miRTarBase - #MIRT078710


—
pre-miRNA Information
pre-miRNA hsa-mir-548ah   
Genomic Coordinates chr4: 76575551 - 76575626
Description Homo sapiens miR-548ah stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548ah-3p
Sequence 47| CAAAAACUGCAGUUACUUUUGC |68
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 4 + 76575599 29233923 MiREDiBase
A-to-I 4 4 + 76575600 29233923 MiREDiBase
A-to-I 5 4 + 76575601 29233923 MiREDiBase
A-to-I 6 4 + 76575602 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1486932451 12 dbSNP
rs1036377818 16 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LLGL2   
Synonyms HGL, Hugl-2, LGL2
Description LLGL2, scribble cell polarity complex component
Transcript NM_001031803   
Other Transcripts NM_001015002 , NM_004524   
Expression
Putative miRNA Targets on LLGL2
3'UTR of LLGL2
(miRNA target sites are highlighted)		 
>LLGL2|NM_001031803|3'UTR
   1 GTGGCTGAGCGTCCAGGCTGCGCGATGAGCACACACTACTACTGATGGCCTTTCGGGGGTCCCTGCCCCAACCGGAGAGG
  81 CCGGTGCACAGGGCCCCGCCAGGGGCTGGGGGCATCCCGGCTTCCACAATGCAGCTGCTCTGGGCCTCGGGAGAGGAGAG
 161 ACCCCAGTCCCCTGGGCTGCCCTTCCCGGGCCTCGTCTGTCTGGGTCCTTTGGTCAATGTTGCACAGTTTTTATTGCTCC
 241 CATCCCTTTTTGTAGTGGGCTGGGTTTTAAGTTATAAATGTTAACTGCCTCTGGGTGAAAAAGTTTTTAATAAACACCTA
 321 TTACCTCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cguUUUCAUUGACGUCAAAAAc 5'
             || || :|  |||||||| 
Target 5' gtcAATGTTGC-ACAGTTTTTa 3'
 213 - 233 154.00 -6.20
2 
miRNA  3' cgUUUUC-AUUGACG-------------UCAAAAAc 5'
            ||| | |||||||             ||||||| 
Target 5' atAAATGTTAACTGCCTCTGGGTGAAAAAGTTTTTa 3'
 274 - 309 152.00 -8.11
3 
miRNA  3' cguuuUCA-UUGACGUCAAAAac 5'
               ||| ::||| :|||||  
Target 5' tttgtAGTGGGCTG-GGTTTTaa 3'
 249 - 270 120.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM9599876 4 COSMIC
COSM8590753 11 COSMIC
COSM8971803 12 COSMIC
COSM984390 21 COSMIC
COSM6701592 22 COSMIC
COSM7427896 26 COSMIC
COSN30517643 55 COSMIC
COSN31511164 56 COSMIC
COSN26982605 60 COSMIC
COSN30513665 60 COSMIC
COSN30104643 62 COSMIC
COSN30461448 63 COSMIC
COSN15322758 72 COSMIC
COSN30490735 76 COSMIC
COSN30479645 78 COSMIC
COSN26982607 98 COSMIC
COSN26982604 100 COSMIC
COSN30470870 105 COSMIC
COSN30498530 106 COSMIC
COSN26982609 113 COSMIC
COSN30452497 117 COSMIC
COSN30461751 119 COSMIC
COSN30191375 138 COSMIC
COSN30147980 159 COSMIC
COSN31494738 182 COSMIC
COSN13746950 195 COSMIC
COSN7455463 268 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs569728853 2 dbSNP
rs1370525446 4 dbSNP
rs1162070587 9 dbSNP
rs1259584316 10 dbSNP
rs147991148 12 dbSNP
rs1333647596 14 dbSNP
rs1239014180 16 dbSNP
rs1002406391 20 dbSNP
rs750018830 22 dbSNP
rs758113032 23 dbSNP
rs141619636 24 dbSNP
rs746591952 25 dbSNP
rs1243483982 26 dbSNP
rs754909041 30 dbSNP
rs1456969182 31 dbSNP
rs781281059 32 dbSNP
rs1241937499 33 dbSNP
rs1458737689 36 dbSNP
rs747913219 37 dbSNP
rs769736551 39 dbSNP
rs1186383109 44 dbSNP
rs1015450793 45 dbSNP
rs1235586618 46 dbSNP
rs903907390 49 dbSNP
rs961247442 52 dbSNP
rs773110264 55 dbSNP
rs373611499 56 dbSNP
rs1393495268 57 dbSNP
rs1422769163 58 dbSNP
rs1301906659 60 dbSNP
rs1464164842 63 dbSNP
rs367615652 66 dbSNP
rs200429656 69 dbSNP
rs1042861 72 dbSNP
rs764540023 74 dbSNP
rs777141808 75 dbSNP
rs375063107 76 dbSNP
rs959721589 83 dbSNP
rs370078960 84 dbSNP
rs912921578 91 dbSNP
rs1427887581 97 dbSNP
rs1168224731 98 dbSNP
rs945571668 99 dbSNP
rs373936735 100 dbSNP
rs1278389766 104 dbSNP
rs1233330430 111 dbSNP
rs925466102 113 dbSNP
rs373939600 117 dbSNP
rs1049816702 118 dbSNP
rs972353700 119 dbSNP
rs1281901539 120 dbSNP
rs1363283202 126 dbSNP
rs1403517407 127 dbSNP
rs566061629 130 dbSNP
rs1300436271 132 dbSNP
rs891233878 134 dbSNP
rs535008352 138 dbSNP
rs753112463 140 dbSNP
rs368103155 149 dbSNP
rs555209743 150 dbSNP
rs1294045020 161 dbSNP
rs995347117 170 dbSNP
rs1197134554 171 dbSNP
rs979836888 174 dbSNP
rs1027358585 175 dbSNP
rs1217696657 178 dbSNP
rs1445131415 180 dbSNP
rs372378903 188 dbSNP
rs938173770 189 dbSNP
rs1325002780 195 dbSNP
rs1260742275 196 dbSNP
rs75515900 197 dbSNP
rs1341692977 200 dbSNP
rs1280712376 202 dbSNP
rs1429059206 205 dbSNP
rs1326253546 206 dbSNP
rs1335079760 209 dbSNP
rs896694150 214 dbSNP
rs1035543802 220 dbSNP
rs1403953481 221 dbSNP
rs1224967291 223 dbSNP
rs1269414996 226 dbSNP
rs945649021 236 dbSNP
rs959754240 254 dbSNP
rs1042345275 258 dbSNP
rs988562464 261 dbSNP
rs537887054 264 dbSNP
rs778162753 265 dbSNP
rs1188247768 269 dbSNP
rs543755909 270 dbSNP
rs557223100 276 dbSNP
rs1000849898 277 dbSNP
rs1421482526 295 dbSNP
rs1428623087 298 dbSNP
rs1462380636 303 dbSNP
rs1167041902 304 dbSNP
rs1162327956 310 dbSNP
rs1397847007 311 dbSNP
rs577409355 313 dbSNP
rs752160702 318 dbSNP
rs1318083276 320 dbSNP
rs1275685758 321 dbSNP
rs1426209060 322 dbSNP
rs545259622 326 dbSNP
rs889912423 328 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3993.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000392550.3 | 3UTR | UUUAAUAAACACCUAUUACCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
269 hsa-miR-548ah-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055349 PDCD4 programmed cell death 4 2 2
MIRT078710 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT088880 FOXN2 forkhead box N2 2 10
MIRT099612 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT111805 MPZL1 myelin protein zero like 1 2 2
MIRT166778 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT221310 LMBR1 limb development membrane protein 1 2 2
MIRT269387 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT309062 C4ORF3 chromosome 4 open reading frame 3 2 2
MIRT318550 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT325436 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT331326 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT336802 ARF1 ADP ribosylation factor 1 2 4
MIRT350505 MRGBP MRG domain binding protein 2 6
MIRT374401 M6PR mannose-6-phosphate receptor, cation dependent 2 4
MIRT399357 IER2 immediate early response 2 2 2
MIRT401033 MOB1B MOB kinase activator 1B 2 4
MIRT441729 HAUS6 HAUS augmin like complex subunit 6 2 2
MIRT442381 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT442407 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT443989 GJD3 gap junction protein delta 3 2 4
MIRT444047 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT444245 CHMP1B charged multivesicular body protein 1B 2 2
MIRT444402 FRMD5 FERM domain containing 5 2 2
MIRT444463 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT444644 HSBP1 heat shock factor binding protein 1 2 2
MIRT444854 EXD2 exonuclease 3'-5' domain containing 2 2 2
MIRT444988 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445107 ZNF207 zinc finger protein 207 2 2
MIRT445449 HSPA14 heat shock protein family A (Hsp70) member 14 2 4
MIRT445515 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 4
MIRT445590 RCC2 regulator of chromosome condensation 2 2 2
MIRT445679 TNFSF15 TNF superfamily member 15 2 2
MIRT445733 PGK1 phosphoglycerate kinase 1 2 2
MIRT445827 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT445996 CD1D CD1d molecule 2 2
MIRT446068 RABIF RAB interacting factor 2 2
MIRT446146 ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 2 2
MIRT446302 ACSL3 acyl-CoA synthetase long chain family member 3 2 2
MIRT446426 ABHD2 abhydrolase domain containing 2 2 2
MIRT447263 C3orf30 chromosome 3 open reading frame 30 2 2
MIRT447692 MTPAP mitochondrial poly(A) polymerase 2 2
MIRT447753 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT447883 LMAN1 lectin, mannose binding 1 2 2
MIRT448032 GSR glutathione-disulfide reductase 2 2
MIRT448155 P2RY10 purinergic receptor P2Y10 2 2
MIRT448215 SNAI2 snail family transcriptional repressor 2 2 2
MIRT448414 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT448890 DENND4C DENN domain containing 4C 2 2
MIRT449043 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449269 PALM2 paralemmin 2 2 2
MIRT449571 GPC5 glypican 5 2 4
MIRT450116 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 2 2
MIRT450149 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT450606 EXOC2 exocyst complex component 2 2 2
MIRT459247 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT464464 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465114 TSC22D2 TSC22 domain family member 2 2 4
MIRT466778 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 4
MIRT467990 SKIL SKI like proto-oncogene 2 4
MIRT469263 RHOB ras homolog family member B 2 2
MIRT470717 POGK pogo transposable element derived with KRAB domain 2 2
MIRT472380 NEK7 NIMA related kinase 7 2 2
MIRT475022 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT475248 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 2
MIRT475678 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT479405 CDKN1B cyclin dependent kinase inhibitor 1B 2 10
MIRT482621 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT490488 FEM1C fem-1 homolog C 2 2
MIRT492176 SOX4 SRY-box 4 2 10
MIRT493559 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT494647 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 2
MIRT497510 ZNF652 zinc finger protein 652 2 4
MIRT499150 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT502081 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT502824 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503936 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504229 MYO6 myosin VI 2 2
MIRT506016 PURA purine rich element binding protein A 2 2
MIRT506416 NHLRC3 NHL repeat containing 3 2 6
MIRT508022 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT508293 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT508358 HES7 hes family bHLH transcription factor 7 2 6
MIRT510848 RARB retinoic acid receptor beta 2 6
MIRT511509 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT511980 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT512301 AMER1 APC membrane recruitment protein 1 2 6
MIRT515651 MYBPC1 myosin binding protein C, slow type 2 2
MIRT518423 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT519692 ZNF620 zinc finger protein 620 2 2
MIRT521598 PSMA2 proteasome subunit alpha 2 2 4
MIRT527241 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT527279 FBLN2 fibulin 2 2 2
MIRT527377 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT527448 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT528342 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529098 ZNF100 zinc finger protein 100 2 2
MIRT529661 ZNF81 zinc finger protein 81 2 2
MIRT530057 TRIM72 tripartite motif containing 72 2 2
MIRT530271 MKRN3 makorin ring finger protein 3 2 2
MIRT530873 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531246 FANCC Fanconi anemia complementation group C 2 2
MIRT531408 TMEM18 transmembrane protein 18 2 2
MIRT534421 SEMA4F ssemaphorin 4F 2 2
MIRT534500 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT534765 RASGEF1A RasGEF domain family member 1A 2 2
MIRT534942 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT536972 HAS3 hyaluronan synthase 3 2 2
MIRT537633 ERI1 exoribonuclease 1 2 2
MIRT537720 ELK3 ELK3, ETS transcription factor 2 2
MIRT538772 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT540958 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541274 GPC4 glypican 4 2 4
MIRT543347 ZNF829 zinc finger protein 829 2 2
MIRT543617 MFAP3 microfibril associated protein 3 2 2
MIRT543644 YY2 YY2 transcription factor 2 2
MIRT544227 GTF2B general transcription factor IIB 2 2
MIRT544413 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544939 SNCB synuclein beta 2 2
MIRT545321 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT546088 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT548516 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT548632 DAZAP1 DAZ associated protein 1 2 4
MIRT551028 SPPL3 signal peptide peptidase like 3 2 2
MIRT552058 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 4
MIRT553268 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553297 TSPAN3 tetraspanin 3 2 2
MIRT553613 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT554201 SLC35D1 solute carrier family 35 member D1 2 2
MIRT554795 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT554838 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT555709 PDZD8 PDZ domain containing 8 2 2
MIRT556063 MTF2 metal response element binding transcription factor 2 2 4
MIRT557999 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT558674 CNIH cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT558954 CBFB core-binding factor beta subunit 2 2
MIRT559026 C20orf24 chromosome 20 open reading frame 24 2 2
MIRT559103 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT559858 GSKIP GSK3B interacting protein 2 2
MIRT561591 SKI SKI proto-oncogene 2 2
MIRT562262 GRB2 growth factor receptor bound protein 2 2 2
MIRT562413 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 2
MIRT562646 ARID1A AT-rich interaction domain 1A 2 4
MIRT564273 DEPDC1B DEP domain containing 1B 2 2
MIRT565301 TMEM64 transmembrane protein 64 2 2
MIRT565392 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566564 OTUD4 OTU deubiquitinase 4 2 2
MIRT566708 MTMR3 myotubularin related protein 3 2 2
MIRT566784 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT568411 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT571817 PHF19 PHD finger protein 19 2 2
MIRT571989 HOXA9 homeobox A9 2 2
MIRT573750 KHSRP KH-type splicing regulatory protein 2 2
MIRT573993 DDX21 DExD-box helicase 21 2 2
MIRT574488 RPS16 ribosomal protein S16 2 2
MIRT574507 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT574553 NRBF2 nuclear receptor binding factor 2 2 2
MIRT576680 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT608353 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT608634 ATP9A ATPase phospholipid transporting 9A (putative) 2 6
MIRT609179 ZNF581 zinc finger protein 581 2 2
MIRT609792 NHSL1 NHS like 1 2 2
MIRT610675 SYT2 synaptotagmin 2 2 4
MIRT610880 NUDCD3 NudC domain containing 3 2 2
MIRT611024 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT611670 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT612067 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT612486 SLC25A11 solute carrier family 25 member 11 2 2
MIRT612648 PSPC1 paraspeckle component 1 2 2
MIRT612688 PLXNA4 plexin A4 2 2
MIRT613108 ESR1 estrogen receptor 1 2 2
MIRT613549 AMPD3 adenosine monophosphate deaminase 3 2 2
MIRT614532 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT614569 GMPR guanosine monophosphate reductase 2 2
MIRT614661 ZNF608 zinc finger protein 608 2 2
MIRT614675 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT615313 CCDC158 coiled-coil domain containing 158 2 2
MIRT616112 GGCX gamma-glutamyl carboxylase 2 2
MIRT617750 MICA MHC class I polypeptide-related sequence A 2 2
MIRT618797 ZIC2 Zic family member 2 2 2
MIRT619227 FUNDC2 FUN14 domain containing 2 2 2
MIRT620281 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT620491 XKR6 XK related 6 2 2
MIRT622613 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT622967 OXSR1 oxidative stress responsive 1 2 2
MIRT623482 KDM5A lysine demethylase 5A 2 2
MIRT623626 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT623699 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT624815 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT625188 GRIK4 glutamate ionotropic receptor kainate type subunit 4 2 2
MIRT625367 CDKL2 cyclin dependent kinase like 2 2 2
MIRT625919 GBP6 guanylate binding protein family member 6 2 2
MIRT625962 RNF2 ring finger protein 2 2 2
MIRT626264 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT626425 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 2 2
MIRT626851 FDX1 ferredoxin 1 2 2
MIRT628014 MEF2C myocyte enhancer factor 2C 2 2
MIRT628047 LIMD1 LIM domains containing 1 2 2
MIRT628360 CCDC117 coiled-coil domain containing 117 2 2
MIRT628461 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT630929 UNC93A unc-93 homolog A 2 2
MIRT635226 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT635478 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT638149 TTC26 tetratricopeptide repeat domain 26 2 2
MIRT638295 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT638431 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640275 TCF24 transcription factor 24 2 2
MIRT641183 STX4 syntaxin 4 2 2
MIRT642295 ZNF99 zinc finger protein 99 2 2
MIRT643270 ZNF566 zinc finger protein 566 2 2
MIRT643581 CTNNA3 catenin alpha 3 2 2
MIRT644173 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644433 VDR vitamin D receptor 2 2
MIRT644614 C17orf77 chromosome 17 open reading frame 77 2 2
MIRT644855 PGM2 phosphoglucomutase 2 2 2
MIRT645449 ATF6B activating transcription factor 6 beta 2 2
MIRT647203 ZNF583 zinc finger protein 583 2 2
MIRT649421 CDC14B cell division cycle 14B 2 2
MIRT650499 UFM1 ubiquitin fold modifier 1 2 2
MIRT650695 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT651209 ZNF280B zinc finger protein 280B 2 2
MIRT653782 SIX4 SIX homeobox 4 2 2
MIRT655057 PKN2 protein kinase N2 2 2
MIRT655707 NUDT21 nudix hydrolase 21 2 2
MIRT656943 KIAA1456 KIAA1456 2 2
MIRT658275 FAXC failed axon connections homolog 2 2
MIRT658519 ETV3 ETS variant 3 2 2
MIRT658655 ENAH ENAH, actin regulator 2 2
MIRT658688 EMP2 epithelial membrane protein 2 2 2
MIRT659241 CXCR5 C-X-C motif chemokine receptor 5 2 2
MIRT659289 CTDSPL2 CTD small phosphatase like 2 2 2
MIRT660101 BTBD3 BTB domain containing 3 2 2
MIRT660463 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT663648 INTU inturned planar cell polarity protein 2 2
MIRT664065 KIAA1551 KIAA1551 2 2
MIRT666140 SPATS2L spermatogenesis associated serine rich 2 like 2 2
MIRT675549 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT684998 RPL10A ribosomal protein L10a 2 2
MIRT685687 TRIM45 tripartite motif containing 45 2 2
MIRT687485 NHLRC2 NHL repeat containing 2 2 2
MIRT687799 KCNJ15 potassium voltage-gated channel subfamily J member 15 2 2
MIRT687911 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT687962 HHIP hedgehog interacting protein 2 2
MIRT689214 ZNF574 zinc finger protein 574 2 2
MIRT689481 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT690495 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT692284 XRN2 5'-3' exoribonuclease 2 2 2
MIRT693054 KIAA1324 KIAA1324 2 2
MIRT697437 ZFHX3 zinc finger homeobox 3 2 2
MIRT698469 TJP1 tight junction protein 1 2 2
MIRT699027 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699779 SEMA4D semaphorin 4D 2 2
MIRT701863 MRO maestro 2 2
MIRT702152 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT702235 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT703744 FAM126B family with sequence similarity 126 member B 2 2
MIRT704271 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT707745 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT709855 SNX12 sorting nexin 12 2 2
MIRT712741 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT712948 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT713142 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT715529 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT718275 ZNF749 zinc finger protein 749 2 2
MIRT720146 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT722713 ZNF460 zinc finger protein 460 2 2
MIRT723253 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT724240 DGKE diacylglycerol kinase epsilon 2 2
MIRT725076 WTIP WT1 interacting protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-548ah-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission