miRTarBase - #MIRT069432


—
pre-miRNA Information
pre-miRNA hsa-mir-664a   
Genomic Coordinates chr1: 220200538 - 220200619
Description Homo sapiens miR-664 stem-loop
Comment This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference , and the sequence is homologous with rat mir-664.
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-664a-3p
Sequence 49| UAUUCAUUUAUCCCCAGCCUACA |71
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30457627 12 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1478242335 2 dbSNP
rs1042905485 5 dbSNP
rs908858734 6 dbSNP
rs1229753248 8 dbSNP
rs770101636 12 dbSNP
rs746047168 14 dbSNP
rs1170225715 15 dbSNP
rs1404740911 16 dbSNP
rs1393962832 17 dbSNP
rs1377901643 18 dbSNP
rs1313271494 19 dbSNP
rs1416447585 20 dbSNP
rs1368463251 21 dbSNP
rs1167925254 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SIVA1   
Synonyms CD27BP, SIVA, Siva-1, Siva-2
Description SIVA1 apoptosis inducing factor
Transcript NM_006427   
Other Transcripts NM_021709   
Expression
Putative miRNA Targets on SIVA1
3'UTR of SIVA1
(miRNA target sites are highlighted)		 
>SIVA1|NM_006427|3'UTR
   1 GGCTGGCTCAAGCCGGCTGCCTTCACCGGGAGCCACGCCGTGCATGGCAGCCTTCCCTGGACGAGCGCTCGGTGTTCACA
  81 CTGAACTGTGGGGTCGACGGGAGGGGTGCCTTTTACATGTTCTATTTTGTATCCTAATGACAGAATGAATAAACCTCTTT
 161 ATATTTGCACAAGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acAUCCGACCCCUAU-UUACUUAu 5'
            ||  ||   || | ||||||| 
Target 5' tgTATCCTAATGACAGAATGAATa 3'
 128 - 151 149.00 -6.30
2 
miRNA  3' acaUC-CGACCCCUA--U-UUACUUau 5'
             || ||| || :|  | | ||||  
Target 5' acgAGCGCTCGGTGTTCACACTGAAct 3'
 61 - 87 102.00 -6.50
3 
miRNA  3' acAUCCGA-C--CCCUAUUUACUUAu 5'
            |:|| | |  |||| :::||  | 
Target 5' tgTGGGGTCGACGGGAGGGGTGCCTt 3'
 87 - 112 67.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31533054 2 COSMIC
COSN26994768 20 COSMIC
COSN31564022 27 COSMIC
COSN30177646 28 COSMIC
COSN26994767 51 COSMIC
COSN30101665 68 COSMIC
COSN30104729 73 COSMIC
COSN30506454 82 COSMIC
COSN24313482 96 COSMIC
COSN30695887 99 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs370091956 2 dbSNP
rs1273644973 3 dbSNP
rs758605452 4 dbSNP
rs778018804 7 dbSNP
rs757236168 13 dbSNP
rs1340247228 14 dbSNP
rs781346755 15 dbSNP
rs981256096 16 dbSNP
rs373057611 17 dbSNP
rs770492092 22 dbSNP
rs539489780 26 dbSNP
rs749722984 28 dbSNP
rs376249415 29 dbSNP
rs559184664 30 dbSNP
rs369632432 33 dbSNP
rs771423066 37 dbSNP
rs939433826 38 dbSNP
rs1240888506 39 dbSNP
rs1411948331 40 dbSNP
rs185050950 41 dbSNP
rs1370855432 44 dbSNP
rs760524308 45 dbSNP
rs766361338 49 dbSNP
rs376097428 52 dbSNP
rs1366823934 57 dbSNP
rs913919354 63 dbSNP
rs945272947 64 dbSNP
rs14905 67 dbSNP
rs903671280 68 dbSNP
rs1207487631 71 dbSNP
rs943253471 72 dbSNP
rs1429096909 73 dbSNP
rs1197820822 74 dbSNP
rs1039194179 96 dbSNP
rs901556140 97 dbSNP
rs910160519 99 dbSNP
rs755781334 100 dbSNP
rs866898731 107 dbSNP
rs1416473725 118 dbSNP
rs1282404707 123 dbSNP
rs868482343 125 dbSNP
rs572913554 126 dbSNP
rs1347347021 135 dbSNP
rs777463831 138 dbSNP
rs1017229532 148 dbSNP
rs922573055 155 dbSNP
rs1133044 158 dbSNP
rs539577951 158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000347067.5 | 3UTR | AAUAAACCUCUUUAUAUUUGCACAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.327 6.4e-2 -0.345 5.3e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.314 6.8e-2 -0.373 3.6e-2 24 Click to see details
GSE38226 Liver fibrosis 0.318 8.0e-2 0.151 2.6e-1 21 Click to see details
GSE28260 Renal cortex and medulla -0.387 9.6e-2 -0.500 4.1e-2 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.187 1.9e-1 0.197 1.7e-1 25 Click to see details
GSE28544 Breast cancer 0.07 3.7e-1 0.208 1.6e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.042 4.1e-1 0.002 5.0e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA 0.481 0.07 0.455 0.08 11 Click to see details
PAAD 0.849 0.08 0.800 0.1 4 Click to see details
BRCA 0.146 0.09 0.133 0.11 84 Click to see details
STAD -0.237 0.1 -0.159 0.19 32 Click to see details
KICH -0.244 0.12 -0.303 0.07 25 Click to see details
CHOL -0.429 0.12 -0.383 0.15 9 Click to see details
COAD 0.41 0.16 0.357 0.19 8 Click to see details
KIRC 0.099 0.21 -0.015 0.45 68 Click to see details
LUSC 0.128 0.22 0.176 0.15 38 Click to see details
THCA 0.087 0.26 0.180 0.09 59 Click to see details
HNSC -0.099 0.27 -0.124 0.22 42 Click to see details
LIHC 0.083 0.29 0.059 0.34 49 Click to see details
UCEC -0.127 0.3 -0.025 0.46 19 Click to see details
LUAD 0.128 0.35 0.042 0.45 12 Click to see details
KIRP -0.024 0.45 0.022 0.45 32 Click to see details
BLCA 0.027 0.46 -0.129 0.3 18 Click to see details
PRAD -0.011 0.47 0.018 0.45 50 Click to see details
CESC 0.083 0.47 -0.500 0.33 3 Click to see details
PCPG 0.082 0.47 -0.500 0.33 3 Click to see details
PCPG 0.082 0.47 -0.500 0.33 3 Click to see details
PCPG 0.082 0.47 -0.500 0.33 3 Click to see details
88 hsa-miR-664a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035824 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT035826 FUS FUS RNA binding protein 1 1
MIRT069432 SIVA1 SIVA1 apoptosis inducing factor 2 2
MIRT071494 CALM1 calmodulin 1 2 2
MIRT100410 HSPA1B heat shock protein family A (Hsp70) member 1B 2 2
MIRT143469 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT191113 ARF6 ADP ribosylation factor 6 2 2
MIRT235584 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT339131 ARID1A AT-rich interaction domain 1A 2 2
MIRT437450 MAT1A methionine adenosyltransferase 1A 1 1
MIRT442234 BTD biotinidase 2 2
MIRT443321 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443769 HLF HLF, PAR bZIP transcription factor 2 2
MIRT444352 KIAA1211 KIAA1211 2 2
MIRT456348 OLIG3 oligodendrocyte transcription factor 3 2 8
MIRT458866 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT466169 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470445 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT471524 PCGF3 polycomb group ring finger 3 2 6
MIRT477744 EDN1 endothelin 1 2 2
MIRT482885 CACNA2D3 calcium voltage-gated channel auxiliary subunit alpha2delta 3 2 2
MIRT496336 PTPRT protein tyrosine phosphatase, receptor type T 2 2
MIRT497703 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 2
MIRT499068 CTBP1 C-terminal binding protein 1 2 4
MIRT500296 ZNF667 zinc finger protein 667 2 8
MIRT500506 ZBTB34 zinc finger and BTB domain containing 34 2 8
MIRT501964 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT505457 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT505955 RAN RAN, member RAS oncogene family 2 6
MIRT507512 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT512953 MKI67 marker of proliferation Ki-67 2 2
MIRT520450 TSPAN2 tetraspanin 2 2 6
MIRT525997 MAGEL2 MAGE family member L2 2 2
MIRT526424 ZNF695 zinc finger protein 695 2 2
MIRT527364 KRTAP13-2 keratin associated protein 13-2 2 2
MIRT529612 H1F0 H1 histone family member 0 2 2
MIRT529811 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT530971 EXO5 exonuclease 5 2 4
MIRT531294 WNT7A Wnt family member 7A 2 2
MIRT531870 POF1B premature ovarian failure, 1B 2 2
MIRT532116 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT533534 TPR translocated promoter region, nuclear basket protein 2 2
MIRT545934 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546649 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT548063 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT548288 FAM3C family with sequence similarity 3 member C 2 4
MIRT551018 SPPL3 signal peptide peptidase like 3 2 2
MIRT551139 ZNF678 zinc finger protein 678 2 2
MIRT552398 ZNF487P zinc finger protein 487 1 1
MIRT555640 PHIP pleckstrin homology domain interacting protein 2 4
MIRT556267 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT558864 CD2AP CD2 associated protein 2 2
MIRT559239 BEND4 BEN domain containing 4 2 2
MIRT559438 ARSJ arylsulfatase family member J 2 2
MIRT559793 ZNF415 zinc finger protein 415 2 2
MIRT562572 CBX6 chromobox 6 2 2
MIRT562741 ZNF83 zinc finger protein 83 2 2
MIRT564737 ZNF23 zinc finger protein 23 2 2
MIRT565174 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT566301 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT571656 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT610720 NAV2 neuron navigator 2 2 2
MIRT611486 ADCYAP1R1 ADCYAP receptor type I 2 4
MIRT617118 KANK2 KN motif and ankyrin repeat domains 2 2 2
MIRT617836 SIGLEC10 sialic acid binding Ig like lectin 10 2 2
MIRT636145 VLDLR very low density lipoprotein receptor 2 2
MIRT638060 YAE1D1 Yae1 domain containing 1 2 4
MIRT640159 CDK13 cyclin dependent kinase 13 2 2
MIRT644257 WEE2 WEE1 homolog 2 2 2
MIRT646838 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT653074 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2 2
MIRT657671 GPR26 G protein-coupled receptor 26 2 2
MIRT660601 AP3M2 adaptor related protein complex 3 mu 2 subunit 2 2
MIRT668908 CREB1 cAMP responsive element binding protein 1 2 2
MIRT672685 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT680977 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682271 RS1 retinoschisin 1 2 2
MIRT702058 RNMT RNA guanine-7 methyltransferase 2 2
MIRT707786 UNK unkempt family zinc finger 2 2
MIRT709238 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710119 MED23 mediator complex subunit 23 2 2
MIRT710675 ADAP2 ArfGAP with dual PH domains 2 2 2
MIRT712884 NIPBL NIPBL, cohesin loading factor 2 2
MIRT719015 HPGD 15-hydroxyprostaglandin dehydrogenase 2 2
MIRT723323 COLEC10 collectin subfamily member 10 2 2
MIRT724947 TXNL1 thioredoxin like 1 2 2
MIRT725535 EN2 engrailed homeobox 2 2 2
MIRT734156 FHL1 four and a half LIM domains 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-664a Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-mir-664a Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-664a Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-miR-664a-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-664a-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-664a-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-664a-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-664a-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-664a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-miR-664a-3p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-664a-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-664a-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-664a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-664a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-664a-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-664a-3p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-664a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-664a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-664a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-664a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission