| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-646 |
| Genomic Coordinates | chr20: 60308474 - 60308567 |
| Synonyms | MIRN646, hsa-mir-646, MIR646 |
| Description | Homo sapiens miR-646 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-646 | ||||||||||||||||||||||||
| Sequence | 61| AAGCAGCUGCCUCUGAGGC |79 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | SAGE | ||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | BIRC5 | ||||||||||||||||||||
| Synonyms | API4, EPR-1 | ||||||||||||||||||||
| Description | baculoviral IAP repeat containing 5 | ||||||||||||||||||||
| Transcript | NM_001012271 | ||||||||||||||||||||
| Other Transcripts | NM_001012270 , NM_001168 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on BIRC5 | |||||||||||||||||||||
| 3'UTR of BIRC5 (miRNA target sites are highlighted) |
>BIRC5|NM_001012271|3'UTR 1 GGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTG 81 TGGGCCCCTTAGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTGTTTTGTCTTG 161 AAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAACAGTGGCTGCTTCTCTCTCTCTCTCTCTTTT 241 TTGGGGGCTCATTTTTGCTGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTG 321 CTAGAGCTGACAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTGAGGCTGTCAC 401 AGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTTCCTTATCTGTCACACCTGTGCCTCCTCAGA 481 GGACAGTTTTTTTGTTGTTGTGTTTTTTTGTTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAG 561 ACAGAGTCCCTGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAGAATAGCACAA 641 ACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGGGGTGAACTTCAGGTGGATGAGGAGACAGAA 721 TAGAGTGATAGGAAGCGTCTGGCAGATACTCCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCAC 801 ATGCTGGCCGCTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTGGGGGACTG 881 GCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTCACGTTCTCCACACGGGGGAGAGACGCAGTC 961 CGCCCAGGTCCCCGCTTTCTTTGGAGGCAGCAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCC 1041 CTCCTCCCTGTCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGGCTGTTCCTGA 1121 GAAATAAAAAGCCTGTCATTTCAAACACTGCTGTGGACCCTACTGGGTTTTTAAAATATTGTCAGTTTTTCATCGTCGTC 1201 CCTAGCCTGCCAACAGCCATCTGCCCAGACAGCCGCAGTGAGGATGAGCGTCCTGGCAGAGACGCAGTTGTCTCTGGGCG 1281 CTTGCCAGAGCCACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAG 1361 ACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTT 1441 GTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATA 1521 CTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGC 1601 ATGCCAGGCGGTGATGTGGATCTCGGCTTCTGTGAGCCTGTGCTGTGGGCAGGGCTGAGCTGGAGCCGCCCCTCTCAGCC 1681 CGCCTGCCACGGCCTTTCCTTAAAGGCCATCCTTAAAACCAGACCCTCATGGCTACCAGCACCTGAAAGCTTCCTCGACA 1761 TCTGTTAATAAAGCCGTAGGCCCTTGTCTAAGTGCAACCGCCTAGACTTTCTTTCAGATACATGTCCACATGTCCATTTT 1841 TCAGGTTCTCTAAGTTGGAGTGGAGTCTGGGAAGGGTTGTGAATGAGGCTTCTGGGCTATGGGTGAGGTTCCAATGGCAG 1921 GTTAGAGCCCCTCGGGCCAACTGCCATCCTGGAAAGTAGAGACAGCAGTGCCCGCTGCCCAGAAGAGACCAGCAAGCCAA 2001 ACTGGAGCCCCCATTGCAGGCTGTCGCCATGTGGAAAGAGTAACTCACAATTGCCAATAAAGTCTCATGTGGTTTTATCT 2081 AAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | |||||||||
| Validation Method |
|
|||||||||
| Conditions | HEK293 | |||||||||
| Location of target site | 3'UTR | |||||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
|||||||||
| miRNA-target interactions (Provided by authors) |
|
|||||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
|||||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 332.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 332.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| CLIP-seq Support 1 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000301633.4 | 3UTR | ACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000301633.4 | 3UTR | CACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000301633.4 | 3UTR | CACUCCAGCCUCUGUACUCAUCUAAGCUGCUUAUUUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000301633.4 | 3UTR | UACUCAUCUAAGCUGCUUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000301633.4 | 3UTR | CCUCUGUACUCAUCUAAGCUGCUUAUUUUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
243 hsa-miR-646 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT061535 | BTG2 | BTG anti-proliferation factor 2 |  |
|
2 | 4 | ||||||
| MIRT064692 | CCND2 | cyclin D2 | |
|
2 | 4 | ||||||
| MIRT068834 | FNDC3A | fibronectin type III domain containing 3A | |
|
2 | 10 | ||||||
| MIRT079080 | BIRC5 | baculoviral IAP repeat containing 5 | |
|
2 | 6 | ||||||
| MIRT092735 | SETD5 | SET domain containing 5 | |
|
2 | 4 | ||||||
| MIRT093692 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
|
2 | 6 | ||||||
| MIRT096244 | CANX | calnexin | |
|
2 | 2 | ||||||
| MIRT096296 | SQSTM1 | sequestosome 1 | |
|
2 | 4 | ||||||
| MIRT098839 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
|
2 | 2 | ||||||
| MIRT100229 | PRR3 | proline rich 3 | |
|
2 | 4 | ||||||
| MIRT156479 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | |
|
2 | 2 | ||||||
| MIRT186378 | PNRC2 | proline rich nuclear receptor coactivator 2 | |
|
2 | 2 | ||||||
| MIRT196460 | TAOK1 | TAO kinase 1 | |
|
2 | 2 | ||||||
| MIRT211252 | FGF2 | fibroblast growth factor 2 | |
|
2 | 2 | ||||||
| MIRT215233 | NPM1 | nucleophosmin 1 | |
|
2 | 4 | ||||||
| MIRT215383 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT224972 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 4 | ||||||
| MIRT235598 | KIF3B | kinesin family member 3B | |
|
2 | 2 | ||||||
| MIRT249860 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 2 | ||||||
| MIRT258407 | FOXK1 | forkhead box K1 | |
|
2 | 2 | ||||||
| MIRT269359 | WEE1 | WEE1 G2 checkpoint kinase | |
|
2 | 4 | ||||||
| MIRT310455 | REST | RE1 silencing transcription factor | |
|
2 | 2 | ||||||
| MIRT314057 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | |
|
2 | 8 | ||||||
| MIRT322288 | SLC39A14 | solute carrier family 39 member 14 | |
|
2 | 2 | ||||||
| MIRT326311 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
|
2 | 2 | ||||||
| MIRT329703 | SCD | stearoyl-CoA desaturase | |
|
2 | 2 | ||||||
| MIRT341278 | PABPN1 | poly(A) binding protein nuclear 1 | |
|
2 | 3 | ||||||
| MIRT403798 | AKIRIN1 | akirin 1 | |
|
2 | 2 | ||||||
| MIRT438549 | NOB1 | NIN1/PSMD8 binding protein 1 homolog | |
1 | 1 | |||||||
| MIRT441908 | SEPN1 | selenoprotein N | |
|
2 | 2 | ||||||
| MIRT444125 | ZNRF3 | zinc and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT445458 | EXT1 | exostosin glycosyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT446500 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT446538 | GOLGA8B | golgin A8 family member B | |
|
2 | 2 | ||||||
| MIRT447770 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT448438 | TLL1 | tolloid like 1 | |
|
2 | 2 | ||||||
| MIRT448768 | GOLGA8A | golgin A8 family member A | |
|
2 | 2 | ||||||
| MIRT460749 | SRP14 | signal recognition particle 14 | |
|
2 | 2 | ||||||
| MIRT461556 | ACTR3B | ARP3 actin related protein 3 homolog B | |
|
2 | 2 | ||||||
| MIRT463163 | ZNF367 | zinc finger protein 367 | |
|
2 | 10 | ||||||
| MIRT464234 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
5 | 12 | |||
| MIRT464496 | UCK2 | uridine-cytidine kinase 2 | |
|
2 | 2 | ||||||
| MIRT465157 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT466429 | TFAP2A | transcription factor AP-2 alpha | |
|
2 | 8 | ||||||
| MIRT467395 | SOCS5 | suppressor of cytokine signaling 5 | |
|
2 | 2 | ||||||
| MIRT468672 | SEC24A | SEC24 homolog A, COPII coat complex component | |
|
2 | 4 | ||||||
| MIRT469407 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 6 | ||||||
| MIRT470750 | PNPLA6 | patatin like phospholipase domain containing 6 | |
|
2 | 2 | ||||||
| MIRT471947 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
|
2 | 2 | ||||||
| MIRT472468 | NAPG | NSF attachment protein gamma | |
|
2 | 12 | ||||||
| MIRT474571 | KLHDC3 | kelch domain containing 3 | |
|
2 | 2 | ||||||
| MIRT477443 | ELOVL5 | ELOVL fatty acid elongase 5 | |
|
2 | 2 | ||||||
| MIRT480541 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 12 | ||||||
| MIRT482110 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 4 | ||||||
| MIRT485206 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | |
|
2 | 8 | ||||||
| MIRT492318 | SETD1B | SET domain containing 1B | |
|
2 | 4 | ||||||
| MIRT497144 | TAPBP | TAP binding protein | |
|
2 | 2 | ||||||
| MIRT498976 | ORC4 | origin recognition complex subunit 4 | |
|
2 | 8 | ||||||
| MIRT499112 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | |
|
2 | 8 | ||||||
| MIRT499448 | ODF2L | outer dense fiber of sperm tails 2 like | |
|
2 | 8 | ||||||
| MIRT500089 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
|
2 | 8 | ||||||
| MIRT500317 | ZNF622 | zinc finger protein 622 | |
|
2 | 8 | ||||||
| MIRT500414 | ZMAT3 | zinc finger matrin-type 3 | |
|
2 | 8 | ||||||
| MIRT500572 | USP53 | ubiquitin specific peptidase 53 | |
|
2 | 2 | ||||||
| MIRT500596 | UBN2 | ubinuclein 2 | |
|
2 | 10 | ||||||
| MIRT500797 | TLK1 | tousled like kinase 1 | |
|
2 | 8 | ||||||
| MIRT500932 | SRPR | SRP receptor alpha subunit | |
|
2 | 6 | ||||||
| MIRT500946 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | |
|
2 | 8 | ||||||
| MIRT501081 | SMAD7 | SMAD family member 7 | |
|
2 | 8 | ||||||
| MIRT501515 | PPTC7 | PTC7 protein phosphatase homolog | |
|
2 | 6 | ||||||
| MIRT501879 | MOB4 | MOB family member 4, phocein | |
|
2 | 8 | ||||||
| MIRT502195 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
|
2 | 8 | ||||||
| MIRT502630 | DDX3X | DEAD-box helicase 3, X-linked | |
|
2 | 8 | ||||||
| MIRT502650 | DCTN5 | dynactin subunit 5 | |
|
2 | 8 | ||||||
| MIRT502914 | CDCA4 | cell division cycle associated 4 | |
|
2 | 8 | ||||||
| MIRT502938 | CDC37L1 | cell division cycle 37 like 1 | |
|
2 | 8 | ||||||
| MIRT502987 | CCND1 | cyclin D1 | |
|
|
|
6 | 3 | ||||
| MIRT503181 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 6 | ||||||
| MIRT504532 | ZNF620 | zinc finger protein 620 | |
|
2 | 6 | ||||||
| MIRT504715 | DLC1 | DLC1 Rho GTPase activating protein | |
|
2 | 6 | ||||||
| MIRT504967 | ZNRF2 | zinc and ring finger 2 | |
|
2 | 2 | ||||||
| MIRT505073 | ZFHX4 | zinc finger homeobox 4 | |
|
2 | 6 | ||||||
| MIRT505109 | YTHDC1 | YTH domain containing 1 | |
|
2 | 6 | ||||||
| MIRT505342 | TMEM245 | transmembrane protein 245 | |
|
2 | 6 | ||||||
| MIRT505389 | TMEM100 | transmembrane protein 100 | |
|
2 | 2 | ||||||
| MIRT505681 | SESTD1 | SEC14 and spectrin domain containing 1 | |
|
2 | 6 | ||||||
| MIRT506162 | PLAG1 | PLAG1 zinc finger | |
|
2 | 8 | ||||||
| MIRT506185 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | |
|
2 | 6 | ||||||
| MIRT506354 | NUP50 | nucleoporin 50 | |
|
2 | 6 | ||||||
| MIRT506480 | MYO5A | myosin VA | |
|
2 | 6 | ||||||
| MIRT506833 | KIF23 | kinesin family member 23 | |
|
2 | 6 | ||||||
| MIRT507310 | FEM1B | fem-1 homolog B | |
|
2 | 4 | ||||||
| MIRT507847 | CCNE2 | cyclin E2 | |
|
2 | 6 | ||||||
| MIRT508670 | DIABLO | diablo IAP-binding mitochondrial protein | |
|
2 | 4 | ||||||
| MIRT509137 | ZNF691 | zinc finger protein 691 | |
|
2 | 4 | ||||||
| MIRT509686 | ATAD5 | ATPase family, AAA domain containing 5 | |
|
2 | 4 | ||||||
| MIRT512205 | C1orf21 | chromosome 1 open reading frame 21 | |
|
2 | 6 | ||||||
| MIRT518087 | TRIM35 | tripartite motif containing 35 | |
|
2 | 2 | ||||||
| MIRT518990 | NNT | nicotinamide nucleotide transhydrogenase | |
|
2 | 4 | ||||||
| MIRT520964 | SPRED1 | sprouty related EVH1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT521049 | SLC2A3 | solute carrier family 2 member 3 | |
|
2 | 4 | ||||||
| MIRT521192 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 6 | ||||||
| MIRT521619 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 6 | ||||||
| MIRT522770 | LAMTOR1 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 | |
|
2 | 2 | ||||||
| MIRT533754 | TMEM184B | transmembrane protein 184B | |
|
2 | 2 | ||||||
| MIRT534131 | SNTB2 | syntrophin beta 2 | |
|
2 | 4 | ||||||
| MIRT537159 | GID8 | GID complex subunit 8 homolog | |
|
2 | 2 | ||||||
| MIRT537812 | EFNB2 | ephrin B2 | |
|
2 | 4 | ||||||
| MIRT538108 | DDX6 | DEAD-box helicase 6 | |
|
2 | 2 | ||||||
| MIRT540839 | GNAT1 | G protein subunit alpha transducin 1 | |
|
2 | 4 | ||||||
| MIRT541019 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
|
2 | 2 | ||||||
| MIRT541145 | PISD | phosphatidylserine decarboxylase | |
|
2 | 2 | ||||||
| MIRT541387 | CDC42SE2 | CDC42 small effector 2 | |
|
2 | 2 | ||||||
| MIRT541422 | CBX4 | chromobox 4 | |
|
2 | 2 | ||||||
| MIRT543521 | PRSS21 | protease, serine 21 | |
|
2 | 2 | ||||||
| MIRT543794 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | |
|
2 | 4 | ||||||
| MIRT543831 | GSG1 | germ cell associated 1 | |
|
2 | 2 | ||||||
| MIRT544961 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | |
|
2 | 2 | ||||||
| MIRT545182 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
|
2 | 4 | ||||||
| MIRT545343 | CCDC83 | coiled-coil domain containing 83 | |
|
2 | 2 | ||||||
| MIRT545367 | LIN7C | lin-7 homolog C, crumbs cell polarity complex component | |
|
2 | 2 | ||||||
| MIRT545656 | SPARC | secreted protein acidic and cysteine rich | |
|
2 | 2 | ||||||
| MIRT545678 | DECR1 | 2,4-dienoyl-CoA reductase 1 | |
|
2 | 2 | ||||||
| MIRT545938 | ZBTB44 | zinc finger and BTB domain containing 44 | |
|
2 | 4 | ||||||
| MIRT546107 | USP48 | ubiquitin specific peptidase 48 | |
|
2 | 4 | ||||||
| MIRT546603 | SALL1 | spalt like transcription factor 1 | |
|
2 | 4 | ||||||
| MIRT546628 | RTN4 | reticulon 4 | |
|
2 | 2 | ||||||
| MIRT547321 | NPTN | neuroplastin | |
|
2 | 2 | ||||||
| MIRT547660 | KPNA3 | karyopherin subunit alpha 3 | |
|
2 | 2 | ||||||
| MIRT547994 | HCFC2 | host cell factor C2 | |
|
2 | 4 | ||||||
| MIRT548048 | GOLIM4 | golgi integral membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT548098 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | |
|
2 | 4 | ||||||
| MIRT548721 | CRK | CRK proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT548938 | CDK17 | cyclin dependent kinase 17 | |
|
2 | 2 | ||||||
| MIRT549071 | CACUL1 | CDK2 associated cullin domain 1 | |
|
2 | 2 | ||||||
| MIRT549272 | ASH1L | ASH1 like histone lysine methyltransferase | |
|
2 | 2 | ||||||
| MIRT549438 | ACTR2 | ARP2 actin related protein 2 homolog | |
|
2 | 2 | ||||||
| MIRT550462 | OSCAR | osteoclast associated, immunoglobulin-like receptor | |
|
2 | 4 | ||||||
| MIRT550794 | WARS2 | tryptophanyl tRNA synthetase 2, mitochondrial | |
|
2 | 2 | ||||||
| MIRT550819 | FAM229B | family with sequence similarity 229 member B | |
|
2 | 2 | ||||||
| MIRT551537 | EMB | embigin | |
|
2 | 2 | ||||||
| MIRT552031 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 2 | ||||||
| MIRT552340 | ZNF704 | zinc finger protein 704 | |
|
2 | 2 | ||||||
| MIRT552444 | ZNF449 | zinc finger protein 449 | |
|
2 | 2 | ||||||
| MIRT553116 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
|
2 | 2 | ||||||
| MIRT553448 | TOX4 | TOX high mobility group box family member 4 | |
|
2 | 2 | ||||||
| MIRT553725 | TBX18 | T-box 18 | |
|
2 | 2 | ||||||
| MIRT553805 | SZRD1 | SUZ RNA binding domain containing 1 | |
|
2 | 4 | ||||||
| MIRT554696 | RNF149 | ring finger protein 149 | |
|
2 | 2 | ||||||
| MIRT554831 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
2 | 2 | ||||||
| MIRT555139 | PTPRD | protein tyrosine phosphatase, receptor type D | |
|
2 | 2 | ||||||
| MIRT555269 | PRDM4 | PR/SET domain 4 | |
|
2 | 2 | ||||||
| MIRT555312 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | |
|
2 | 4 | ||||||
| MIRT555558 | PLEKHA1 | pleckstrin homology domain containing A1 | |
|
2 | 2 | ||||||
| MIRT556379 | LURAP1L | leucine rich adaptor protein 1 like | |
|
2 | 2 | ||||||
| MIRT556669 | KMT2D | lysine methyltransferase 2D | |
|
2 | 4 | ||||||
| MIRT556853 | KANK1 | KN motif and ankyrin repeat domains 1 | |
|
2 | 4 | ||||||
| MIRT557476 | GPR27 | G protein-coupled receptor 27 | |
|
2 | 4 | ||||||
| MIRT558361 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT558385 | DHX33 | DEAH-box helicase 33 | |
