miRTarBase - #MIRT078652


—
pre-miRNA Information
pre-miRNA hsa-mir-4477a   
Genomic Coordinates chr9: 41233755 - 41233835
Description Homo sapiens miR-4477a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4477a
Sequence 48| CUAUUAAGGACAUUUGUGAUUC |69
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1281813060 1 dbSNP
rs1352899679 1 dbSNP
rs1283566158 2 dbSNP
rs1236244724 4 dbSNP
rs75019967 4 dbSNP
rs1348124293 5 dbSNP
rs34026740 8 dbSNP
rs1288237115 9 dbSNP
rs71262206 10 dbSNP
rs1355759977 11 dbSNP
rs1300249508 16 dbSNP
rs1328879592 18 dbSNP
rs139133717 20 dbSNP
Putative Targets

Gene Information
Gene Symbol ICT1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3396.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuuaguGUUUACAGGAAUUAUc 5'
                ||||   |||||||| 
Target 5' -----uCAAA---CCUUAAUAa 3'
 		1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001545 | 3UTR | GGAGCCAUCACAAGAAUGUUCAUUUGGAAUGAAGGCUGCAGGCACUGGUUGCAGACGUCUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001545 | 3UTR | CUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001545 | 3UTR | GAGCCAUCACAAGAAUGUUCAUUUGGAAUGAAGGCUGCAGGCACUGGUUGCAGACGUCUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001545 | 3UTR | UUUGGAAUGAAGGCUGCAGGCACUGGUUGCAGACGUCUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001545 | 3UTR | CUUGUCUAUAACAUUGGAGCCAUCACAAGAAUGUUCAUUUGGAAUGAAGGCUGCAGGCACUGGUUGCAGACGUCUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001545 | 3UTR | AUGAAGGCUGCAGGCACUGGUUGCAGACGUCUUUAUAGGCAGUCACCAUGUUGUCAAACCUUAAUAAUGCACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000301585.5 | 3UTR | UCAAACCUUAAUAAUGCACCUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000301585.5 | 3UTR | UCAAACCUUAAUAAUGCACCUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055843 PLEKHA1 pleckstrin homology domain containing A1 2 10
MIRT061259 AMOTL1 angiomotin like 1 2 4
MIRT071895 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT076933 MLLT6 MLLT6, PHD finger containing 2 2
MIRT078652 ICT1 mitochondrial ribosomal protein L58 2 2
MIRT083633 PRNP prion protein 2 2
MIRT091629 RPL15 ribosomal protein L15 2 4
MIRT107076 PPP6C protein phosphatase 6 catalytic subunit 2 2
MIRT111191 TRIM33 tripartite motif containing 33 2 2
MIRT114515 ARF6 ADP ribosylation factor 6 2 2
MIRT175250 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT175430 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT178687 FAM102B family with sequence similarity 102 member B 2 2
MIRT189771 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT229450 RPL10 ribosomal protein L10 2 2
MIRT244899 PHF6 PHD finger protein 6 2 2
MIRT249189 AKIRIN1 akirin 1 2 8
MIRT261134 TRIM8 tripartite motif containing 8 2 2
MIRT275561 ZIC5 Zic family member 5 2 4
MIRT275652 ABHD13 abhydrolase domain containing 13 2 2
MIRT288082 UTP18 UTP18, small subunit processome component 2 2
MIRT303605 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT307924 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT316787 FOXC1 forkhead box C1 2 2
MIRT326910 SCML2 Scm polycomb group protein like 2 2 2
MIRT327713 SPIN4 spindlin family member 4 2 2
MIRT331632 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT342506 TMOD3 tropomodulin 3 2 4
MIRT354470 LRRC58 leucine rich repeat containing 58 2 2
MIRT378711 TRIM24 tripartite motif containing 24 2 2
MIRT407462 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT408226 SMAD5 SMAD family member 5 2 4
MIRT441824 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442783 CHD8 chromodomain helicase DNA binding protein 8 2 2
MIRT443184 NHS NHS actin remodeling regulator 2 4
MIRT447615 CUL3 cullin 3 2 2
MIRT450156 DSEL dermatan sulfate epimerase-like 2 2
MIRT454801 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT463050 ZNF644 zinc finger protein 644 2 2
MIRT467400 SOCS3 suppressor of cytokine signaling 3 2 2
MIRT468174 SGMS1 sphingomyelin synthase 1 2 2
MIRT468949 RPS14 ribosomal protein S14 2 6
MIRT469835 R3HDM4 R3H domain containing 4 2 2
MIRT470724 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT470902 PLIN3 perilipin 3 2 2
MIRT472467 NAPG NSF attachment protein gamma 2 12
MIRT472602 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT492350 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT493840 FOXN3 forkhead box N3 2 4
MIRT496318 DOCK9 dedicator of cytokinesis 9 2 2
MIRT500159 CLEC2D C-type lectin domain family 2 member D 2 8
MIRT500535 XPO4 exportin 4 2 4
MIRT503916 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504003 SAT1 spermidine/spermine N1-acetyltransferase 1 2 4
MIRT505647 SHMT1 serine hydroxymethyltransferase 1 2 4
MIRT506574 MIER3 MIER family member 3 2 4
MIRT506945 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 4
MIRT508196 RPS19 ribosomal protein S19 2 6
MIRT511417 HSPA13 heat shock protein family A (Hsp70) member 13 2 4
MIRT512326 ACTB actin beta 2 4
MIRT515376 RPL7 ribosomal protein L7 2 2
MIRT520422 TUBG1 tubulin gamma 1 2 4
MIRT524844 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT526320 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526561 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT528027 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT529874 RBM43 RNA binding motif protein 43 2 2
MIRT530826 CLEC4D C-type lectin domain family 4 member D 2 2
MIRT531334 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT532068 CCNB1 cyclin B1 2 4
MIRT532870 ZNF566 zinc finger protein 566 2 2
MIRT535580 NUP35 nucleoporin 35 2 2
MIRT537644 ERGIC2 ERGIC and golgi 2 2 4
MIRT537725 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT538894 BRI3BP BRI3 binding protein 2 2
MIRT538945 BMP2K BMP2 inducible kinase 2 2
MIRT540703 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT543210 TMEM117 transmembrane protein 117 2 3
MIRT543357 LYRM2 LYR motif containing 2 2 2
MIRT544905 CLSPN claspin 2 2
MIRT545532 ARF3 ADP ribosylation factor 3 2 2
MIRT546446 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT546882 PURB purine rich element binding protein B 2 4
MIRT547440 MED13 mediator complex subunit 13 2 2
MIRT548027 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548673 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT550435 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT551850 RPS3 ribosomal protein S3 2 2
MIRT556072 MRFAP1 Morf4 family associated protein 1 2 2
MIRT556554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT557132 HOXA13 homeobox A13 2 2
MIRT557875 FEM1B fem-1 homolog B 2 4
MIRT558146 ELK4 ELK4, ETS transcription factor 2 2
MIRT558862 CD2AP CD2 associated protein 2 2
MIRT558884 CCNE1 cyclin E1 2 4
MIRT558907 CBX5 chromobox 5 2 2
MIRT559175 BRAP BRCA1 associated protein 2 2
MIRT560860 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT561729 PPIF peptidylprolyl isomerase F 2 2
MIRT564024 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT564366 TRMT5 tRNA methyltransferase 5 2 2
MIRT564609 ZNF703 zinc finger protein 703 2 2
MIRT565494 AZF1 azoospermia factor 1 2 2
MIRT565577 SLC6A8 solute carrier family 6 member 8 2 2
MIRT566947 LEPROT leptin receptor overlapping transcript 2 2
MIRT567293 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT567308 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT568048 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT571807 PHF19 PHD finger protein 19 2 2
MIRT609234 RBM23 RNA binding motif protein 23 2 2
MIRT610328 SSX5 SSX family member 5 2 2
MIRT611428 UGT8 UDP glycosyltransferase 8 2 4
MIRT611709 SLFN13 schlafen family member 13 2 2
MIRT612069 CEP135 centrosomal protein 135 2 4
MIRT617676 JRKL JRK like 2 2
MIRT623684 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT635634 PRR15L proline rich 15 like 2 2
MIRT636422 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT637011 GPATCH11 G-patch domain containing 11 2 2
MIRT644150 C4orf3 chromosome 4 open reading frame 3 2 2
MIRT648562 MEMO1 mediator of cell motility 1 2 2
MIRT650752 WNT16 Wnt family member 16 2 2
MIRT651914 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT653556 SLC38A7 solute carrier family 38 member 7 2 2
MIRT692277 XRN2 5'-3' exoribonuclease 2 2 2
MIRT697650 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT703876 ERCC6 ERCC excision repair 6, chromatin remodeling factor 2 2
MIRT704615 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT708562 BBOX1 gamma-butyrobetaine hydroxylase 1 2 2
MIRT709614 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT712955 SGCD sarcoglycan delta 2 2
MIRT713502 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT720239 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT724255 GLUD1 glutamate dehydrogenase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4477a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4477a Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4477a Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)

Error report submission