| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-570 |
| Genomic Coordinates | chr3: 195699401 - 195699497 |
| Synonyms | MIRN570, hsa-mir-570, MIR570 |
| Description | Homo sapiens miR-570 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations. |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-570-3p | |||||||||||||||||||||||||||||||||
| Sequence | 60| CGAAAACAGCAAUUACCUUUGC |81 | |||||||||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||||||||
| Experiments | SAGE | |||||||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | TNRC6A | ||||||||||||||||||||
| Synonyms | CAGH26, GW1, GW182, TNRC6 | ||||||||||||||||||||
| Description | trinucleotide repeat containing 6A | ||||||||||||||||||||
| Transcript | NM_014494 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on TNRC6A | |||||||||||||||||||||
| 3'UTR of TNRC6A (miRNA target sites are highlighted) |
>TNRC6A|NM_014494|3'UTR 1 CAGTGTAGATGCAGACTCACCGACCGGGACCTCAGACGCGAGGGAAAGGAGCACTAAGTGGGGCTCGCCGCCTGCAGCCA 81 GGGGCCGCCTGTGGGAACAGCTATTCTCTGCACATTTTCCACTTTGTTTTCCCCAAAACATATCAGTTTGAATACTTGAA 161 TCATGCAGGCCAATATTATAATGTGAAAAGGTATCTACTCTATTTACACTCCCAAATAGCGCCATACATGCTAAACCGTA 241 GAGAATGAGCTCGCTTGTGTCTATTCATCATGTTTAGCCTTTGGATTCTTTTTTTTTTTTTCCTTCTATTCCTCCCCAAC 321 CCCCCCCCCCGCCCCTTTTTTTCTCTCTTGCAAAACCATTTTTTGGGCTGATAACGTATGAGCTTTTCCCTTTGCACTGA 401 ATGATGTTCTCTCCGTCTCATCGGCAGTATGGGGGGCAGCTGTCCCAGTGTCAATGTTTACTCAAGGGTGTTCTTAGGAG 481 GCGTGCGCTCTCTACTATGCCTTGATGTTGCCTACCTTATTGTGGTATCGTGGAGTTTAAAAGATCAAGTTAGGATGCTG 561 ACTTAGGATTATTAATGAAAGTGTTGCACCAGTTTTTTCATGTTGTAAAACTAAAGAATTTCGCTCTGCAGTTTGAAAAA 641 CTGTGGCCACAGCTGTGACTTGCAGCCCACCTGCCACCCAGGACGGGCCCTGCACTTTGAATAGGCTTTCCATTTTGTTT 721 TGGAGGTTCTCACTTTGAACCTTCTTGTTTACAGATTTTTTTGTTTGTTTTTTGAGAAAAAAAAATGTTTACTCTTCCAT 801 CATTTAAAAAAAATGTAAAAGACAAAAAAAAAATGGAGGATGATTTAAAAGATGCTTTCTATCTCTGGGAAAAAGGAGCA 881 GCATTTGGCCATGTTCTTTTGTTTTTCTATTCCTGTCCCAAATCAAAGAGCATGGTTCTCAGGAAAACCAGTTCCCCAGT 961 TTAAAAAAAAAAAAAAAAATTCCTTGTAGTTTCTTAGAGGAAAAAAAGAAAAACCCCAACTTTTAGCACTGATACTACAT 1041 ATTGCTCTGTTAAAGAATTTTCTCTGCCAAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCTGC 1121 TTTCAGATGCTGTCTTTTTATTAGTGAGTGATGATGGTTTGCTAATAATCAATAGGTAATAATTTTTTGTAATCCCATCA 1201 AGTGGCTCCATATGTTTCTGCTCTCTCGTGACTGTGTTAATGTTTAACTGTTGTACCTTAAAGCCGAAATCAGTAACTAT 1281 GCATACTGTAACCAAGGTATTGGGCTTACAGAGTTGTTTGTTGTATAAAGAAAATTTTAAATGTTGTTGCAAACTAACGA 1361 GTTACACCATTTTAAACTTTCTTTCCTCCCCCCTTTTTTTGCCCACAAATGGTATTATAATGCTTGCTTAGTCAAAGAAG 1441 AGAGACTAAACAAGGGTAAAAATTTTAACAGTACAGAATTTGCCATCATATCATTGCCTTGATTCTAACTGTTTGTGTCC 1521 TAAGATGCAAAAGAAGTCAGTGGCTTTTAACTGTTTACAAATAGAATGTGATTGTAAAATGTACAGTTTGGTTGTGTTTG 1601 AATTATGAAATTTCTTCAGATATAATAAACCATGACTTTTTGGCTGCTCAACATTAATTGTCTCCTTTTTGTGAATTTAT 1681 TTGTAGGCTCTTTTTTATAATGAAAGTTTCAAAGTTGCTATGTATGAGGGTTCTCATAGAGCAACCGATTAAAAATCTAA 1761 GCAAATATTTGAACATTTTATCTGAACTCATCACAATTTCACCCTGAAATAATGTGAGAACAATGGGAAACTGTAGCTTG 1841 CTCCTTCCCACCCTCTCTGAGCATCTTTGGGATCTTGTTGCTCAAAACTCTTCTGTGACTTCATCTTCCCCACCATTTGT 1921 GCCCATCTCAAGCCTCAGCAAGAAACCATGTGGAACATGAAGCTTAATGACTTGACAGTGTACTAGTGTTAAACTCTCAT 2001 ACCTCTGTTACAAAGCGAGAAACGCCACACCCGGACTGGCCTTTTCTTCCCCCTTCACGGCCCTCGCTTCTCCCTGCAGG 2081 AGCTCGGGGGCGAAACCTGTGTATGGATTTCAGTGTATGACTTCAGATCATGCTCCAACTTGCCAGGTGTGAGCTAATGT 2161 TGTCGGACACCTTACTATAAGCAAATGTTATTCAGTGCGTTCAATGTATATTGACTTCCATACTGGTTTTTCCAAAAACC 2241 AAAGGTAGCTTTGAAAAACCATGTCTGGAAATGTTTGGAGCGTTAAGCTGATTGACCTTCTGACCTTGGGGCTTTGAGTA 2321 GTATATAATTCATAACTGCGTTAATTGTATTGTTAAAGTGTTTGGGAGTTTTTTGCGCTTGTTATGTGGAAATAAAGTGT 2401 TTGATTTAAAATTTTTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 27327.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 27327.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 27327.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| CLIP-seq Support 1 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000395799.3 | 3UTR | AUUCUCUGCACAUUUUCCACUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000395799.3 | 3UTR | CUAUUCUCUGCACAUUUUCCACUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000395799.3 | 3UTR | CUAUUCUCUGCACAUUUUCCACUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000395799.3 | 3UTR | CUAUUCUCUGCACAUUUUCCACUUUGUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000395799.3 | 3UTR | GCUAUUCUCUGCACAUUUUCCACUUUGUUUUCCCCAAAACAUAUCAGUUUGAAUACUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
166 hsa-miR-570-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT053484 | CD274 | CD274 molecule |  |
|
2 | 2 | ||||||
| MIRT056153 | OTUD1 | OTU deubiquitinase 1 | |
|
2 | 2 | ||||||
| MIRT057406 | TNKS2 | tankyrase 2 | |
|
2 | 2 | ||||||
| MIRT065096 | SLC38A1 | solute carrier family 38 member 1 | |
|
2 | 2 | ||||||
| MIRT073901 | ARL6IP1 | ADP ribosylation factor like GTPase 6 interacting protein 1 | |
|
2 | 8 | ||||||
| MIRT074322 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 8 | ||||||
| MIRT077514 | UBE2Z | ubiquitin conjugating enzyme E2 Z | |
|
2 | 4 | ||||||
| MIRT082532 | CALM3 | calmodulin 3 | |
|
2 | 2 | ||||||
| MIRT084575 | BCL2L11 | BCL2 like 11 | |
|
2 | 4 | ||||||
| MIRT092028 | ABHD5 | abhydrolase domain containing 5 | |
|
2 | 6 | ||||||
| MIRT099121 | MYLIP | myosin regulatory light chain interacting protein | |
|
2 | 8 | ||||||
| MIRT102992 | RBM33 | RNA binding motif protein 33 | |
|
2 | 8 | ||||||
| MIRT105434 | ATP6V1B2 | ATPase H+ transporting V1 subunit B2 | |
|
2 | 10 | ||||||
| MIRT109568 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT145281 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT150161 | MIDN | midnolin | |
|
2 | 2 | ||||||
| MIRT167432 | TRIP13 | thyroid hormone receptor interactor 13 | |
|
2 | 2 | ||||||
| MIRT168486 | HSPA1B | heat shock protein family A (Hsp70) member 1B | |
|
2 | 4 | ||||||
| MIRT172128 | KLF10 | Kruppel like factor 10 | |
|
|
|
4 | 2 | ||||
| MIRT215596 | SUB1 | SUB1 homolog, transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT259928 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 2 | ||||||
| MIRT274852 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 4 | ||||||
| MIRT290491 | C18ORF25 | chromosome 18 open reading frame 25 | |
|
2 | 2 | ||||||
| MIRT290941 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | |
|
2 | 4 | ||||||
| MIRT322703 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 2 | ||||||
| MIRT358568 | CANX | calnexin | |
|
2 | 2 | ||||||
| MIRT381250 | RMND5A | required for meiotic nuclear division 5 homolog A | |
|
2 | 2 | ||||||
| MIRT442077 | NDRG1 | N-myc downstream regulated 1 | |
|
2 | 2 | ||||||
| MIRT442943 | C17orf105 | chromosome 17 open reading frame 105 | |
|
2 | 2 | ||||||
| MIRT444267 | ATOX1 | antioxidant 1 copper chaperone | |
|
2 | 2 | ||||||
| MIRT444365 | TIMM8B | translocase of inner mitochondrial membrane 8 homolog B | |
|
2 | 2 | ||||||
| MIRT444863 | SAMD12 | sterile alpha motif domain containing 12 | |
|
2 | 2 | ||||||
| MIRT444871 | ISPD | isoprenoid synthase domain containing | |
|
2 | 2 | ||||||
| MIRT445077 | CXXC4 | CXXC finger protein 4 | |
|
2 | 2 | ||||||
| MIRT445717 | NAP1L6 | nucleosome assembly protein 1 like 6 | |
|
2 | 2 | ||||||
| MIRT445945 | SCML4 | Scm polycomb group protein like 4 | |
|
2 | 2 | ||||||
| MIRT446054 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | |
|
2 | 2 | ||||||
| MIRT446704 | FUT10 | fucosyltransferase 10 | |
|
2 | 2 | ||||||
| MIRT446726 | SPAG11A | sperm associated antigen 11A | |
|
2 | 2 | ||||||
| MIRT447147 | HHIP | hedgehog interacting protein | |
|
2 | 2 | ||||||
| MIRT447566 | LLPH | LLP homolog, long-term synaptic facilitation | |
|
2 | 2 | ||||||
| MIRT448698 | KLRC4 | killer cell lectin like receptor C4 | |
|
2 | 2 | ||||||
| MIRT448778 | GNA13 | G protein subunit alpha 13 | |
|
2 | 2 | ||||||
| MIRT449290 | GMNC | geminin coiled-coil domain containing | |
|
2 | 2 | ||||||
| MIRT449673 | SOX3 | SRY-box 3 | |
|
2 | 2 | ||||||
| MIRT450020 | EPM2AIP1 | EPM2A interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT450089 | OR2A4 | olfactory receptor family 2 subfamily A member 4 | |
|
2 | 2 | ||||||
| MIRT450209 | PAIP1 | poly(A) binding protein interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT450271 | F2RL2 | coagulation factor II thrombin receptor like 2 | |
|
2 | 2 | ||||||
| MIRT450402 | TMEM47 | transmembrane protein 47 | |
|
2 | 2 | ||||||
| MIRT450419 | BCL2L14 | BCL2 like 14 | |
|
2 | 2 | ||||||
| MIRT450598 | EXOC2 | exocyst complex component 2 | |
|
2 | 2 | ||||||
| MIRT450821 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT453007 | CCDC115 | coiled-coil domain containing 115 | |
|
2 | 17 | ||||||
| MIRT453857 | ZNF12 | zinc finger protein 12 | |
|
2 | 2 | ||||||
| MIRT454706 | HMGN1 | high mobility group nucleosome binding domain 1 | |
|
2 | 4 | ||||||
| MIRT458699 | LEPREL1 | prolyl 3-hydroxylase 2 | |
1 | 1 | |||||||
| MIRT465144 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT468216 | SGK1 | serum/glucocorticoid regulated kinase 1 | |
|
2 | 2 | ||||||
| MIRT469657 | RAC1 | Rac family small GTPase 1 | |
|
2 | 2 | ||||||
| MIRT470155 | PSME3 | proteasome activator subunit 3 | |
|
2 | 2 | ||||||
| MIRT470287 | PRDX5 | peroxiredoxin 5 | |
|
2 | 2 | ||||||
| MIRT470296 | PPTC7 | PTC7 protein phosphatase homolog | |
|
2 | 2 | ||||||
| MIRT472433 | NCBP2 | nuclear cap binding protein subunit 2 | |
|
2 | 2 | ||||||
| MIRT472459 | NASP | nuclear autoantigenic sperm protein | |
|
2 | 2 | ||||||
| MIRT475265 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | |
|
2 | 2 | ||||||
| MIRT476735 | FOXN2 | forkhead box N2 | |
|
2 | 2 | ||||||
| MIRT476757 | FOXK1 | forkhead box K1 | |
|
2 | 2 | ||||||
| MIRT477549 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
|
2 | 2 | ||||||
| MIRT478797 | CRTAP | cartilage associated protein | |
|
2 | 4 | ||||||
| MIRT479661 | CD164 | CD164 molecule | |
|
2 | 4 | ||||||
| MIRT479893 | CCDC117 | coiled-coil domain containing 117 | |
|
2 | 4 | ||||||
| MIRT480325 | C5orf51 | chromosome 5 open reading frame 51 | |
|
2 | 2 | ||||||
| MIRT481229 | ATXN7L3 | ataxin 7 like 3 | |
|
2 | 2 | ||||||
| MIRT484088 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | |
|
2 | 2 | ||||||
| MIRT487507 | GRK5 | G protein-coupled receptor kinase 5 | |
|
2 | 2 | ||||||
| MIRT488356 | PAX2 | paired box 2 | |
|
2 | 2 | ||||||
| MIRT496746 | PDIK1L | PDLIM1 interacting kinase 1 like | |
|
2 | 2 | ||||||
| MIRT496832 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT500913 | STARD13 | StAR related lipid transfer domain containing 13 | |
|
2 | 4 | ||||||
| MIRT502256 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | |
|
2 | 4 | ||||||
| MIRT504078 | C9orf40 | chromosome 9 open reading frame 40 | |
|
2 | 6 | ||||||
| MIRT504890 | MRPL51 | mitochondrial ribosomal protein L51 | |
|
2 | 4 | ||||||
| MIRT509834 | TACR3 | tachykinin receptor 3 | |
|
2 | 4 | ||||||
| MIRT511989 | E2F8 | E2F transcription factor 8 | |
|
2 | 4 | ||||||
| MIRT524543 | CDC5L | cell division cycle 5 like | |
|
2 | 4 | ||||||
| MIRT526673 | ZNF791 | zinc finger protein 791 | |
|
2 | 2 | ||||||
| MIRT527410 | SMU1 | DNA replication regulator and spliceosomal factor | |
|
2 | 2 | ||||||
| MIRT528393 | PGK1 | phosphoglycerate kinase 1 | |
|
2 | 2 | ||||||
| MIRT529318 | PDE5A | phosphodiesterase 5A | |
|
2 | 2 | ||||||
| MIRT529844 | SMTN | smoothelin | |
|
2 | 2 | ||||||
| MIRT531461 | TNFRSF10B | TNF receptor superfamily member 10b | |
|
2 | 4 | ||||||
| MIRT535096 | PODXL | podocalyxin like | |
|
2 | 2 | ||||||
| MIRT535294 | PHF6 | PHD finger protein 6 | |
|
2 | 2 | ||||||
| MIRT537542 | ETS1 | ETS proto-oncogene 1, transcription factor | |
|
2 | 2 | ||||||
| MIRT540200 | ARHGAP18 | Rho GTPase activating protein 18 | |
|
2 | 2 | ||||||
| MIRT543416 | C5orf42 | chromosome 5 open reading frame 42 | |
|
2 | 2 | ||||||
| MIRT543873 | SLC16A9 | solute carrier family 16 member 9 | |
|
2 | 2 | ||||||
| MIRT544393 | SMC5 | structural maintenance of chromosomes 5 | |
|
2 | 2 | ||||||
| MIRT544919 | MBLAC2 | metallo-beta-lactamase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT546579 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT548834 | CHD1 | chromodomain helicase DNA binding protein 1 | |
|
2 | 4 | ||||||
| MIRT550787 | WARS2 | tryptophanyl tRNA synthetase 2, mitochondrial | |
|
2 | 2 | ||||||
| MIRT553434 | TPM3 | tropomyosin 3 | |
|
2 | 2 | ||||||
| MIRT557467 | GRB10 | growth factor receptor bound protein 10 | |
|
2 | 4 | ||||||
| MIRT558065 | ESCO2 | establishment of sister chromatid cohesion N-acetyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT558258 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 2 | ||||||
| MIRT559205 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | |
|
2 | 2 | ||||||
| MIRT561072 | SRRM4 | serine/arginine repetitive matrix 4 | |
|
2 | 2 | ||||||
| MIRT561805 | PAPD5 | poly(A) RNA polymerase D5, non-canonical | |
|
2 | 2 | ||||||
| MIRT563875 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
|
2 | 4 | ||||||
| MIRT565835 | SCML2 | Scm polycomb group protein like 2 | |
|
2 | 2 | ||||||
| MIRT568049 | CHSY1 | chondroitin sulfate synthase 1 | |
|
2 | 2 | ||||||
| MIRT572820 | MYO1C | myosin IC | |
|
2 | 2 | ||||||
| MIRT575423 | Epg5 | ectopic P-granules autophagy protein 5 homolog (C. elegans) | |
|
2 | 4 | ||||||
| MIRT576435 | Ccdc115 | coiled-coil domain containing 115 | |
|
2 | 10 | ||||||
| MIRT576533 | Txlna | taxilin alpha | |
|
2 | 2 | ||||||
| MIRT611715 | EPG5 | ectopic P-granules autophagy protein 5 homolog | |
|
2 | 5 | ||||||
| MIRT612574 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | |
|
2 | 2 | ||||||
| MIRT613945 | IFIT3 | interferon induced protein with tetratricopeptide repeats 3 | |
|
2 | 2 | ||||||
| MIRT614279 | WSCD2 | WSC domain containing 2 | |
|
2 | 2 | ||||||
| MIRT615194 | CLUAP1 | clusterin associated protein 1 | |
|
2 | 2 | ||||||
| MIRT627995 | MTA3 | metastasis associated 1 family member 3 | |
|
2 | 2 | ||||||
| MIRT637069 | DENND2C | DENN domain containing 2C | |
|
2 | 2 | ||||||
| MIRT639912 | SLIT1 | slit guidance ligand 1 | |
|
2 | 2 | ||||||
| MIRT642026 | MYADM | myeloid associated differentiation marker | |
|
2 | 2 | ||||||
| MIRT642844 | SLC5A8 | solute carrier family 5 member 8 | |
|
2 | 2 | ||||||
| MIRT643706 | ZNF736 | zinc finger protein 736 | |
|
2 | 2 | ||||||
| MIRT643835 | RBMY1J | RNA binding motif protein, Y-linked, family 1, member J | |
|
2 | 2 | ||||||
| MIRT644775 | RBMY1B | RNA binding motif protein, Y-linked, family 1, member B | |
|
2 | 2 | ||||||
| MIRT644778 | RBMY1A1 | RNA binding motif protein, Y-linked, family 1, member A1 | |
|
2 | 2 | ||||||
| MIRT644781 | RBMY1D | RNA binding motif protein, Y-linked, family 1, member D | |
|
2 | 2 | ||||||
| MIRT644784 | RBMY1E | RNA binding motif protein, Y-linked, family 1, member E | |
|
2 | 2 | ||||||
| MIRT647495 | ZNF639 | zinc finger protein 639 | |
|
2 | 2 | ||||||
| MIRT648248 | RBMY1F | RNA binding motif protein, Y-linked, family 1, member F | |
|
2 | 2 | ||||||
| MIRT648633 | LEMD2 | LEM domain containing 2 | |
|
2 | 2 | ||||||
| MIRT654626 | PTGFR | prostaglandin F receptor | |
|
2 | 2 | ||||||
| MIRT656345 | MED28 | mediator complex subunit 28 | |
|
2 | 2 | ||||||
| MIRT657354 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
|
2 | 2 | ||||||
| MIRT659635 | CDKN2AIP | CDKN2A interacting protein | |
|
2 | 2 | ||||||
| MIRT659651 | CDH4 | cadherin 4 | |
|
2 | 2 | ||||||
| MIRT660959 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT664139 | ATP6V1G3 | ATPase H+ transporting V1 subunit G3 | |
|
2 | 2 | ||||||
| MIRT666038 | STRBP | spermatid perinuclear RNA binding protein | |
|
2 | 2 | ||||||
| MIRT666200 | SMARCC1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 | |
|
2 | 2 | ||||||
| MIRT681712 | GDF6 | growth differentiation factor 6 | |
|
2 | 2 | ||||||
| MIRT683276 | ZNF99 | zinc finger protein 99 | |
|
2 | 2 | ||||||
| MIRT690312 | MRPS30 | mitochondrial ribosomal protein S30 | |
|
2 | 2 | ||||||
| MIRT691642 | SLC43A3 | solute carrier family 43 member 3 | |
|
2 | 2 | ||||||
| MIRT692270 | GPR157 | G protein-coupled receptor 157 | |
|
2 | 2 | ||||||
| MIRT692840 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT697820 | UBQLN1 | ubiquilin 1 | |
|
2 | 2 | ||||||
| MIRT698248 | TMEM2 | transmembrane protein 2 | |
|
2 | 2 | ||||||
| MIRT702755 | IGF1R | insulin like growth factor 1 receptor | |
|
2 | 2 | ||||||
| MIRT702918 | CRAMP1L | cramped chromatin regulator homolog 1 | |
|
2 | 2 | ||||||
| MIRT703411 | FYTTD1 | forty-two-three domain containing 1 | |
|
2 | 2 | ||||||
| MIRT704857 | CD46 | CD46 molecule | |
|
2 | 2 | ||||||
| MIRT711066 | BTD | biotinidase | |
|
2 | 2 | ||||||
| MIRT717794 | TGFBR2 | transforming growth factor beta receptor 2 | |
|
2 | 2 | ||||||
| MIRT719676 | SPDYE1 | speedy/RINGO cell cycle regulator family member E1 | |
|
2 | 2 | ||||||
| MIRT720300 | DDHD1 | DDHD domain containing 1 | |
|
2 | 2 | ||||||
| MIRT723496 | WDR33 | WD repeat domain 33 | |
|
2 | 2 | ||||||
| MIRT723934 | SVOP | SV2 related protein | |
|
2 | 2 | ||||||
| MIRT735586 | FUT8 | fucosyltransferase 8 | |
|
2 | 0 | ||||||
| MIRT735935 | EYA3 | EYA transcriptional coactivator and phosphatase 3 | |
|
|
3 | 0 | |||||
| MIRT756075 | HDAC1 | histone deacetylase 1 | 3 | 1 | ||||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|