|
2 | 2 | ||||||
| MIRT558502 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | |
|
2 | 4 | ||||||
| MIRT558515 | CTDSPL | CTD small phosphatase like | |
|
2 | 4 | ||||||
| MIRT558583 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
2 | 4 | ||||||
| MIRT558641 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | |
|
2 | 2 | ||||||
| MIRT558653 | CNKSR3 | CNKSR family member 3 | |
|
2 | 2 | ||||||
| MIRT558865 | CD2AP | CD2 associated protein | |
|
2 | 2 | ||||||
| MIRT558888 | CCNE1 | cyclin E1 | |
|
2 | 4 | ||||||
| MIRT559002 | CA8 | carbonic anhydrase 8 | |
|
2 | 2 | ||||||
| MIRT559149 | BTN3A3 | butyrophilin subfamily 3 member A3 | |
|
2 | 2 | ||||||
| MIRT559999 | RAB3IP | RAB3A interacting protein | |
|
2 | 2 | ||||||
| MIRT562023 | LANCL1 | LanC like 1 | |
|
2 | 2 | ||||||
| MIRT562474 | CNOT6L | CCR4-NOT transcription complex subunit 6 like | |
|
2 | 2 | ||||||
| MIRT562586 | CBX2 | chromobox 2 | |
|
2 | 2 | ||||||
| MIRT562595 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | |
|
2 | 2 | ||||||
| MIRT562873 | KIAA1456 | KIAA1456 | |
|
2 | 2 | ||||||
| MIRT562989 | KIAA0408 | KIAA0408 | |
|
2 | 4 | ||||||
| MIRT563082 | SLC25A12 | solute carrier family 25 member 12 | |
|
2 | 2 | ||||||
| MIRT563499 | DLGAP3 | DLG associated protein 3 | |
|
2 | 2 | ||||||
| MIRT563892 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | |
|
2 | 2 | ||||||
| MIRT564328 | CCNT1 | cyclin T1 | |
|
2 | 2 | ||||||
| MIRT564945 | XKR7 | XK related 7 | |
|
2 | 2 | ||||||
| MIRT564981 | WNK3 | WNK lysine deficient protein kinase 3 | |
|
2 | 2 | ||||||
| MIRT566302 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | |
|
2 | 2 | ||||||
| MIRT566701 | MTMR3 | myotubularin related protein 3 | |
|
2 | 2 | ||||||
| MIRT566827 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | |
|
2 | 2 | ||||||
| MIRT571236 | SCAMP4 | secretory carrier membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT571424 | RIF1 | replication timing regulatory factor 1 | |
|
2 | 2 | ||||||
| MIRT571637 | SKI | SKI proto-oncogene | |
|
2 | 2 | ||||||
| MIRT571836 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT571962 | KIF5B | kinesin family member 5B | |
|
2 | 2 | ||||||
| MIRT572104 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 2 | ||||||
| MIRT572183 | CDK6 | cyclin dependent kinase 6 | |
|
2 | 2 | ||||||
| MIRT572720 | RBL1 | RB transcriptional corepressor like 1 | |
|
2 | 2 | ||||||
| MIRT574589 | N4BP1 | NEDD4 binding protein 1 | |
|
2 | 2 | ||||||
| MIRT575878 | Cask | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | |
|
2 | 3 | ||||||
| MIRT609979 | HERPUD2 | HERPUD family member 2 | |
|
2 | 2 | ||||||
| MIRT612932 | GPRIN3 | GPRIN family member 3 | |
|
2 | 2 | ||||||
| MIRT614327 | C1orf220 | chromosome 1 open reading frame 220 | |
|
2 | 2 | ||||||
| MIRT614694 | TRAK1 | trafficking kinesin protein 1 | |
|
2 | 2 | ||||||
| MIRT618328 | IPP | intracisternal A particle-promoted polypeptide | |
|
2 | 2 | ||||||
| MIRT618456 | ZFP30 | ZFP30 zinc finger protein | |
|
2 | 4 | ||||||
| MIRT621135 | EMC7 | ER membrane protein complex subunit 7 | |
|
2 | 4 | ||||||
| MIRT622878 | PDE12 | phosphodiesterase 12 | |
|
2 | 4 | ||||||
| MIRT631163 | CCBE1 | collagen and calcium binding EGF domains 1 | |
|
2 | 2 | ||||||
| MIRT632793 | KREMEN1 | kringle containing transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT636731 | AFAP1 | actin filament associated protein 1 | |
|
2 | 2 | ||||||
| MIRT649297 | IRF8 | interferon regulatory factor 8 | |
|
2 | 2 | ||||||
| MIRT650955 | QPCTL | glutaminyl-peptide cyclotransferase like | |
|
2 | 2 | ||||||
| MIRT653267 | SOGA3 | SOGA family member 3 | |
|
2 | 2 | ||||||
| MIRT654665 | PSMG1 | proteasome assembly chaperone 1 | |
|
2 | 2 | ||||||
| MIRT656180 | MPRIP | myosin phosphatase Rho interacting protein | |
|
2 | 2 | ||||||
| MIRT659252 | CUL3 | cullin 3 | |
|
2 | 2 | ||||||
| MIRT663826 | NLRP12 | NLR family pyrin domain containing 12 | |
|
2 | 4 | ||||||
| MIRT676632 | CSNK1E | casein kinase 1 epsilon | |
|
2 | 2 | ||||||
| MIRT679503 | ZNF106 | zinc finger protein 106 | |
|
2 | 2 | ||||||
| MIRT680978 | DCAF17 | DDB1 and CUL4 associated factor 17 | |
|
2 | 2 | ||||||
| MIRT682272 | RS1 | retinoschisin 1 | |
|
2 | 2 | ||||||
| MIRT682421 | OLR1 | oxidized low density lipoprotein receptor 1 | |
|
2 | 2 | ||||||
| MIRT682510 | GLP2R | glucagon like peptide 2 receptor | |
|
2 | 2 | ||||||
| MIRT693926 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | |
|
2 | 2 | ||||||
| MIRT700660 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
|
2 | 2 | ||||||
| MIRT700740 | PLEKHA8 | pleckstrin homology domain containing A8 | |
|
2 | 2 | ||||||
| MIRT702871 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
|
2 | 2 | ||||||
| MIRT703192 | GPBP1 | GC-rich promoter binding protein 1 | |
|
2 | 2 | ||||||
| MIRT704453 | CSNK2A1 | casein kinase 2 alpha 1 | |
|
2 | 2 | ||||||
| MIRT704709 | CHEK1 | checkpoint kinase 1 | |
|
2 | 2 | ||||||
| MIRT706164 | CASK | calcium/calmodulin dependent serine protein kinase | |
|
2 | 3 | ||||||
| MIRT713334 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | |
|
2 | 2 | ||||||
| MIRT713416 | SLC35E2B | solute carrier family 35 member E2B | |
|
2 | 2 | ||||||
| MIRT716300 | PAX1 | paired box 1 | |
|
2 | 2 | ||||||
| MIRT717394 | PTPRF | protein tyrosine phosphatase, receptor type F | |
|
2 | 2 | ||||||
| MIRT718453 | BTNL9 | butyrophilin like 9 | |
|
2 | 2 | ||||||
| MIRT718728 | VWA9 | integrator complex subunit 14 | |
|
2 | 2 | ||||||
| MIRT719029 | SHROOM3 | shroom family member 3 | |
|
2 | 2 | ||||||
| MIRT720367 | ZBTB8B | zinc finger and BTB domain containing 8B | |
|
2 | 2 | ||||||
| MIRT723120 | ZSCAN16 | zinc finger and SCAN domain containing 16 | |
|
2 | 2 | ||||||
| MIRT733741 | EGFR | epidermal growth factor receptor | |
|
|
|
4 | 0 | ||||
| MIRT734281 | HIF1A | hypoxia inducible factor 1 alpha subunit | |
|
|
3 | 0 | |||||
| MIRT735934 | EYA3 | EYA transcriptional coactivator and phosphatase 3 | |
|
|
3 | 0 | |||||
| MIRT755830 | IGF1 | insulin like growth factor 1 | 5 | 1 | ||||||||
| MIRT755831 | BCL2 | BCL2, apoptosis regulator | 4 | 1 | ||||||||
| MIRT755832 | CDK2 | cyclin dependent kinase 2 | 4 | 1 | ||||||||
| MIRT755833 | BAX | BCL2 associated X, apoptosis regulator | 4 | 1 | ||||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|