miRTarBase - #MIRT078862


—
pre-miRNA Information
pre-miRNA hsa-mir-8066   
Genomic Coordinates chr4: 101240795 - 101240872
Description Homo sapiens miR-8066 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-8066
Sequence 48| CAAUGUGAUCUUUUGGAUGUA |68
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs931560390 4 dbSNP
rs1189907448 6 dbSNP
rs1347410735 8 dbSNP
rs1422871438 10 dbSNP
rs1281396192 14 dbSNP
rs1236502030 19 dbSNP
rs929291819 20 dbSNP
rs756482594 21 dbSNP
Putative Targets

Gene Information
Gene Symbol WBP2   
Synonyms GRAMD6, WBP-2
Description WW domain binding protein 2
Transcript NM_012478   
Expression
Putative miRNA Targets on WBP2
3'UTR of WBP2
(miRNA target sites are highlighted)		 
>WBP2|NM_012478|3'UTR
   1 GCCCTCCTGCCTCCCTGCCTCCCACCCTCATCTCTCTACCCTACCCCTCCCATCGGGGCTGTGCTGGGGCTTGGGGAGGG
  81 GAGGGGGCGCCTTGTTCTCCCTCCAGGTCTGATCATAAACAATTACCAGGAACTAGCATTGTGGGACATTAGGGCCCCCG
 161 GCCTCGGGAGAGGTGCCGCCCAGCTTCCCATGCCAGCCCGGAGCCCACAGTGCTGCCCAGCGTACCTCCCTCACCGTCTG
 241 GGGCTCTTCTGGGAGCACGGAGCATCCCCTGTTCCTGTTTCACTCTCAGCTTCTCCCCTCGAAGGGACTCTCTGGCCACC
 321 TCCTCCACCGCAGTCCAGCTCCCTCAGTCTGGCACCCACTGCTACACTCAGCCTCATGAGCCACTTCAGACCAGCCAGGT
 401 GTCTTCCCGGGCCCTGCCAGACCCTGCTCACATTCCCTCTGCTGGTCTGTGCTGGTCTCAGAAGGCCACCGCGCCCGCAT
 481 TCCACTCAGCCAGGGTCCAGCTGCAGCCCCCGCCACCCTTCCTTCCCTTCCCTGTCCTGGGTCATGTTGTTGCCACCCTG
 561 TGTGACTTTTGAAGCTGTAAAATGAGCTTCCAGGGCTTGGGTGGCGTCGGGGCAGGGCCGCCGAGGCTGGGAGGAAGCCC
 641 TTCTGCCTTTTGCTGGTGTTTCTGGAATTTGCTTTCCCTCACCTCTCACTTCCTTCTAGAAGGAGCTTCCTGACTGGAAC
 721 CAGAGAATGCATGTCTGTCCACTTGGTGGCTGCTGGGTGGGGCCGGGAACAAGGGCCCCTGACCCTGTGTGCTGGCCGGG
 801 ACCTGCCACCAGCCCCCCAGCCTGCTTCTTCCCCTTAAGCTTTGTGCCCCTGGATGCGCTAACATTCACTCTTGTTTGTC
 881 CCTGGACTGGCCATGAAGTGAGGAGATGGTTATTTAAAGAGAATTCCCTATTTATTTGACAAAAAATCCAGTTAATATAT
 961 TAATGTGAAATAAACCCTGTTTGCACCTCGATTTGTTTGCTGAAAATGTGAAATAGTAAAAATGAAATAACTGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auguaGGUUU---UCUAGUGUAAc 5'
               |||:|    | ||||||| 
Target 5' ccctgCCAGACCCTGCTCACATTc 3'
 412 - 435 148.00 -9.50
2 
miRNA  3' auGUAGGUUUUCUAGUGUAAc 5'
            ::|||   :|:|||::|| 
Target 5' ccTGTCC--TGGGTCATGTTg 3'
 531 - 549 119.00 -13.10
3 
miRNA  3' auguaGGUUUU---CUAGUGUAAc 5'
               || ::|   | | ||||| 
Target 5' gtgccCCTGGATGCGCTAACATTc 3'
 844 - 867 112.00 -5.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26556040 40 COSMIC
COSN31483076 54 COSMIC
COSN30139699 88 COSMIC
COSN31482995 101 COSMIC
COSN30752051 109 COSMIC
COSN25234701 172 COSMIC
COSN25242878 173 COSMIC
COSN6549322 236 COSMIC
COSN28974925 274 COSMIC
COSN30027236 473 COSMIC
COSN20619412 815 COSMIC
COSN30540833 852 COSMIC
COSN31566914 857 COSMIC
COSN1201353 858 COSMIC
COSN9673967 977 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1235895512 2 dbSNP
rs987121524 10 dbSNP
rs1337136606 11 dbSNP
rs1454580887 18 dbSNP
rs1407512235 19 dbSNP
rs774862579 20 dbSNP
rs553245181 23 dbSNP
rs770918318 25 dbSNP
rs1374255694 30 dbSNP
rs1167885651 31 dbSNP
rs1333666636 37 dbSNP
rs1309879752 38 dbSNP
rs1427497922 41 dbSNP
rs1261541177 42 dbSNP
rs1184586211 44 dbSNP
rs1463081603 45 dbSNP
rs1241811155 46 dbSNP
rs1354166758 48 dbSNP
rs1230022431 53 dbSNP
rs908605311 54 dbSNP
rs182026710 55 dbSNP
rs1253081093 57 dbSNP
rs777978881 59 dbSNP
rs114129161 62 dbSNP
rs1315523035 63 dbSNP
rs1247875484 66 dbSNP
rs748341225 67 dbSNP
rs922545264 69 dbSNP
rs1336036888 72 dbSNP
rs112525741 73 dbSNP
rs779735968 77 dbSNP
rs558160216 79 dbSNP
rs750335308 85 dbSNP
rs1385436458 87 dbSNP
rs968920843 87 dbSNP
rs376221037 89 dbSNP
rs765288135 94 dbSNP
rs1164393713 97 dbSNP
rs757175524 101 dbSNP
rs753392530 119 dbSNP
rs569387245 126 dbSNP
rs760348887 132 dbSNP
rs1377109088 137 dbSNP
rs1395598512 139 dbSNP
rs915096513 141 dbSNP
rs73997645 147 dbSNP
rs1449923849 151 dbSNP
rs1421095440 154 dbSNP
rs767786307 155 dbSNP
rs768255229 159 dbSNP
rs1030736735 160 dbSNP
rs767226716 160 dbSNP
rs536050054 165 dbSNP
rs1480458235 166 dbSNP
rs1292808943 167 dbSNP
rs1224961933 168 dbSNP
rs1357018615 170 dbSNP
rs1314039167 175 dbSNP
rs1239756218 176 dbSNP
rs774573008 177 dbSNP
rs970413602 178 dbSNP
rs1254895619 179 dbSNP
rs1390286274 180 dbSNP
rs1365603059 194 dbSNP
rs1216132408 198 dbSNP
rs563642327 199 dbSNP
rs547311902 200 dbSNP
rs1364113706 201 dbSNP
rs748961284 207 dbSNP
rs9899283 221 dbSNP
rs995765452 222 dbSNP
rs1404582250 231 dbSNP
rs563775025 235 dbSNP
rs1038516233 236 dbSNP
rs1356839742 242 dbSNP
rs1005662730 243 dbSNP
rs756588099 258 dbSNP
rs940211614 262 dbSNP
rs886159916 266 dbSNP
rs1413794728 270 dbSNP
rs35922446 270 dbSNP
rs887216340 270 dbSNP
rs1051527718 271 dbSNP
rs1201400869 274 dbSNP
rs1047127213 277 dbSNP
rs1487512319 284 dbSNP
rs1196546679 287 dbSNP
rs1264505806 289 dbSNP
rs932933097 289 dbSNP
rs1320110911 290 dbSNP
rs550176503 290 dbSNP
rs530397624 291 dbSNP
rs561452743 292 dbSNP
rs934043220 293 dbSNP
rs1398858554 296 dbSNP
rs922629367 298 dbSNP
rs1384219374 300 dbSNP
rs541523808 300 dbSNP
rs535566573 301 dbSNP
rs573036204 304 dbSNP
rs1359727753 308 dbSNP
rs1417607061 309 dbSNP
rs1476201030 314 dbSNP
rs947320267 318 dbSNP
rs1040085565 319 dbSNP
rs11645 322 dbSNP
rs1332464379 323 dbSNP
rs1234650950 324 dbSNP
rs942645133 328 dbSNP
rs769156097 329 dbSNP
rs981501525 330 dbSNP
rs1488413742 331 dbSNP
rs970151184 337 dbSNP
rs1269470422 339 dbSNP
rs1446816895 343 dbSNP
rs1291157992 346 dbSNP
rs1022962798 347 dbSNP
rs1216109958 348 dbSNP
rs995937567 349 dbSNP
rs1336210861 364 dbSNP
rs745449945 376 dbSNP
rs1364320845 383 dbSNP
rs956525202 387 dbSNP
rs1362283312 392 dbSNP
rs891302540 394 dbSNP
rs1440981633 396 dbSNP
rs923721824 408 dbSNP
rs1051474967 409 dbSNP
rs1410516217 413 dbSNP
rs1242797949 414 dbSNP
rs1308083363 416 dbSNP
rs997256916 419 dbSNP
rs1271683242 422 dbSNP
rs981867059 429 dbSNP
rs1468994892 435 dbSNP
rs566670076 438 dbSNP
rs1236605162 439 dbSNP
rs1459211544 440 dbSNP
rs1180279108 442 dbSNP
rs1326433358 442 dbSNP
rs1462955170 448 dbSNP
rs1023319314 455 dbSNP
rs1012298128 470 dbSNP
rs550509677 471 dbSNP
rs1392355461 472 dbSNP
rs559283070 473 dbSNP
rs79220087 476 dbSNP
rs1005708594 477 dbSNP
rs887284315 483 dbSNP
rs1298391365 484 dbSNP
rs914473625 485 dbSNP
rs1394620793 492 dbSNP
rs1053450667 493 dbSNP
rs1336037499 500 dbSNP
rs1475256301 502 dbSNP
rs1256159824 507 dbSNP
rs11549519 508 dbSNP
rs577193245 510 dbSNP
rs141368308 511 dbSNP
rs867443806 517 dbSNP
rs1039734850 519 dbSNP
rs538262690 521 dbSNP
rs575663220 522 dbSNP
rs970098947 523 dbSNP
rs757844270 527 dbSNP
rs528896853 532 dbSNP
rs1192306445 533 dbSNP
rs942675067 534 dbSNP
rs1420927483 535 dbSNP
rs1466719598 537 dbSNP
rs893760806 541 dbSNP
rs1170758574 544 dbSNP
rs1358176730 545 dbSNP
rs1304897661 546 dbSNP
rs1356661549 547 dbSNP
rs916010103 548 dbSNP
rs538879663 553 dbSNP
rs535566952 555 dbSNP
rs1215210398 559 dbSNP
rs1274619264 560 dbSNP
rs1300890848 564 dbSNP
rs1310616500 577 dbSNP
rs1015807968 579 dbSNP
rs1212460917 589 dbSNP
rs1004476199 592 dbSNP
rs1215878052 596 dbSNP
rs1485874772 596 dbSNP
rs1260907408 601 dbSNP
rs567100427 605 dbSNP
rs935204003 606 dbSNP
rs1029831392 608 dbSNP
rs997039117 609 dbSNP
rs1368748587 612 dbSNP
rs923773951 613 dbSNP
rs546863686 620 dbSNP
rs751934996 622 dbSNP
rs1362966726 623 dbSNP
rs1431602705 624 dbSNP
rs1365763528 626 dbSNP
rs916304418 644 dbSNP
rs539611393 646 dbSNP
rs1348385096 647 dbSNP
rs1239109578 661 dbSNP
rs1228192576 664 dbSNP
rs1448601989 669 dbSNP
rs1356479899 681 dbSNP
rs1215886513 689 dbSNP
rs1245689384 694 dbSNP
rs570831935 698 dbSNP
rs1487209925 702 dbSNP
rs778306566 705 dbSNP
rs1295698218 709 dbSNP
rs963371921 731 dbSNP
rs1015848420 733 dbSNP
rs1395275131 737 dbSNP
rs1439509338 741 dbSNP
rs758886234 743 dbSNP
rs1366036249 752 dbSNP
rs191539132 762 dbSNP
rs376041204 764 dbSNP
rs1348271651 765 dbSNP
rs561797709 765 dbSNP
rs1044286 770 dbSNP
rs1045530370 776 dbSNP
rs1326876645 776 dbSNP
rs1445791238 777 dbSNP
rs948570277 779 dbSNP
rs879221372 781 dbSNP
rs765566078 797 dbSNP
rs1224326222 798 dbSNP
rs1289027749 800 dbSNP
rs915973390 802 dbSNP
rs1214975489 807 dbSNP
rs1025780248 817 dbSNP
rs759524898 818 dbSNP
rs1225025627 819 dbSNP
rs901279856 822 dbSNP
rs1470710489 833 dbSNP
rs1163238921 837 dbSNP
rs767545607 840 dbSNP
rs1412224905 844 dbSNP
rs1489918031 848 dbSNP
rs755076514 849 dbSNP
rs11549524 853 dbSNP
rs530436062 857 dbSNP
rs941336850 858 dbSNP
rs1399838966 859 dbSNP
rs753961333 862 dbSNP
rs567957403 864 dbSNP
rs1421970329 867 dbSNP
rs1442619608 868 dbSNP
rs1255308273 874 dbSNP
rs1376829814 874 dbSNP
rs528354084 877 dbSNP
rs1273197106 880 dbSNP
rs1186631222 884 dbSNP
rs1216976315 887 dbSNP
rs893821835 891 dbSNP
rs1274652478 892 dbSNP
rs1224276199 893 dbSNP
rs1187234035 898 dbSNP
rs1053749338 908 dbSNP
rs982818353 909 dbSNP
rs2880 924 dbSNP
rs1296582552 928 dbSNP
rs1423078286 938 dbSNP
rs1441721267 942 dbSNP
rs1464107978 946 dbSNP
rs35810342 947 dbSNP
rs1169904791 956 dbSNP
rs1029947068 957 dbSNP
rs1410349719 965 dbSNP
rs902403055 979 dbSNP
rs1376337748 983 dbSNP
rs1046256165 986 dbSNP
rs187152539 987 dbSNP
rs1293818699 989 dbSNP
rs949225185 990 dbSNP
rs964563695 993 dbSNP
rs181726619 994 dbSNP
rs1433198258 995 dbSNP
rs1394872749 997 dbSNP
rs1285991754 1010 dbSNP
rs990983427 1013 dbSNP
rs1339590416 1021 dbSNP
rs545692295 1031 dbSNP
rs908900726 1032 dbSNP
rs113767977 1036 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000254806.3 | 3UTR | CUCACAUUCCCUCUGCUGGUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
92 hsa-miR-8066 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060588 CCND1 cyclin D1 2 2
MIRT067440 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT078862 WBP2 WW domain binding protein 2 2 2
MIRT088062 UBXN2A UBX domain protein 2A 2 4
MIRT088214 NUP50 nucleoporin 50 2 2
MIRT103494 HOXA3 homeobox A3 2 8
MIRT135196 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT177727 REEP3 receptor accessory protein 3 2 2
MIRT179439 TBRG1 transforming growth factor beta regulator 1 2 4
MIRT191647 SLC39A9 solute carrier family 39 member 9 2 2
MIRT192342 KLF13 Kruppel like factor 13 2 2
MIRT212035 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT215387 CREBRF CREB3 regulatory factor 2 2
MIRT235001 IER2 immediate early response 2 2 2
MIRT238793 TPD52L1 tumor protein D52 like 1 2 2
MIRT273384 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 4
MIRT280473 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT298320 SLC5A3 solute carrier family 5 member 3 2 2
MIRT309180 SPATA5 spermatogenesis associated 5 2 2
MIRT354483 LRRC58 leucine rich repeat containing 58 2 2
MIRT354710 SLC25A36 solute carrier family 25 member 36 2 2
MIRT361004 CDC5L cell division cycle 5 like 2 4
MIRT366247 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT405774 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT442640 TBC1D12 TBC1 domain family member 12 2 2
MIRT443928 ZNF99 zinc finger protein 99 2 2
MIRT454287 FXN frataxin 2 2
MIRT454367 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT463574 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT464484 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT466866 STX6 syntaxin 6 2 2
MIRT467283 SPNS1 sphingolipid transporter 1 (putative) 2 2
MIRT470298 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT471630 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT472802 MTMR4 myotubularin related protein 4 2 4
MIRT474708 KIF3A kinesin family member 3A 2 2
MIRT478256 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT479330 CERS2 ceramide synthase 2 2 2
MIRT480658 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT481954 ANKRD11 ankyrin repeat domain 11 2 2
MIRT482895 IAH1 isoamyl acetate-hydrolyzing esterase 1 homolog 2 4
MIRT493634 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500847 SYPL1 synaptophysin like 1 2 4
MIRT502035 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502185 IGSF3 immunoglobulin superfamily member 3 2 4
MIRT502605 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT502977 CCNL1 cyclin L1 2 8
MIRT504725 PLEKHA6 pleckstrin homology domain containing A6 2 10
MIRT504778 CLEC2D C-type lectin domain family 2 member D 2 4
MIRT505786 SATB1 SATB homeobox 1 2 4
MIRT510090 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 4
MIRT520010 YY1 YY1 transcription factor 2 4
MIRT532552 TXNL1 thioredoxin like 1 2 2
MIRT533433 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT537459 FAM84B family with sequence similarity 84 member B 2 2
MIRT541825 SV2B synaptic vesicle glycoprotein 2B 2 2
MIRT543222 TMEM117 transmembrane protein 117 2 2
MIRT551088 DDX52 DExD-box helicase 52 2 2
MIRT551500 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT552326 ZNF791 zinc finger protein 791 2 2
MIRT553213 TXLNG taxilin gamma 2 2
MIRT554590 RRAGC Ras related GTP binding C 2 2
MIRT559004 CA8 carbonic anhydrase 8 2 2
MIRT559134 BTG3 BTG anti-proliferation factor 3 2 4
MIRT559409 GDNF glial cell derived neurotrophic factor 2 4
MIRT560678 SRFBP1 serum response factor binding protein 1 2 2
MIRT560954 POTED POTE ankyrin domain family member D 2 2
MIRT562856 C17orf58 chromosome 17 open reading frame 58 2 2
MIRT563003 MOCS2 molybdenum cofactor synthesis 2 2 2
MIRT564545 CCDC80 coiled-coil domain containing 80 2 2
MIRT566272 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 2
MIRT566510 PAWR pro-apoptotic WT1 regulator 2 2
MIRT572103 EFNB2 ephrin B2 2 2
MIRT574576 NLGN4X neuroligin 4, X-linked 2 4
MIRT576574 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 2 2
MIRT610815 POT1 protection of telomeres 1 2 2
MIRT624589 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT627567 SMAD6 SMAD family member 6 2 2
MIRT632675 MTX3 metaxin 3 2 2
MIRT689265 WDR83OS WD repeat domain 83 opposite strand 2 2
MIRT694310 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT697721 USP8 ubiquitin specific peptidase 8 2 2
MIRT700209 RFWD3 ring finger and WD repeat domain 3 2 2
MIRT704399 CTSS cathepsin S 2 2
MIRT710665 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 2
MIRT711953 SLC7A14 solute carrier family 7 member 14 2 2
MIRT712596 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT712692 TNFAIP2 TNF alpha induced protein 2 2 2
MIRT714171 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 2 2
MIRT715964 CES4A carboxylesterase 4A 2 2
MIRT722781 PDE3A phosphodiesterase 3A 2 2
MIRT724505 MSMO1 methylsterol monooxygenase 1 2 2

Error report submission