miRTarBase - #MIRT080576


—
pre-miRNA Information
pre-miRNA hsa-mir-1185-1   
Genomic Coordinates chr14: 101042977 - 101043062
Synonyms MIRN1185-1, hsa-mir-1185-1, MIR1185-1
Description Homo sapiens miR-1185-1 stem-loop
Comment This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1185-1-3p
Sequence 53| AUAUACAGGGGGAGACUCUUAU |74
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101043033 29233923 MiREDiBase
A-to-I 7 14 + 101043035 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749794228 1 dbSNP
rs369414498 4 dbSNP
rs771096180 5 dbSNP
rs774958411 7 dbSNP
rs1226171972 11 dbSNP
rs1449899083 14 dbSNP
rs761183893 16 dbSNP
rs1380874583 20 dbSNP
rs771625921 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PMAIP1   
Synonyms APR, NOXA
Description phorbol-12-myristate-13-acetate-induced protein 1
Transcript NM_021127   
Expression
Putative miRNA Targets on PMAIP1
3'UTR of PMAIP1
(miRNA target sites are highlighted)		 
>PMAIP1|NM_021127|3'UTR
   1 CTGCATCAAAAACTTGCATGAGGGGACTCCTTCAAAAGAGTTTTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGA
  81 CTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAAT
 161 TTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGA
 241 ATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCG
 321 AAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTG
 401 TTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCACATTGTATATGATTCGGTTTATACATATTACCT
 481 TGTTATAATGAAAAAACTCATTCTGAGAACACTGAAATGTTATACTCAGTGTTGATTTCTTCGGTCACTACACAACGTAA
 561 AATCATTTGTTTCTTTTGACTCAAATTGTATTGCTTCTGTTCAGATGATCTTTCATTCAATGTGTTCCTGTTGGGCGTTA
 641 CTAGAAACTATGGAAAACTGGAAAATAACTTTGAAAAAATTGGATAAAGTATAGGAGGGTTACTTGGGGCCAGTAAATCA
 721 GTAGACTGAACATTCAATATAATAAAAGAACATGGGGATTTTGTATAACCAGGGATAATAAAAAGAAAAAAGAAGTTAAT
 801 TTTTAATTGATGTTTTTGAAACTTAGTAGAACAAATATTCAGAAGTAACTTGATAAGATATGAATGTTTCTAAAGAAGTT
 881 TCTAAAGGTTCGGAAAATGCTCCTTGTCACATTAGTGTGCATCCTACAAAAAGTGATCTCTTAATGTAAATTAAGAATAT
 961 TTTCATAATTGGAATATACTTTTCTTAAAAAAAAGGAACAGTTAGTTCTCATCTAGAATGAAAGTTCCATATATGCATTG
1041 GTGAATATATATGTATACACATACTTACATACTTATATGGGTATCTGTATAGATAATTTGTATTAGAGTATTATATAGCT
1121 TCTTAGTAGGGTCTCAAGTAAGTTTCATTTTTTTTATCTGGGCTATATACAGTCCTCAAATAAATAATGTCTTGATTTTA
1201 TTTCAGCAGGAATAATTTTATTTATTTTGCCTATTTATAATTAAAGTATTTTTCTTTAGTTTGAAAATGTGTATTAAAGT
1281 TACATTTTTGAGTTACAAGAGTCTTATAACTACTTGAATTTTTAGTTAAAATGTCTTAATGTAGGTTGTAGTCACTTTAG
1361 ATGGAAAATTACCTCACATCTGTTTTCTTCAGTATTACTTAAGATTGTTTATTTAGTGGTAGAGAGTTTTTTTTTTCAGC
1441 CTAGAGGCAGCTATTTTACCATCTGGTATTTATGGTCTAATTTGTATTTAAACATATGCACACATATAAAAGTTGATACT
1521 GTGGCAGTAAACTATTAAAAGTTTTCACTGTTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaUUCUCAGAGGGGGACAUAUa 5'
            | |:|| |    ||||||| 
Target 5' atATGGGTAT----CTGTATAg 3'
 1075 - 1092 146.00 -9.80
2 
miRNA  3' uauucUCAG-AGGGGGACAUAUa 5'
               | ||  | | :|||||| 
Target 5' tgccaACTCAGCACATTGTATAt 3'
 435 - 457 129.00 -9.60
3 
miRNA  3' uauucucagaggGGGACAUAUa 5'
                      :::|||||| 
Target 5' agaacatggggaTTTTGTATAa 3'
 747 - 768 126.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31523372 13 COSMIC
COSN20088094 28 COSMIC
COSN23015317 39 COSMIC
COSN5847125 40 COSMIC
COSN32053464 48 COSMIC
COSN1082150 85 COSMIC
COSN31612918 105 COSMIC
COSN30146601 117 COSMIC
COSN31549645 165 COSMIC
COSN31480386 169 COSMIC
COSN31559307 183 COSMIC
COSN30116454 211 COSMIC
COSN5430042 303 COSMIC
COSN5430043 306 COSMIC
COSN31527761 433 COSMIC
COSN31556395 437 COSMIC
COSN30173668 500 COSMIC
COSN30173566 540 COSMIC
COSN31588945 543 COSMIC
COSN28645187 544 COSMIC
COSN31606973 568 COSMIC
COSN6129261 611 COSMIC
COSN17226036 952 COSMIC
COSN9841439 1073 COSMIC
COSN16436086 1168 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs142504944 2 dbSNP
rs199746594 4 dbSNP
rs1394283053 7 dbSNP
rs1435186663 8 dbSNP
rs767708286 15 dbSNP
rs773344454 16 dbSNP
rs760723354 19 dbSNP
rs565088805 20 dbSNP
rs1363605172 23 dbSNP
rs369661307 24 dbSNP
rs755468477 26 dbSNP
rs765533777 27 dbSNP
rs753039812 30 dbSNP
rs1281348139 34 dbSNP
rs1315707157 35 dbSNP
rs758055156 38 dbSNP
rs1317618976 40 dbSNP
rs777557325 41 dbSNP
rs1466389045 49 dbSNP
rs751162307 54 dbSNP
rs753913594 56 dbSNP
rs531143556 59 dbSNP
rs200701850 60 dbSNP
rs769709864 62 dbSNP
rs1357351275 67 dbSNP
rs186289188 69 dbSNP
rs567995177 73 dbSNP
rs111493733 75 dbSNP
rs1290285211 76 dbSNP
rs1346462258 81 dbSNP
rs773395427 86 dbSNP
rs755817967 97 dbSNP
rs760850088 99 dbSNP
rs1344100592 103 dbSNP
rs771025863 104 dbSNP
rs776634359 109 dbSNP
rs559709122 110 dbSNP
rs765771009 111 dbSNP
rs753063688 112 dbSNP
rs1010120763 115 dbSNP
rs1331332621 117 dbSNP
rs763878145 119 dbSNP
rs1272778528 120 dbSNP
rs1475103308 122 dbSNP
rs1254451696 126 dbSNP
rs751287233 127 dbSNP
rs1188520396 134 dbSNP
rs750986075 135 dbSNP
rs756920899 136 dbSNP
rs1206958166 139 dbSNP
rs780859507 142 dbSNP
rs1177727104 143 dbSNP
rs1410147534 146 dbSNP
rs1232549705 150 dbSNP
rs1042039716 154 dbSNP
rs1338496924 156 dbSNP
rs953406595 171 dbSNP
rs1286511094 182 dbSNP
rs1382571868 185 dbSNP
rs1360915040 195 dbSNP
rs987452541 197 dbSNP
rs758732393 204 dbSNP
rs71357660 216 dbSNP
rs1394523772 238 dbSNP
rs935423304 243 dbSNP
rs1018362649 250 dbSNP
rs1357449536 263 dbSNP
rs988237836 267 dbSNP
rs964162487 273 dbSNP
rs549031554 275 dbSNP
rs913096882 292 dbSNP
rs780452079 299 dbSNP
rs7240965 303 dbSNP
rs1043023863 304 dbSNP
rs983028430 305 dbSNP
rs1469892348 306 dbSNP
rs1253637363 307 dbSNP
rs1199568219 317 dbSNP
rs191277486 320 dbSNP
rs1255529351 321 dbSNP
rs937216353 322 dbSNP
rs1057202920 330 dbSNP
rs918186125 331 dbSNP
rs1294988765 335 dbSNP
rs971073051 337 dbSNP
rs1041978 349 dbSNP
rs937055377 356 dbSNP
rs1942918 358 dbSNP
rs914383592 363 dbSNP
rs1389883188 364 dbSNP
rs537293356 373 dbSNP
rs1441951578 374 dbSNP
rs1193154707 383 dbSNP
rs1395919108 383 dbSNP
rs1466853757 387 dbSNP
rs1331684532 389 dbSNP
rs899363524 392 dbSNP
rs1480200364 403 dbSNP
rs780715290 411 dbSNP
rs1041618361 413 dbSNP
rs77732188 419 dbSNP
rs1029095488 422 dbSNP
rs953633499 427 dbSNP
rs1341607069 431 dbSNP
rs1302206984 435 dbSNP
rs1218334182 442 dbSNP
rs1276696886 453 dbSNP
rs1320503848 455 dbSNP
rs181343195 460 dbSNP
rs149001141 464 dbSNP
rs552920759 465 dbSNP
rs572904263 469 dbSNP
rs545058893 473 dbSNP
rs988657611 475 dbSNP
rs915317667 476 dbSNP
rs1436958629 480 dbSNP
rs1376348988 483 dbSNP
rs1172186719 496 dbSNP
rs1477101904 497 dbSNP
rs968096940 509 dbSNP
rs1182457144 512 dbSNP
rs118066714 523 dbSNP
rs1249526106 527 dbSNP
rs1485953960 531 dbSNP
rs1027089439 543 dbSNP
rs1192925938 543 dbSNP
rs3826598 544 dbSNP
rs1352230086 546 dbSNP
rs1279561113 551 dbSNP
rs114858354 555 dbSNP
rs1350480402 556 dbSNP
rs1025218375 557 dbSNP
rs1057037759 558 dbSNP
rs561405337 566 dbSNP
rs1412925279 570 dbSNP
rs1170665256 589 dbSNP
rs916941588 617 dbSNP
rs940349970 621 dbSNP
rs926927156 626 dbSNP
rs530382215 629 dbSNP
rs1409712643 637 dbSNP
rs7240310 638 dbSNP
rs1475425173 642 dbSNP
rs143843017 645 dbSNP
rs1236621009 651 dbSNP
rs1402381245 659 dbSNP
rs898931017 660 dbSNP
rs1448436216 662 dbSNP
rs1284499366 665 dbSNP
rs914331805 670 dbSNP
rs994507813 670 dbSNP
rs1050562678 673 dbSNP
rs889275944 682 dbSNP
rs528105468 684 dbSNP
rs1009603260 690 dbSNP
rs945890052 692 dbSNP
rs770823107 693 dbSNP
rs763032410 695 dbSNP
rs1019178030 716 dbSNP
rs956953516 727 dbSNP
rs1041980136 731 dbSNP
rs1446275852 732 dbSNP
rs1401015869 739 dbSNP
rs774236204 740 dbSNP
rs943900406 749 dbSNP
rs759277656 753 dbSNP
rs1386480111 754 dbSNP
rs1235782008 758 dbSNP
rs899810903 771 dbSNP
rs1256649331 790 dbSNP
rs1353142215 791 dbSNP
rs931325018 791 dbSNP
rs3826599 799 dbSNP
rs1161301369 803 dbSNP
rs1476260081 804 dbSNP
rs980815746 807 dbSNP
rs1242382813 808 dbSNP
rs1187502660 815 dbSNP
rs571368595 822 dbSNP
rs536824219 827 dbSNP
rs1489122892 828 dbSNP
rs58665242 860 dbSNP
rs759482252 861 dbSNP
rs958524802 863 dbSNP
rs1025526043 883 dbSNP
rs1341859375 887 dbSNP
rs57686154 889 dbSNP
rs185902213 892 dbSNP
rs572441307 893 dbSNP
rs1036032297 894 dbSNP
rs1321477106 897 dbSNP
rs1395127162 899 dbSNP
rs1411484419 907 dbSNP
rs1419910067 910 dbSNP
rs535025708 912 dbSNP
rs930430307 918 dbSNP
rs1193785263 922 dbSNP
rs536095469 924 dbSNP
rs552856864 925 dbSNP
rs1246667054 928 dbSNP
rs1454566723 933 dbSNP
rs967491193 946 dbSNP
rs1275712678 949 dbSNP
rs1228113331 973 dbSNP
rs1293297812 987 dbSNP
rs1305868492 987 dbSNP
rs1365999056 990 dbSNP
rs1388717869 995 dbSNP
rs1302295929 997 dbSNP
rs1376205310 1000 dbSNP
rs889308803 1001 dbSNP
rs1273033476 1005 dbSNP
rs572891665 1011 dbSNP
rs1238090843 1012 dbSNP
rs1354901572 1022 dbSNP
rs977204453 1030 dbSNP
rs1254360166 1032 dbSNP
rs1376952765 1033 dbSNP
rs912353276 1037 dbSNP
rs538692412 1039 dbSNP
rs74255491 1046 dbSNP
rs1487404724 1057 dbSNP
rs1471477484 1062 dbSNP
rs1211223020 1077 dbSNP
rs921210068 1081 dbSNP
rs1482259130 1082 dbSNP
rs1009056612 1085 dbSNP
rs1211031516 1090 dbSNP
rs1311698313 1103 dbSNP
rs1040916120 1105 dbSNP
rs558758218 1107 dbSNP
rs1438479967 1111 dbSNP
rs1351094412 1114 dbSNP
rs1287628015 1116 dbSNP
rs1407812479 1117 dbSNP
rs1176241040 1119 dbSNP
rs1303078829 1127 dbSNP
rs1465173221 1134 dbSNP
rs931293805 1138 dbSNP
rs1400757157 1148 dbSNP
rs1413393011 1148 dbSNP
rs573004852 1148 dbSNP
rs892738351 1149 dbSNP
rs765366709 1156 dbSNP
rs575723889 1160 dbSNP
rs1022310831 1164 dbSNP
rs1259981810 1166 dbSNP
rs112680252 1178 dbSNP
rs1483085956 1180 dbSNP
rs1235933013 1183 dbSNP
rs1218099741 1184 dbSNP
rs1459799723 1186 dbSNP
rs544391956 1193 dbSNP
rs1326774351 1215 dbSNP
rs1226436593 1232 dbSNP
rs1336677339 1239 dbSNP
rs1313245724 1248 dbSNP
rs1395220084 1249 dbSNP
rs903845497 1257 dbSNP
rs1290232740 1262 dbSNP
rs1387217464 1272 dbSNP
rs1435224939 1272 dbSNP
rs1399859725 1276 dbSNP
rs1159093603 1291 dbSNP
rs7227934 1299 dbSNP
rs1311551974 1308 dbSNP
rs1166007292 1320 dbSNP
rs1423579795 1321 dbSNP
rs1033745590 1327 dbSNP
rs1188469074 1330 dbSNP
rs958815749 1338 dbSNP
rs1377818244 1339 dbSNP
rs894097632 1340 dbSNP
rs1206895782 1348 dbSNP
rs1469809466 1349 dbSNP
rs574941137 1351 dbSNP
rs1243844057 1352 dbSNP
rs1319657393 1355 dbSNP
rs758854744 1356 dbSNP
rs1224253343 1363 dbSNP
rs1021673738 1368 dbSNP
rs1024534136 1369 dbSNP
rs961996968 1374 dbSNP
rs1318034211 1377 dbSNP
rs34120135 1380 dbSNP
rs7245349 1383 dbSNP
rs1319647872 1395 dbSNP
rs1294604184 1399 dbSNP
rs1457750049 1404 dbSNP
rs1367023221 1405 dbSNP
rs1170718735 1413 dbSNP
rs1450392903 1423 dbSNP
rs1389764098 1424 dbSNP
rs11376390 1427 dbSNP
rs560808893 1427 dbSNP
rs778258920 1427 dbSNP
rs138203769 1428 dbSNP
rs1273351603 1437 dbSNP
rs1457036207 1438 dbSNP
rs1487391649 1441 dbSNP
rs551426467 1448 dbSNP
rs1252782142 1451 dbSNP
rs965194626 1452 dbSNP
rs1196431702 1454 dbSNP
rs975277630 1473 dbSNP
rs1294922887 1479 dbSNP
rs190664610 1483 dbSNP
rs2849431 1484 dbSNP
rs985873459 1485 dbSNP
rs1331144024 1493 dbSNP
rs1181751890 1521 dbSNP
rs1386636316 1525 dbSNP
rs1389195743 1535 dbSNP
rs7232296 1543 dbSNP
rs199734220 1545 dbSNP
rs200740224 1548 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5366.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5366.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000316660.6 | 3UTR | UAUACACAUACUUACAUACUUAUAUGGGUAUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000316660.6 | 3UTR | GUUCCAUAUAUGCAUUGGUGAAUAUAUAUGUAUACACAUACUUACAUACUUAUAUGGGUAUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000316660.6 | 3UTR | AUCUAGAAUGAAAGUUCCAUAUAUGCAUUGGUGAAUAUAUAUGUAUACACAUACUUACAUACUUAUAUGGGUAUCUGUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000316660.6 | 3UTR | UUCCAUAUAUGCAUUGGUGAAUAUAUAUGUAUACACAUACUUACAUACUUAUAUGGGUAUCUGUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000316660.6 | 3UTR | AAAGUUCCAUAUAUGCAUUGGUGAAUAUAUAUGUAUACACAUACUUACAUACUUAUAUGGGUAUCUGUAUAGAUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000316660.6 | 3UTR | UUCCAUAUAUGCAUUGGUGAAUAUAUAUGUAUACACAUACUUACAUACUUAUAUGGGUAUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
114 hsa-miR-1185-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066415 TBK1 TANK binding kinase 1 2 4
MIRT073567 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT074516 USP1 ubiquitin specific peptidase 1 2 4
MIRT080576 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT086539 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086547 MOB4 MOB family member 4, phocein 2 2
MIRT088684 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT090811 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT095500 PURA purine rich element binding protein A 2 2
MIRT109530 KLHL15 kelch like family member 15 2 6
MIRT109807 ZFX zinc finger protein, X-linked 2 2
MIRT117888 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT120273 GSK3B glycogen synthase kinase 3 beta 2 4
MIRT149892 LDLR low density lipoprotein receptor 2 2
MIRT178475 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT193445 RORA RAR related orphan receptor A 2 2
MIRT198527 DSG2 desmoglein 2 2 2
MIRT226427 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT227669 SET SET nuclear proto-oncogene 2 2
MIRT320405 HOXA9 homeobox A9 2 2
MIRT407774 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT439228 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT439312 VAT1L vesicle amine transport 1 like 1 1
MIRT439421 TMOD1 tropomodulin 1 1 1
MIRT439446 TMEM104 transmembrane protein 104 1 1
MIRT439524 STIM2 stromal interaction molecule 2 1 1
MIRT439612 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT439997 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440017 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT440131 NCOA4 nuclear receptor coactivator 4 1 1
MIRT440311 LRRC1 leucine rich repeat containing 1 1 1
MIRT440475 IAPP islet amyloid polypeptide 1 1
MIRT440511 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440617 FOXA2 forkhead box A2 1 1
MIRT440666 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440705 ERO1LB endoplasmic reticulum oxidoreductase 1 beta 1 1
MIRT441007 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441018 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT441062 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT441209 ARCN1 archain 1 1 1
MIRT449461 HAT1 histone acetyltransferase 1 2 2
MIRT467104 SRI sorcin 2 2
MIRT468060 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT468476 SESN3 sestrin 3 2 4
MIRT473533 MAX MYC associated factor X 2 2
MIRT473852 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474711 KIF13A kinesin family member 13A 2 6
MIRT481665 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT485120 SF3B3 splicing factor 3b subunit 3 2 2
MIRT493055 MTFR1 mitochondrial fission regulator 1 2 2
MIRT504258 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504361 ARID1B AT-rich interaction domain 1B 2 4
MIRT505748 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT506298 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT508442 ZNF608 zinc finger protein 608 2 4
MIRT512782 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT520447 TSPAN2 tetraspanin 2 2 4
MIRT522133 NRBF2 nuclear receptor binding factor 2 2 6
MIRT522395 MYADM myeloid associated differentiation marker 2 4
MIRT523397 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523938 E2F8 E2F transcription factor 8 2 4
MIRT524349 CREB1 cAMP responsive element binding protein 1 2 2
MIRT524711 BRMS1L breast cancer metastasis-suppressor 1 like 2 4
MIRT525134 ZNF256 zinc finger protein 256 2 2
MIRT525710 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT531264 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT538844 BTG1 BTG anti-proliferation factor 1 2 2
MIRT541366 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT542093 KCNK10 potassium two pore domain channel subfamily K member 10 2 6
MIRT543770 RBM12B RNA binding motif protein 12B 2 4
MIRT543940 NCOA7 nuclear receptor coactivator 7 2 2
MIRT545150 GABRG1 gamma-aminobutyric acid type A receptor gamma1 subunit 2 2
MIRT545842 ZNF264 zinc finger protein 264 2 4
MIRT548057 GOLGA7 golgin A7 2 2
MIRT549242 ATXN1L ataxin 1 like 2 4
MIRT551829 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT552484 ZNF136 zinc finger protein 136 2 2
MIRT553663 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT554988 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555760 PCTP phosphatidylcholine transfer protein 2 2
MIRT556923 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT564991 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT566458 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT566538 PANK3 pantothenate kinase 3 2 2
MIRT567732 DLX2 distal-less homeobox 2 2 2
MIRT570081 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 2
MIRT571735 RNF11 ring finger protein 11 2 2
MIRT573529 MDM2 MDM2 proto-oncogene 2 2
MIRT574459 RPS16 ribosomal protein S16 2 2
MIRT574992 Phka1 phosphorylase kinase alpha 1 2 3
MIRT576349 Pxdn peroxidasin 2 2
MIRT610196 CD99 CD99 molecule (Xg blood group) 2 4
MIRT612920 GPRIN3 GPRIN family member 3 2 2
MIRT615021 DUSP6 dual specificity phosphatase 6 2 2
MIRT623573 IRS1 insulin receptor substrate 1 2 2
MIRT624437 CASD1 CAS1 domain containing 1 2 2
MIRT628714 ZNF585A zinc finger protein 585A 2 2
MIRT639565 PCK1 phosphoenolpyruvate carboxykinase 1 2 4
MIRT641485 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT641657 PAPOLG poly(A) polymerase gamma 2 2
MIRT642210 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT653010 STX7 syntaxin 7 2 2
MIRT656130 MSH6 mutS homolog 6 2 2
MIRT656893 KIAA2018 upstream transcription factor family member 3 2 2
MIRT660130 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT660855 AFAP1 actin filament associated protein 1 2 2
MIRT676843 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 3
MIRT681473 DIP2A disco interacting protein 2 homolog A 2 2
MIRT682253 RS1 retinoschisin 1 2 2
MIRT694296 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT694401 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
MIRT705277 BACH1 BTB domain and CNC homolog 1 2 2
MIRT720833 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT735713 SIRT1 sirtuin 1 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-1185-1-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1185-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1185-1-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission