miRTarBase - #MIRT081183


—
pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MIDN   
Synonyms -
Description midnolin
Transcript NM_177401   
Expression
Putative miRNA Targets on MIDN
3'UTR of MIDN
(miRNA target sites are highlighted)		 
>MIDN|NM_177401|3'UTR
   1 GATCTTCGGATCGGCCACCCTCGCCCCTCGCACCCCAGCCCAGGGCGGCGGGGACTCCGAGAGCCCCGGAGAGAACGTGG
  81 CCCAGCCCTGGAGGGCAGGCGGCCACTCCCCCAGCCAGAAGTCTTTTTTTCTTTTCTTCTTTTTTATTATTTTTTTCTTT
 161 TTTTAAAAAGTTCTGACCGTGGTTTCCTGGACTCTTCATGGGCTTTGCTTCCTACCTCCTTCACCCTTCACTCCTGCCCT
 241 CCTCTTCCTCCTCCTCCTCCTCCTCCGTCTGTCTCCTTTCACCTCTGCGCCAGGTCGGTCCTCCCTGCCAACCTTCCCCA
 321 GCTCCAATATGTAGCAGTCTCTCTGGATGGCGGAGAGTGAAGGAGACGGAGAAACGCGCCCCATCCCTTCCGCCGCCTCC
 401 TTTCCCCCCCGACCCTATTCAGGTTTTAAGTCAAAAATGTCGATATGTCATTATGCACTTTACAGATGAGGGGAGGGGCC
 481 GCAGTGCGCAGAACCCACCCCACCCCCCAGTGCAGACTTCGGGGTCTCCACCCCAGGCCAGCAGCGCCCACTGGGCTACA
 561 GCAAGCCAACAGGTCACAGAAGCCAACGAGGGGACTGTTTCTCTTCCACTCCTATCCTCTTTTCTTGATCTTTTTTTTGC
 641 ATTTTCCTTCATTTCTTTAACAAGGAGAGCAAAGCTGTTTTAGCAGAGGCTGGGGCTGAGGTCCCCATGGGGTTTGGGTG
 721 CAGGGGCATGGCACCCTTTCCTGTCGGGAAGGGAGAGGGGAACTACCCCCCCAGCCTGCCCTCCGCCCCGCCCCAGCCGG
 801 CGGACTGTGCTGTTTCCTCCGCCCCCACTCCCGTGTTTTCTGACCTCCTGCCTGAGTTTGGGGTATTTATAGACTATTAA
 881 TTTTCTGACTGAGCCAATAGTGGTTGGGGAACTCTTGAAAAAGGGGAGAGAATGGCTGGGTGCTGGGGAGTTCCCCCCTC
 961 CGAGCCCTCCTTCCCGGCCCAACCTGAGGGATGTGGATTTGGGACTGTCTGGGGGCCCCTCCTGCAGCGAGGATGGGAGG
1041 GGGTGCTGAGCTGTGAATCCCCTGGGCAGGGGGCGACAACTCCGTGTAGCATTAACCCCCGTGGCGGGGTCCGCTGCTGG
1121 TCTAATTTGGACCCCCTGCCTCTCAGTGCCCCTGCCCTAGGGGTGTCTGTCTCCAGAGGGGAGGGACAAATCCCCTACTG
1201 GGGCCATTTCAATGGGGTAGTTTTTGGATTTTTTTCCCCACTCACTTTTTATTTTTTAATGATAATGGAGATGTCTGGAC
1281 CCTTCCTCACCCCACCTGTCGGTCTTGTCCTGGCTCTGCCTGTCCCCCACCGTTGTTCTCGTAGGTGAACCCCAGGTCCT
1361 CAACTCCCCCCCTTTATGTGTTGAAAGTTAATGGTTTCAGATGTGAACATCACGTGTTATAACTGTAGCGCTGTAAATTT
1441 TTTTGTGGGAGGGTGGGCAGGGAGGGGTCCCAGAGGGTAGAGCTCAAGGATTTTGGGTTTTGTTTTGTTTTCATTTTTCC
1521 AAAAAAAAAAGAAAAAAAAATAGAAAAAAAAGGAGTAAAAGGGGCGGGTTTGTTTTTTGAAGAACTGTCTTGGATACCTA
1601 TTTAAATGTGTGTTCTGTTTTGTTTTTTAACGATTTTTAAATAACGTCTGTGCCTCCACTGGTTGAGGGTGGAACCTCCA
1681 GGCAGGAACCGGCTCGCCACCCTCTGCCCGGTAAGGGCTGCCCAAGAAAGCATTACCCGCCCTCGGGGGGTCGGGCTGTG
1761 GGGGTCCCGGCACCTGGCGTGAGTTTCATGTATGAAAACATAAAATTGAAAAAAAAAAAAAAACCTACACGAGCACCGTG
