miRTarBase - #MIRT080004


—
pre-miRNA Information
pre-miRNA hsa-mir-4251   
Genomic Coordinates chr1: 3127975 - 3128035
Description Homo sapiens miR-4251 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4251
Sequence 35| CCUGAGAAAAGGGCCAA |51
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs529666453 6 dbSNP
rs761641851 13 dbSNP
rs1417009298 15 dbSNP
rs915117785 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MYL12B   
Synonyms MLC-B, MRLC2
Description myosin light chain 12B
Transcript NM_001144944   
Other Transcripts NM_001144945 , NM_033546   
Expression
Putative miRNA Targets on MYL12B
3'UTR of MYL12B
(miRNA target sites are highlighted)		 
>MYL12B|NM_001144944|3'UTR
   1 AAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTTCTCAGACACTTCCCCCACCCTCATAGAAC
  81 CTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACT
 161 TGTATAATCAGACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACAAATGTGAAA
 241 GCCCAGAAAAATATATTCGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGTTATTTTGAAATAAA
 321 GATTATGCTGACTCAAATGCAATGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaccGGGAA--AAGAGUCc 5'
              |::||  ||||||| 
Target 5' ctctCTTTTACTTCTCAGa 3'
 39 - 57 147.00 -10.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31599946 4 COSMIC
COSN30181774 16 COSMIC
COSN28878313 40 COSMIC
COSN30040459 44 COSMIC
COSN30121222 58 COSMIC
COSN1205260 165 COSMIC
COSN30120740 217 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755500497 6 dbSNP
rs1020260405 7 dbSNP
rs779442114 9 dbSNP
rs551834738 10 dbSNP
rs1317886064 12 dbSNP
rs1254801519 13 dbSNP
rs1440242782 15 dbSNP
rs752945133 18 dbSNP
rs752382430 20 dbSNP
rs780772250 23 dbSNP
rs1168286409 26 dbSNP
rs150425942 31 dbSNP
rs1463687153 36 dbSNP
rs1168738569 43 dbSNP
rs1392216137 44 dbSNP
rs958559427 44 dbSNP
rs779511346 46 dbSNP
rs993099608 47 dbSNP
rs55947816 53 dbSNP
rs537417083 58 dbSNP
rs557652289 64 dbSNP
rs1399548536 67 dbSNP
rs1246420725 70 dbSNP
rs1177078253 71 dbSNP
rs1290773519 74 dbSNP
rs1357467958 78 dbSNP
rs1011968774 81 dbSNP
rs1219108778 83 dbSNP
rs1261335544 90 dbSNP
rs574212590 94 dbSNP
rs188223835 103 dbSNP
rs1175031019 109 dbSNP
rs553279303 112 dbSNP
rs369668874 116 dbSNP
rs570353774 116 dbSNP
rs546718839 119 dbSNP
rs1321806966 130 dbSNP
rs1255813823 138 dbSNP
rs1183302915 140 dbSNP
rs1319017095 147 dbSNP
rs1304956522 152 dbSNP
rs1390831187 154 dbSNP
rs1383640733 162 dbSNP
rs540700743 163 dbSNP
rs371514507 181 dbSNP
rs1422315184 186 dbSNP
rs886572848 192 dbSNP
rs971697337 194 dbSNP
rs181387021 196 dbSNP
rs1452419674 199 dbSNP
rs1234516865 202 dbSNP
rs757097229 203 dbSNP
rs1453983008 204 dbSNP
rs561620630 207 dbSNP
rs368049458 215 dbSNP
rs778941922 216 dbSNP
rs577234267 217 dbSNP
rs750367885 218 dbSNP
rs755065833 220 dbSNP
rs1041218375 231 dbSNP
rs974797896 236 dbSNP
rs1259128575 237 dbSNP
rs1239729590 244 dbSNP
rs1380336269 245 dbSNP
rs1059935 247 dbSNP
rs1225302787 255 dbSNP
rs781308483 259 dbSNP
rs1010458089 260 dbSNP
rs954605320 264 dbSNP
rs199645542 274 dbSNP
rs1213660777 277 dbSNP
rs1020207982 286 dbSNP
rs1257840073 291 dbSNP
rs987342437 294 dbSNP
rs923772373 296 dbSNP
rs935122650 298 dbSNP
rs1241888998 299 dbSNP
rs748301401 301 dbSNP
rs1418754855 303 dbSNP
rs542972682 305 dbSNP
rs1441900023 326 dbSNP
rs1178201059 329 dbSNP
rs563602077 333 dbSNP
rs1034427531 336 dbSNP
rs915124700 348 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aaccGGGAA--AAGAGucc 5'
              |::||  |||||   
Target 5' cucuCUUUUACUUCUC--- 3'
 		14 - 29
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000237500.5 | 3UTR | UUACAUUGUCUUACUCUCUUUUACUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
98 hsa-miR-4251 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056156 OTUD1 OTU deubiquitinase 1 2 2
MIRT080004 MYL12B myosin light chain 12B 2 2
MIRT080407 ONECUT2 one cut homeobox 2 2 2
MIRT081901 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT090342 SEC61A1 Sec61 translocon alpha 1 subunit 2 8
MIRT096824 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT140185 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT149716 LDLR low density lipoprotein receptor 2 6
MIRT205293 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT213265 REST RE1 silencing transcription factor 2 6
MIRT254069 BACH1 BTB domain and CNC homolog 1 2 2
MIRT256251 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT264966 TMEM136 transmembrane protein 136 2 2
MIRT267496 FEN1 flap structure-specific endonuclease 1 2 2
MIRT285077 MIER1 MIER1 transcriptional regulator 2 2
MIRT296167 NCOA3 nuclear receptor coactivator 3 2 2
MIRT316073 ABRACL ABRA C-terminal like 2 2
MIRT360286 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT364793 PRRC2B proline rich coiled-coil 2B 2 2
MIRT443277 TSPAN15 tetraspanin 15 2 2
MIRT443453 CLIC5 chloride intracellular channel 5 2 2
MIRT445938 KLHL32 kelch like family member 32 2 2
MIRT448012 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448382 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 4
MIRT448499 RYBP RING1 and YY1 binding protein 2 2
MIRT449896 C11orf34 placenta expressed transcript 1 1 2
MIRT450457 ZDHHC2 zinc finger DHHC-type containing 2 2 2
MIRT450849 HTR2A 5-hydroxytryptamine receptor 2A 2 2
MIRT453774 NUCB1 nucleobindin 1 2 10
MIRT464399 URM1 ubiquitin related modifier 1 2 2
MIRT465008 TUBB2A tubulin beta 2A class IIa 2 8
MIRT465145 TSC22D2 TSC22 domain family member 2 2 2
MIRT467799 SLC2A14 solute carrier family 2 member 14 2 2
MIRT472597 NACC1 nucleus accumbens associated 1 2 2
MIRT477969 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT486586 ZNF619 zinc finger protein 619 2 2
MIRT487739 MICAL2 microtubule associated monooxygenase, calponin and LIM domain containing 2 2 4
MIRT492529 PTMA prothymosin, alpha 2 6
MIRT496845 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT499064 CTBP1 C-terminal binding protein 1 2 4
MIRT502046 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 6
MIRT503907 ZSCAN25 zinc finger and SCAN domain containing 25 2 2
MIRT506776 KLHL15 kelch like family member 15 2 4
MIRT510003 UCP1 uncoupling protein 1 2 6
MIRT513040 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT513174 MOAP1 modulator of apoptosis 1 2 6
MIRT517592 ZNF579 zinc finger protein 579 2 4
MIRT521825 POLR1D RNA polymerase I subunit D 2 2
MIRT530663 TRIM56 tripartite motif containing 56 2 2
MIRT531718 TARS threonyl-tRNA synthetase 2 2
MIRT535154 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT536385 LEFTY1 left-right determination factor 1 2 2
MIRT543847 APIP APAF1 interacting protein 2 2
MIRT546973 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT548667 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT548799 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT549610 TMEM101 transmembrane protein 101 2 2
MIRT549716 NUP37 nucleoporin 37 2 4
MIRT549873 ZNF260 zinc finger protein 260 2 2
MIRT555383 PPP1CC protein phosphatase 1 catalytic subunit gamma 2 2
MIRT566976 LBR lamin B receptor 2 2
MIRT568052 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT570970 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT571174 ZNF85 zinc finger protein 85 2 2
MIRT571364 ZNF45 zinc finger protein 45 2 2
MIRT572309 LSM4 LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT572493 BTN2A2 butyrophilin subfamily 2 member A2 2 2
MIRT606783 KIAA0040 KIAA0040 2 5
MIRT607952 NFAM1 NFAT activating protein with ITAM motif 1 2 10
MIRT609978 HERPUD2 HERPUD family member 2 2 2
MIRT610069 CD300E CD300e molecule 2 2
MIRT610118 IL17REL interleukin 17 receptor E like 2 2
MIRT610151 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611075 ZNF621 zinc finger protein 621 2 2
MIRT612011 COX17 COX17, cytochrome c oxidase copper chaperone 2 2
MIRT617901 PTCHD3 patched domain containing 3 2 2
MIRT618052 MRVI1 murine retrovirus integration site 1 homolog 2 2
MIRT619526 ZNF74 zinc finger protein 74 2 2
MIRT624276 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT625357 MGLL monoglyceride lipase 2 2
MIRT626756 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 2 2
MIRT628851 FAM151B family with sequence similarity 151 member B 2 2
MIRT630458 GMPS guanine monophosphate synthase 2 2
MIRT634536 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638806 DCTN3 dynactin subunit 3 2 2
MIRT647607 TMTC2 transmembrane and tetratricopeptide repeat containing 2 2 2
MIRT650885 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT653507 SLC43A2 solute carrier family 43 member 2 2 2
MIRT658608 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT666345 SKAP2 src kinase associated phosphoprotein 2 2 2
MIRT693743 ACACA acetyl-CoA carboxylase alpha 2 2
MIRT704049 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT709789 CYBRD1 cytochrome b reductase 1 2 2
MIRT711837 AMOTL2 angiomotin like 2 2 2
MIRT711875 VASP vasodilator stimulated phosphoprotein 2 2
MIRT717349 RAB40A RAB40A, member RAS oncogene family 2 2
MIRT717746 MYLK myosin light chain kinase 2 2
MIRT725398 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4251 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4251 Doxorubicin 31703 NSC123127 approved resistant High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-4251 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-4251 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4251 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)

Error report submission