miRTarBase - #MIRT078708


—
pre-miRNA Information
pre-miRNA hsa-mir-548ac   
Genomic Coordinates chr1: 116560024 - 116560111
Description Homo sapiens miR-548ac stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548ac
Sequence 53| CAAAAACCGGCAAUUACUUUUG |74
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 - 116560056 29233923 MiREDiBase
A-to-I 5 1 - 116560055 29233923 MiREDiBase
A-to-I 6 1 - 116560054 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1182074110 6 dbSNP
rs1392446444 6 dbSNP
rs1326234665 7 dbSNP
rs556579863 8 dbSNP
rs993390910 9 dbSNP
rs901450363 13 dbSNP
rs538553306 22 dbSNP
Putative Targets

Gene Information
Gene Symbol LLGL2   
Synonyms HGL, Hugl-2, LGL2
Description LLGL2, scribble cell polarity complex component
Transcript NM_001031803   
Other Transcripts NM_001015002 , NM_004524   
Expression
Putative miRNA Targets on LLGL2
3'UTR of LLGL2
(miRNA target sites are highlighted)		 
>LLGL2|NM_001031803|3'UTR
   1 GTGGCTGAGCGTCCAGGCTGCGCGATGAGCACACACTACTACTGATGGCCTTTCGGGGGTCCCTGCCCCAACCGGAGAGG
  81 CCGGTGCACAGGGCCCCGCCAGGGGCTGGGGGCATCCCGGCTTCCACAATGCAGCTGCTCTGGGCCTCGGGAGAGGAGAG
 161 ACCCCAGTCCCCTGGGCTGCCCTTCCCGGGCCTCGTCTGTCTGGGTCCTTTGGTCAATGTTGCACAGTTTTTATTGCTCC
 241 CATCCCTTTTTGTAGTGGGCTGGGTTTTAAGTTATAAATGTTAACTGCCTCTGGGTGAAAAAGTTTTTAATAAACACCTA
 321 TTACCTCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guuuuCAUUAACGG--CCAAAAac 5'
               |||:| | |  ||||||  
Target 5' tttttGTAGTGGGCTGGGTTTTaa 3'
 247 - 270 135.00 -9.90
2 
miRNA  3' guuuUCA-UU--AACG-GCCAAAAAc 5'
              :|| ||  |||| | |||||| 
Target 5' ctttGGTCAATGTTGCACAGTTTTTa 3'
 208 - 233 128.00 -5.30
3 
miRNA  3' guuuucauuaACGGCCAAAaac 5'
                    | |||| ||   
Target 5' gctgggggcaTCCCGGCTTcca 3'
 105 - 126 80.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM9599876 4 COSMIC
COSM8590753 11 COSMIC
COSM8971803 12 COSMIC
COSM984390 21 COSMIC
COSM6701592 22 COSMIC
COSM7427896 26 COSMIC
COSN30517643 55 COSMIC
COSN31511164 56 COSMIC
COSN26982605 60 COSMIC
COSN30513665 60 COSMIC
COSN30104643 62 COSMIC
COSN30461448 63 COSMIC
COSN15322758 72 COSMIC
COSN30490735 76 COSMIC
COSN30479645 78 COSMIC
COSN26982607 98 COSMIC
COSN26982604 100 COSMIC
COSN30470870 105 COSMIC
COSN30498530 106 COSMIC
COSN26982609 113 COSMIC
COSN30452497 117 COSMIC
COSN30461751 119 COSMIC
COSN30191375 138 COSMIC
COSN30147980 159 COSMIC
COSN31494738 182 COSMIC
COSN13746950 195 COSMIC
COSN7455463 268 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs569728853 2 dbSNP
rs1370525446 4 dbSNP
rs1162070587 9 dbSNP
rs1259584316 10 dbSNP
rs147991148 12 dbSNP
rs1333647596 14 dbSNP
rs1239014180 16 dbSNP
rs1002406391 20 dbSNP
rs750018830 22 dbSNP
rs758113032 23 dbSNP
rs141619636 24 dbSNP
rs746591952 25 dbSNP
rs1243483982 26 dbSNP
rs754909041 30 dbSNP
rs1456969182 31 dbSNP
rs781281059 32 dbSNP
rs1241937499 33 dbSNP
rs1458737689 36 dbSNP
rs747913219 37 dbSNP
rs769736551 39 dbSNP
rs1186383109 44 dbSNP
rs1015450793 45 dbSNP
rs1235586618 46 dbSNP
rs903907390 49 dbSNP
rs961247442 52 dbSNP
rs773110264 55 dbSNP
rs373611499 56 dbSNP
rs1393495268 57 dbSNP
rs1422769163 58 dbSNP
rs1301906659 60 dbSNP
rs1464164842 63 dbSNP
rs367615652 66 dbSNP
rs200429656 69 dbSNP
rs1042861 72 dbSNP
rs764540023 74 dbSNP
rs777141808 75 dbSNP
rs375063107 76 dbSNP
rs959721589 83 dbSNP
rs370078960 84 dbSNP
rs912921578 91 dbSNP
rs1427887581 97 dbSNP
rs1168224731 98 dbSNP
rs945571668 99 dbSNP
rs373936735 100 dbSNP
rs1278389766 104 dbSNP
rs1233330430 111 dbSNP
rs925466102 113 dbSNP
rs373939600 117 dbSNP
rs1049816702 118 dbSNP
rs972353700 119 dbSNP
rs1281901539 120 dbSNP
rs1363283202 126 dbSNP
rs1403517407 127 dbSNP
rs566061629 130 dbSNP
rs1300436271 132 dbSNP
rs891233878 134 dbSNP
rs535008352 138 dbSNP
rs753112463 140 dbSNP
rs368103155 149 dbSNP
rs555209743 150 dbSNP
rs1294045020 161 dbSNP
rs995347117 170 dbSNP
rs1197134554 171 dbSNP
rs979836888 174 dbSNP
rs1027358585 175 dbSNP
rs1217696657 178 dbSNP
rs1445131415 180 dbSNP
rs372378903 188 dbSNP
rs938173770 189 dbSNP
rs1325002780 195 dbSNP
rs1260742275 196 dbSNP
rs75515900 197 dbSNP
rs1341692977 200 dbSNP
rs1280712376 202 dbSNP
rs1429059206 205 dbSNP
rs1326253546 206 dbSNP
rs1335079760 209 dbSNP
rs896694150 214 dbSNP
rs1035543802 220 dbSNP
rs1403953481 221 dbSNP
rs1224967291 223 dbSNP
rs1269414996 226 dbSNP
rs945649021 236 dbSNP
rs959754240 254 dbSNP
rs1042345275 258 dbSNP
rs988562464 261 dbSNP
rs537887054 264 dbSNP
rs778162753 265 dbSNP
rs1188247768 269 dbSNP
rs543755909 270 dbSNP
rs557223100 276 dbSNP
rs1000849898 277 dbSNP
rs1421482526 295 dbSNP
rs1428623087 298 dbSNP
rs1462380636 303 dbSNP
rs1167041902 304 dbSNP
rs1162327956 310 dbSNP
rs1397847007 311 dbSNP
rs577409355 313 dbSNP
rs752160702 318 dbSNP
rs1318083276 320 dbSNP
rs1275685758 321 dbSNP
rs1426209060 322 dbSNP
rs545259622 326 dbSNP
rs889912423 328 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3993.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000392550.3 | 3UTR | UUUAAUAAACACCUAUUACCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
275 hsa-miR-548ac Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055863 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT074959 LEPROT leptin receptor overlapping transcript 2 2
MIRT076823 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 4
MIRT078708 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT099610 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT103362 CBX3 chromobox 3 2 2
MIRT111801 MPZL1 myelin protein zero like 1 2 2
MIRT114050 AKAP11 A-kinase anchoring protein 11 2 12
MIRT133719 SKI SKI proto-oncogene 2 2
MIRT136817 NHLRC3 NHL repeat containing 3 2 6
MIRT149926 LDLR low density lipoprotein receptor 2 2
MIRT166915 TNPO1 transportin 1 2 2
MIRT168142 SOX4 SRY-box 4 2 10
MIRT190787 STRN3 striatin 3 2 4
MIRT207471 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT250951 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT271993 ARF1 ADP ribosylation factor 1 2 4
MIRT282618 IGF1R insulin like growth factor 1 receptor 2 8
MIRT294153 ZNF845 zinc finger protein 845 2 2
MIRT309060 C4ORF3 chromosome 4 open reading frame 3 2 2
MIRT318548 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT319752 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT331324 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT337204 TOMM20 translocase of outer mitochondrial membrane 20 2 6
MIRT346145 ALYREF Aly/REF export factor 2 2
MIRT347727 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT350503 MRGBP MRG domain binding protein 2 6
MIRT356409 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT357986 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT374399 M6PR mannose-6-phosphate receptor, cation dependent 2 6
MIRT442727 TMEM158 transmembrane protein 158 (gene/pseudogene) 2 2
MIRT443411 HMX3 H6 family homeobox 3 2 2
MIRT444408 FRMD5 FERM domain containing 5 2 2
MIRT444469 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT444650 HSBP1 heat shock factor binding protein 1 2 2
MIRT444861 EXD2 exonuclease 3'-5' domain containing 2 2 2
MIRT445685 TNFSF15 TNF superfamily member 15 2 2
MIRT446001 CD1D CD1d molecule 2 2
MIRT446074 RABIF RAB interacting factor 2 2
MIRT446308 ACSL3 acyl-CoA synthetase long chain family member 3 2 2
MIRT446432 ABHD2 abhydrolase domain containing 2 2 2
MIRT447269 C3orf30 chromosome 3 open reading frame 30 2 2
MIRT447759 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448161 P2RY10 purinergic receptor P2Y10 2 2
MIRT449049 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449275 PALM2 paralemmin 2 2 2
MIRT450122 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 2 2
MIRT450155 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT451289 ZNF101 zinc finger protein 101 2 2
MIRT459253 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT462554 NUDT19 nudix hydrolase 19 2 2
MIRT464470 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465120 TSC22D2 TSC22 domain family member 2 2 4
MIRT467996 SKIL SKI like proto-oncogene 2 2
MIRT468718 SDC4 syndecan 4 2 2
MIRT469269 RHOB ras homolog family member B 2 2
MIRT470675 POLR2D RNA polymerase II subunit D 2 4
MIRT470723 POGK pogo transposable element derived with KRAB domain 2 2
MIRT471438 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471502 PDE4D phosphodiesterase 4D 2 4
MIRT471988 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT472386 NEK7 NIMA related kinase 7 2 2
MIRT475028 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT479411 CDKN1B cyclin dependent kinase inhibitor 1B 2 10
MIRT480514 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT481700 AR androgen receptor 2 2
MIRT482543 ACTB actin beta 2 4
MIRT482627 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT484725 INHBA inhibin beta A subunit 2 12
MIRT487778 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT491883 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT494653 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 2
MIRT497366 SF1 splicing factor 1 2 2
MIRT499156 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT502830 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502944 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503942 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504235 MYO6 myosin VI 2 2
MIRT504453 MC2R melanocortin 2 receptor 2 2
MIRT506022 PURA purine rich element binding protein A 2 2
MIRT508028 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT508299 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT511515 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT512307 AMER1 APC membrane recruitment protein 1 2 6
MIRT514565 XRCC3 X-ray repair cross complementing 3 2 4
MIRT515657 MYBPC1 myosin binding protein C, slow type 2 2
MIRT518429 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT520378 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 4
MIRT521604 PSMA2 proteasome subunit alpha 2 2 4
MIRT521725 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 4
MIRT522579 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT522731 LRRC55 leucine rich repeat containing 55 2 8
MIRT524547 CDC5L cell division cycle 5 like 2 4
MIRT525371 SYNM synemin 2 2
MIRT526489 PPIA peptidylprolyl isomerase A 2 4
MIRT527197 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT527285 FBLN2 fibulin 2 2 2
MIRT527383 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT527409 SMU1 DNA replication regulator and spliceosomal factor 2 6
MIRT527454 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT528348 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529104 ZNF100 zinc finger protein 100 2 2
MIRT529317 ATRNL1 attractin like 1 2 2
MIRT529328 PDE5A phosphodiesterase 5A 2 2
MIRT529750 SEL1L SEL1L ERAD E3 ligase adaptor subunit 2 2
MIRT530277 MKRN3 makorin ring finger protein 3 2 2
MIRT531415 TMEM18 transmembrane protein 18 2 2
MIRT532544 WDR13 WD repeat domain 13 2 2
MIRT533245 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT534659 RNF20 ring finger protein 20 2 2
MIRT534818 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT537492 FAM169A family with sequence similarity 169 member A 2 2
MIRT538778 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539122 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT540964 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541403 CDC27 cell division cycle 27 2 2
MIRT543353 ZNF829 zinc finger protein 829 2 2
MIRT543623 MFAP3 microfibril associated protein 3 2 2
MIRT543649 YY2 YY2 transcription factor 2 2
MIRT544945 SNCB synuclein beta 2 2
MIRT545327 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT546094 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT548605 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT548638 DAZAP1 DAZ associated protein 1 2 4
MIRT550318 ZNF681 zinc finger protein 681 2 2
MIRT550412 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT551034 SPPL3 signal peptide peptidase like 3 2 2
MIRT551602 HDGFRP2 HDGF like 2 2 2
MIRT552064 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 4
MIRT552803 YAF2 YY1 associated factor 2 2 2
MIRT553274 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553303 TSPAN3 tetraspanin 3 2 2
MIRT553570 NPM3 nucleophosmin/nucleoplasmin 3 2 2
MIRT554844 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT556069 MTF2 metal response element binding transcription factor 2 2 4
MIRT556898 ITGA2 integrin subunit alpha 2 2 2
MIRT558680 CNIH cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT559032 C20orf24 chromosome 20 open reading frame 24 2 2
MIRT559108 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT559864 GSKIP GSK3B interacting protein 2 2
MIRT560868 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT562268 GRB2 growth factor receptor bound protein 2 2 2
MIRT562419 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 2
MIRT562652 ARID1A AT-rich interaction domain 1A 2 4
MIRT563771 ZNF678 zinc finger protein 678 2 2
MIRT564279 DEPDC1B DEP domain containing 1B 2 2
MIRT565253 TRA2B transformer 2 beta homolog 2 4
MIRT565307 TMEM64 transmembrane protein 64 2 2
MIRT566034 RFX1 regulatory factor X1 2 2
MIRT566714 MTMR3 myotubularin related protein 3 2 2
MIRT568087 CELF2 CUGBP Elav-like family member 2 2 2
MIRT568417 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT568766 MYBL1 MYB proto-oncogene like 1 2 2
MIRT569516 THYN1 thymocyte nuclear protein 1 2 2
MIRT571823 PHF19 PHD finger protein 19 2 2
MIRT571995 HOXA9 homeobox A9 2 2
MIRT572174 CELF1 CUGBP Elav-like family member 1 2 2
MIRT572637 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT573756 KHSRP KH-type splicing regulatory protein 2 2
MIRT574089 CCDC132 VPS50, EARP/GARPII complex subunit 2 6
MIRT574311 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574512 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT574559 NRBF2 nuclear receptor binding factor 2 2 2
MIRT576686 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT608491 NKTR natural killer cell triggering receptor 2 6
MIRT608640 ATP9A ATPase phospholipid transporting 9A (putative) 2 6
MIRT609231 TMEM189 transmembrane protein 189 2 2
MIRT609561 TCEAL4 transcription elongation factor A like 4 2 2
MIRT610193 FAM49A family with sequence similarity 49 member A 2 2
MIRT610681 SYT2 synaptotagmin 2 2 4
MIRT610725 NAV2 neuron navigator 2 2 2
MIRT610813 SGOL2 shugoshin 2 2 2
MIRT610993 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT611030 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT611339 SLC2A4 solute carrier family 2 member 4 2 2
MIRT611511 HIPK3 homeodomain interacting protein kinase 3 2 2
MIRT611638 EDIL3 EGF like repeats and discoidin domains 3 2 2
MIRT611856 RPL3L ribosomal protein L3 like 2 2
MIRT611905 TRPC3 transient receptor potential cation channel subfamily C member 3 2 2
MIRT612047 PCNXL2 pecanex homolog 2 2 6
MIRT612340 TRIB2 tribbles pseudokinase 2 2 2
MIRT612870 INO80C INO80 complex subunit C 2 2
MIRT613555 AMPD3 adenosine monophosphate deaminase 3 2 2
MIRT614490 MMS22L MMS22 like, DNA repair protein 2 2
MIRT615098 BRD4 bromodomain containing 4 2 2
MIRT616228 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 2
MIRT617220 GDPGP1 GDP-D-glucose phosphorylase 1 2 2
MIRT617884 ESR1 estrogen receptor 1 2 2
MIRT618344 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT620264 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT620660 CCDC108 cilia and flagella associated protein 65 2 2
MIRT620761 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621416 TXNL1 thioredoxin like 1 2 2
MIRT621676 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT622231 SLC25A51 solute carrier family 25 member 51 2 2
MIRT622377 SALL1 spalt like transcription factor 1 2 2
MIRT622404 RRAGC Ras related GTP binding C 2 2
MIRT622494 RC3H1 ring finger and CCCH-type domains 1 2 2
MIRT623064 NRXN1 neurexin 1 2 2
MIRT623295 MAX MYC associated factor X 2 2
MIRT623691 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT623930 FMNL3 formin like 3 2 2
MIRT623984 FAM208A family with sequence similarity 208 member A 2 2
MIRT624513 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT624668 ARID4A AT-rich interaction domain 4A 2 2
MIRT624756 ANGPTL2 angiopoietin like 2 2 2
MIRT624949 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT625968 RNF2 ring finger protein 2 2 2
MIRT626415 KIAA2018 upstream transcription factor family member 3 2 2
MIRT626882 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT627157 ZNF652 zinc finger protein 652 2 2
MIRT627613 SFT2D2 SFT2 domain containing 2 2 2
MIRT627744 RAP2B RAP2B, member of RAS oncogene family 2 4
MIRT627808 PTEN phosphatase and tensin homolog 2 2
MIRT627820 PRR3 proline rich 3 2 2
MIRT630935 UNC93A unc-93 homolog A 2 2
MIRT635930 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638301 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT638437 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640281 TCF24 transcription factor 24 2 2
MIRT641979 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT644179 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644439 VDR vitamin D receptor 2 2
MIRT644974 STEAP4 STEAP4 metalloreductase 2 2
MIRT647653 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT648702 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT650120 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT650505 UFM1 ubiquitin fold modifier 1 2 2
MIRT650701 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT651083 ZNF518B zinc finger protein 518B 2 4
MIRT653644 SLC30A1 solute carrier family 30 member 1 2 2
MIRT653788 SIX4 SIX homeobox 4 2 2
MIRT656773 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT656949 KIAA1456 KIAA1456 2 2
MIRT656981 KDM5A lysine demethylase 5A 2 2
MIRT657225 TOR1AIP2 torsin 1A interacting protein 2 2 4
MIRT657706 GPC5 glypican 5 2 2
MIRT660107 BTBD3 BTB domain containing 3 2 2
MIRT662817 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT665889 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT668140 GINS2 GINS complex subunit 2 2 2
MIRT668566 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT669718 AAGAB alpha and gamma adaptin binding protein 2 2
MIRT685693 TRIM45 tripartite motif containing 45 2 2
MIRT686579 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT687491 NHLRC2 NHL repeat containing 2 2 2
MIRT687805 KCNJ15 potassium voltage-gated channel subfamily J member 15 2 2
MIRT687968 HHIP hedgehog interacting protein 2 2
MIRT689487 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT689595 NUDT7 nudix hydrolase 7 2 2
MIRT690501 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT692290 XRN2 5'-3' exoribonuclease 2 2 2
MIRT693060 KIAA1324 KIAA1324 2 2
MIRT697443 ZFHX3 zinc finger homeobox 3 2 2
MIRT698475 TJP1 tight junction protein 1 2 2
MIRT699033 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699785 SEMA4D semaphorin 4D 2 2
MIRT701463 NEO1 neogenin 1 2 2
MIRT701869 MRO maestro 2 2
MIRT702158 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT703750 FAM126B family with sequence similarity 126 member B 2 2
MIRT704277 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT707956 PGM3 phosphoglucomutase 3 2 2
MIRT712747 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT712848 RHOA ras homolog family member A 2 2
MIRT712954 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT713119 U2SURP U2 snRNP associated SURP domain containing 2 2
MIRT713148 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT715394 TADA3 transcriptional adaptor 3 2 2
MIRT715475 NEGR1 neuronal growth regulator 1 2 2
MIRT715535 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT721159 MYOCD myocardin 2 2
MIRT722719 ZNF460 zinc finger protein 460 2 2
MIRT723130 GTF2F2 general transcription factor IIF subunit 2 2 2
MIRT723259 TMLHE trimethyllysine hydroxylase, epsilon 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-54 Nicotine approved 89594 Microarray Caenorhabditis elegans 23765240 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-548ac Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-548ac Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission