| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-124-1 |
| Genomic Coordinates | chr8: 9903388 - 9903472 |
| Description | Homo sapiens miR-124-1 stem-loop |
| Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| pre-miRNA | hsa-mir-124-2 |
| Genomic Coordinates | chr8: 64379149 - 64379257 |
| Description | Homo sapiens miR-124-2 stem-loop |
| Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
| RNA Secondary Structure | |
| Associated Diseases |  |
| pre-miRNA | hsa-mir-124-3 |
| Genomic Coordinates | chr20: 63178500 - 63178586 |
| Description | Homo sapiens miR-124-3 stem-loop |
| Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
| RNA Secondary Structure | |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-124-5p | ||||||||||||||||||||||||||||||
| Sequence | 14| CGUGUUCACAGCGGACCUUGAU |35 | ||||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||||
| Experiments | Cloned | ||||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | FOXG1 | ||||||||||||||||||||
| Synonyms | BF1, BF2, FHKL3, FKH2, FKHL1, FKHL2, FKHL3, FKHL4, FOXG1A, FOXG1B, FOXG1C, HBF-1, HBF-2, HBF-3, HBF-G2, HBF2, HFK1, HFK2, HFK3, KHL2, QIN | ||||||||||||||||||||
| Description | forkhead box G1 | ||||||||||||||||||||
| Transcript | NM_005249 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on FOXG1 | |||||||||||||||||||||
| 3'UTR of FOXG1 (miRNA target sites are highlighted) |
>FOXG1|NM_005249|3'UTR 1 CATCCCTGGGACCAGACTGTAAGTGAACGTTTTACACACATTTGCATTGTAAATGATAATTAAAAAAATAAGTCCAGGTA 81 TTTTTTATTAAGCCCCCCCCTCCCATTTCTGTACGTTTGTTCAGTCTCTAGGGTTGTTTATTATTCTAACAAGGTGTGGA 161 GTGTCAGCGAGGTGCAATGTGGGGAGAATACATTGTAGAATATAAGGTTTGGAAGTCAAATTATAGTAGAATGTGTATCT 241 AAATAGTGACTGCTTTGCCATTTCATTCAAACCTGACAAGTCTATCTCTAAGAGCCGCCAGATTTCCATGTGTGCAGTAT 321 TATAAGTTATCATGGAACTATATGGTGGACGCAGACCTTGAGAACAACCTAAATTATGGGGAGAATTTTAAAATGTTAAA 401 CTGTAATTTGTATTTAAAAAGCATTCGTAGTAAAGGTGCCCAAGAAATTATTTTGGCCATTTATTGTTTTGTCCTTTTCT 481 TTAAAGAACTGTTTTTTTTTCTTTTGTTTACTTTTAGACCAAAGATTGGGTTCTAGAAAATGCACTTGGTATACTAAGTA 561 TTAAAACAAACAAAAAGGAAAGTTGTTTCAGTTGGCAACACTGCCCATTCAATTGAATCAGAAGGGGACAAAATTAACGA 641 TTGCCTTCAGTTTGTGTTGTGTATATTTTGATGTATGTGGTCACTAACAGGTCACTTTTATTTTTTCTAAATGTAGTGAA 721 ATGTTAATACCTATTGTACTTATAGGTAAACCTTGCAAATATGTAACCTGTGTTGCGCAAATGCCGCATAAATTTGAGTG 801 ATTGTTAATGTTGTCTTAAAATTTCTTGATTGTGATACTGTGGTCATATGCCCGTGTTTGTCACTTACAAAAATGTTTAC 881 TATGAACACACAGAAATAAAAAATAGGCTAAATTCATATATATCTTGATACTTTTGTCTCTTTTATTAAGTAGAGCTAAT 961 TTTTTAAAGACCAATCAACTTATAGGGAATTCAAAGGCTTTTTCAGCCAAACTAAAATTTAAACTGCTCCTTTAATTTGA 1041 ACTGACTCTAAAAATGAAAATAGTATTTTTCCCTTTGTGAACAAATTTTACAAGGAGCAGCCTATTTAATAAACACTAGC 1121 TTTAAACAAAGTATAGGCTTTTCAGCTGATACCTGTAAGTTTCTGTGGATATACAGCAAAAAGAGATATAATTTAATTTT 1201 CTGTGCATAGCTCTTTACCCTGTGTTTATTTCCAAATCCATTAATAGAATGCCATTTATATATTTTGTTTCAGGTATATT 1281 GTTAATAGAGCTTGGCAAATTATAAATAAATATATGTATATGGTTAGATAGAAGTGACTATAATGCACACATATGTAATA 1361 TATATAGACACACAGAGCCCTTCAGTTCAGGTACAATTTGCGCTATGAATGCTGCAAACATTTTTGTTTAAATATTTGTA 1441 TTTATACTTTCTAAGTCAGCATTTATTTTTGTGGCTGTTTACCCACAATGAAAGAGTTCTAATAAAGATGTGCTGAAGTT 1521 GCAATATAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 2290.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| CLIP-seq Support 1 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000382535.3 | 3UTR | UCACUUACAAAAAUGUUUACUAUGAACACACA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000382535.3 | 3UTR | UCACUUACAAAAAUGUUUACUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT064177 | KIAA1804 | mitogen-activated protein kinase kinase kinase 21 |  |
|
2 | 2 | ||||||
| MIRT069736 | FOXG1 | forkhead box G1 | |
|
2 | 4 | ||||||
| MIRT086429 | NABP1 | nucleic acid binding protein 1 | |
|
2 | 6 | ||||||
| MIRT105334 | SLC7A2 | solute carrier family 7 member 2 | |
|
2 | 4 | ||||||
| MIRT110455 | PLEKHA1 | pleckstrin homology domain containing A1 | |
|
2 | 2 | ||||||
| MIRT172998 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | |
|
2 | 2 | ||||||
| MIRT196428 | TAOK1 | TAO kinase 1 | |
|
2 | 14 | ||||||
| MIRT325704 | CSTF2 | cleavage stimulation factor subunit 2 | |
|
2 | 2 | ||||||
| MIRT365670 | TSC22D3 | TSC22 domain family member 3 | |
|
2 | 4 | ||||||
| MIRT365873 | XIAP | X-linked inhibitor of apoptosis | |
|
2 | 2 | ||||||
| MIRT404126 | ASB1 | ankyrin repeat and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT404626 | LCOR | ligand dependent nuclear receptor corepressor | |
|
2 | 2 | ||||||
| MIRT405284 | ARF1 | ADP ribosylation factor 1 | |
|
2 | 2 | ||||||
| MIRT406099 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
|
2 | 2 | ||||||
| MIRT446627 | SDC3 | syndecan 3 | |
|
2 | 2 | ||||||
| MIRT446906 | RGS5 | regulator of G protein signaling 5 | |
|
2 | 2 | ||||||
| MIRT461790 | FXR2 | FMR1 autosomal homolog 2 | |
|
2 | 2 | ||||||
| MIRT463982 | WEE1 | WEE1 G2 checkpoint kinase | |
|
2 | 4 | ||||||
| MIRT464204 | VGLL4 | vestigial like family member 4 | |
|
2 | 2 | ||||||
| MIRT472790 | MTMR4 | myotubularin related protein 4 | |
|
2 | 4 | ||||||
| MIRT473485 | MCFD2 | multiple coagulation factor deficiency 2 | |
|
2 | 2 | ||||||
| MIRT481124 | AZIN1 | antizyme inhibitor 1 | |
|
2 | 4 | ||||||
| MIRT485060 | SUCO | SUN domain containing ossification factor | |
|
2 | 2 | ||||||
| MIRT487343 | HLA-DRA | major histocompatibility complex, class II, DR alpha | |
|
2 | 2 | ||||||
| MIRT491948 | VPS52 | VPS52, GARP complex subunit | |
|
2 | 2 | ||||||
| MIRT497208 | CDH7 | cadherin 7 | |
|
2 | 2 | ||||||
| MIRT497476 | TOR1AIP2 | torsin 1A interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT528203 | NELFE | negative elongation factor complex member E | |
|
2 | 2 | ||||||
| MIRT529255 | TRIM4 | tripartite motif containing 4 | |
|
2 | 4 | ||||||
| MIRT530096 | PSAPL1 | prosaposin like 1 (gene/pseudogene) | |
|
2 | 2 | ||||||
| MIRT530597 | C7orf33 | chromosome 7 open reading frame 33 | |
|
2 | 4 | ||||||
| MIRT534980 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 4 | ||||||
| MIRT538326 | CSGALNACT1 | chondroitin sulfate N-acetylgalactosaminyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT561237 | ZNF652 | zinc finger protein 652 | |
|
2 | 2 | ||||||
| MIRT562035 | KRAS | KRAS proto-oncogene, GTPase | |
|
2 | 2 | ||||||
| MIRT563120 | THAP5 | THAP domain containing 5 | |
|
2 | 2 | ||||||
| MIRT563538 | RBM41 | RNA binding motif protein 41 | |
|
2 | 2 | ||||||
| MIRT566037 | REV3L | REV3 like, DNA directed polymerase zeta catalytic subunit | |
|
2 | 2 | ||||||
| MIRT566505 | PAWR | pro-apoptotic WT1 regulator | |
|
2 | 2 | ||||||
| MIRT566745 | MRPL35 | mitochondrial ribosomal protein L35 | |
|
2 | 2 | ||||||
| MIRT566850 | LRRC58 | leucine rich repeat containing 58 | |
|
2 | 2 | ||||||
| MIRT568077 | CELF2 | CUGBP Elav-like family member 2 | |
|
2 | 2 | ||||||
| MIRT576826 | Tgfbr3 | transforming growth factor, beta receptor III | |
|
2 | 2 | ||||||
| MIRT608870 | NR2E1 | nuclear receptor subfamily 2 group E member 1 | |
|
2 | 4 | ||||||
| MIRT611997 | VAC14 | Vac14, PIKFYVE complex component | |
|
2 | 2 | ||||||
| MIRT614054 | FAM89A | family with sequence similarity 89 member A | |
|
2 | 2 | ||||||
| MIRT618800 | SPATA21 | spermatogenesis associated 21 | |
|
2 | 2 | ||||||
| MIRT619389 | RSPH3 | radial spoke head 3 homolog | |
|
2 | 2 | ||||||
| MIRT622282 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | |
|
2 | 2 | ||||||
| MIRT624026 | EN2 | engrailed homeobox 2 | |
|
2 | 2 | ||||||
| MIRT626000 | MPEG1 | macrophage expressed 1 | |
|
2 | 2 | ||||||
| MIRT641792 | USP32 | ubiquitin specific peptidase 32 | |
|
2 | 2 | ||||||
| MIRT651599 | WDFY2 | WD repeat and FYVE domain containing 2 | |
|
2 | 2 | ||||||
| MIRT659662 | CDC73 | cell division cycle 73 | |
|
2 | 2 | ||||||
| MIRT663010 | KIAA1586 | KIAA1586 | |
|
2 | 2 | ||||||
| MIRT663561 | ASTN2 | astrotactin 2 | |
|
2 | 2 | ||||||
| MIRT669312 | C16orf72 | chromosome 16 open reading frame 72 | |
|
2 | 2 | ||||||
| MIRT685216 | POTED | POTE ankyrin domain family member D | |
|
2 | 2 | ||||||
| MIRT695757 | ZNF117 | zinc finger protein 117 | |
|
2 | 2 | ||||||
| MIRT697909 | TXNRD1 | thioredoxin reductase 1 | |
|
2 | 2 | ||||||
| MIRT707181 | RPH3A | rabphilin 3A | |
|
2 | 2 | ||||||
| MIRT707214 | TRIM13 | tripartite motif containing 13 | |
|
2 | 2 | ||||||
| MIRT707478 | SLCO4C1 | solute carrier organic anion transporter family member 4C1 | |
|
2 | 2 | ||||||
| MIRT719507 | LMAN2L | lectin, mannose binding 2 like | |
|
2 | 2 | ||||||
| MIRT755814 | PARP1 | poly(ADP-ribose) polymerase 1 | 2 | 1 | ||||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|