1841 ATTTCAAGTAATAAACAGAAAATGAAACACAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gggguggAAAAGAAGGGGg 5'
                 ||||:|||||| 
Target 5' ttttggaTTTTTTTCCCCa 3'
 1222 - 1240 144.00 -14.50
2 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            ||| |    ||||||| 
Target 5' tgCCAAC----CTTCCCCa 3'
 306 - 320 143.00 -15.10
3 
miRNA  3' gggguGGAAAAGAAGGGGg 5'
               |||  ||||||:| 
Target 5' cctgcCCTCCTCTTCCTCc 3'
 233 - 251 138.00 -21.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19727720 9 COSMIC
COSN26984408 15 COSMIC
COSN31506735 23 COSMIC
COSN26984407 24 COSMIC
COSN30131600 47 COSMIC
COSN30154776 48 COSMIC
COSN31498723 50 COSMIC
COSN509406 51 COSMIC
COSN26984406 59 COSMIC
COSN31500482 91 COSMIC
COSN26440743 100 COSMIC
COSN509404 130 COSMIC
COSN30530182 137 COSMIC
COSN25107220 141 COSMIC
COSN1760521 215 COSMIC
COSN14661410 224 COSMIC
COSN20115258 267 COSMIC
COSN20115260 267 COSMIC
COSN28158976 267 COSMIC
COSN1210917 268 COSMIC
COSN31536392 284 COSMIC
COSN30110488 291 COSMIC
COSN31482309 308 COSMIC
COSN23682603 352 COSMIC
COSN1210923 459 COSMIC
COSN20115264 639 COSMIC
COSN31584204 642 COSMIC
COSN17977501 766 COSMIC
COSN31592764 962 COSMIC
COSN31563554 992 COSMIC
COSN28734761 1155 COSMIC
COSN8604970 1155 COSMIC
COSN15660487 1193 COSMIC
COSN31563474 1218 COSMIC
COSN31570050 1220 COSMIC
COSN31517812 1305 COSMIC
COSN26562236 1452 COSMIC
COSN5183593 1473 COSMIC
COSN21549639 1508 COSMIC
COSN22852709 1508 COSMIC
COSN29685857 1531 COSMIC
COSN15663102 1532 COSMIC
COSN20115267 1824 COSMIC
COSN27205375 1824 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs7359977 1 dbSNP
rs1271696761 2 dbSNP
rs757629749 3 dbSNP
rs779454394 5 dbSNP
rs200018037 8 dbSNP
rs201601323 9 dbSNP
rs1445312702 13 dbSNP
rs747594530 14 dbSNP
rs1364230532 15 dbSNP
rs769356196 17 dbSNP
rs762907550 18 dbSNP
rs774775900 18 dbSNP
rs1289849798 19 dbSNP
rs1384638568 21 dbSNP
rs371426361 23 dbSNP
rs762623417 24 dbSNP
rs372957121 25 dbSNP
rs770662121 26 dbSNP
rs774108455 27 dbSNP
rs1357146798 28 dbSNP
rs201056488 30 dbSNP
rs762233338 30 dbSNP
rs1048378804 31 dbSNP
rs543672421 32 dbSNP
rs1261111095 34 dbSNP
rs1485385656 38 dbSNP
rs926268598 39 dbSNP
rs752739121 40 dbSNP
rs760614454 45 dbSNP
rs764240371 46 dbSNP
rs372884117 47 dbSNP
rs375818896 48 dbSNP
rs768047262 48 dbSNP
rs757578396 49 dbSNP
rs779330542 50 dbSNP
rs750789749 51 dbSNP
rs758868314 53 dbSNP
rs1237544779 57 dbSNP
rs1000249863 59 dbSNP
rs1174784251 60 dbSNP
rs1225015386 65 dbSNP
rs546903569 66 dbSNP
rs780963972 68 dbSNP
rs1395468118 69 dbSNP
rs1441274021 70 dbSNP
rs891554375 76 dbSNP
rs1332256491 77 dbSNP
rs373601491 78 dbSNP
rs1024148888 85 dbSNP
rs1447768750 87 dbSNP
rs1393499690 89 dbSNP
rs1193251617 90 dbSNP
rs1469144273 92 dbSNP
rs1006262376 101 dbSNP
rs533336127 102 dbSNP
rs747854078 107 dbSNP
rs377117054 110 dbSNP
rs1001487922 111 dbSNP
rs1236799465 112 dbSNP
rs1217303196 118 dbSNP
rs1034266090 122 dbSNP
rs1234597758 124 dbSNP
rs1302163748 124 dbSNP
rs201356901 124 dbSNP
rs1381489946 127 dbSNP
rs959429048 127 dbSNP
rs1385566141 132 dbSNP
rs1030399881 134 dbSNP
rs1421524696 134 dbSNP
rs1373727477 136 dbSNP
rs1173200836 137 dbSNP
rs1379635080 140 dbSNP
rs955218583 140 dbSNP
rs987962228 141 dbSNP
rs973825264 143 dbSNP
rs1199456020 144 dbSNP
rs920582389 147 dbSNP
rs1484376261 148 dbSNP
rs141429373 150 dbSNP
rs538696961 150 dbSNP
rs1458849565 151 dbSNP
rs772368897 158 dbSNP
rs983520507 158 dbSNP
rs1297566058 159 dbSNP
rs912094597 163 dbSNP
rs7359860 165 dbSNP
rs1353605655 166 dbSNP
rs1312324150 170 dbSNP
rs1404610165 174 dbSNP
rs555189815 179 dbSNP
rs922176866 180 dbSNP
rs1374014302 181 dbSNP
rs936240688 183 dbSNP
rs1054549648 186 dbSNP
rs891424372 193 dbSNP
rs377555924 199 dbSNP
rs1474494921 200 dbSNP
rs1257492073 203 dbSNP
rs370809735 204 dbSNP
rs1201664002 210 dbSNP
rs1378776847 216 dbSNP
rs1247902097 217 dbSNP
rs1194890060 218 dbSNP
rs907074940 219 dbSNP
rs1339776108 224 dbSNP
rs1259791516 225 dbSNP
rs1001351046 232 dbSNP
rs1034155062 233 dbSNP
rs1448760773 234 dbSNP
rs1342355549 235 dbSNP
rs991893997 237 dbSNP
rs1174418895 238 dbSNP
rs1391070938 238 dbSNP
rs962968376 238 dbSNP
rs917653048 240 dbSNP
rs929511038 240 dbSNP
rs1166294488 243 dbSNP
rs1473461986 243 dbSNP
rs995395598 243 dbSNP
rs1466367408 244 dbSNP
rs1361587309 245 dbSNP
rs1048360594 246 dbSNP
rs1238483764 246 dbSNP
rs1349890014 246 dbSNP
rs373707840 246 dbSNP
rs78673746 246 dbSNP
rs1333699224 253 dbSNP
rs1439079157 257 dbSNP
rs1394224908 258 dbSNP
rs758047356 260 dbSNP
rs1407608723 261 dbSNP
rs1375897143 262 dbSNP
rs1389523048 263 dbSNP
rs942286829 264 dbSNP
rs1491338001 265 dbSNP
rs1491575293 266 dbSNP
rs113517572 267 dbSNP
rs1283546895 267 dbSNP
rs1445187245 267 dbSNP
rs1859247 267 dbSNP
rs866187056 268 dbSNP
rs200924200 269 dbSNP
rs1331652017 271 dbSNP
rs900524174 274 dbSNP
rs1232410053 284 dbSNP
rs966208299 289 dbSNP
rs974897578 290 dbSNP
rs922102368 294 dbSNP
rs1198884629 295 dbSNP
rs184125310 297 dbSNP
rs936254744 298 dbSNP
rs1030452262 306 dbSNP
rs1479446562 312 dbSNP
rs891881087 320 dbSNP
rs1171329710 321 dbSNP
rs1212073058 322 dbSNP
rs1395331297 323 dbSNP
rs1192652577 324 dbSNP
rs1010284230 327 dbSNP
rs376456234 328 dbSNP
rs912923727 329 dbSNP
rs1433139222 331 dbSNP
rs1193882347 332 dbSNP
rs1197845876 337 dbSNP
rs967878343 338 dbSNP
rs1208854671 340 dbSNP
rs945730745 343 dbSNP
rs1478156108 346 dbSNP
rs1170047788 349 dbSNP
rs567512223 352 dbSNP
rs906963810 353 dbSNP
rs1033582468 359 dbSNP
rs937050829 362 dbSNP
rs1295122162 366 dbSNP
rs959060454 367 dbSNP
rs991778741 368 dbSNP
rs1055637223 369 dbSNP
rs1281225166 372 dbSNP
rs535019876 376 dbSNP
rs1407987358 379 dbSNP
rs1218770557 380 dbSNP
rs995860784 383 dbSNP
rs1168391581 386 dbSNP
rs1025556711 388 dbSNP
rs886459852 389 dbSNP
rs1277012081 390 dbSNP
rs1478737616 390 dbSNP
rs1255343090 391 dbSNP
rs1004824693 392 dbSNP
rs539852068 393 dbSNP
rs909386490 394 dbSNP
rs1018875369 395 dbSNP
rs1488321978 396 dbSNP
rs1272695748 398 dbSNP
rs966120486 401 dbSNP
rs1291985359 404 dbSNP
rs368568511 404 dbSNP
rs571581280 405 dbSNP
rs538645708 406 dbSNP
rs1379335515 407 dbSNP
rs562082138 408 dbSNP
rs1029585141 409 dbSNP
rs1051848034 410 dbSNP
rs1010641795 411 dbSNP
rs529543097 411 dbSNP
rs756940491 412 dbSNP
rs1417441252 414 dbSNP
rs755962995 416 dbSNP
rs1479753396 418 dbSNP
rs1425807811 423 dbSNP
rs903746297 424 dbSNP
rs1459423576 427 dbSNP
rs1368833013 430 dbSNP
rs1000803021 433 dbSNP
rs537126071 442 dbSNP
rs1309532217 443 dbSNP
rs945723867 444 dbSNP
rs1325106145 445 dbSNP
rs749039895 449 dbSNP
rs1166933625 450 dbSNP
rs201839606 450 dbSNP
rs950498255 450 dbSNP
rs983502260 453 dbSNP
rs542357882 454 dbSNP
rs11550178 460 dbSNP
rs1441904442 462 dbSNP
rs1251564711 465 dbSNP
rs908894781 471 dbSNP
rs1400500825 472 dbSNP
rs1287832173 474 dbSNP
rs1359204758 475 dbSNP
rs963933640 477 dbSNP
rs1212946907 480 dbSNP
rs749732458 481 dbSNP
rs554841890 482 dbSNP
rs1241925653 487 dbSNP
rs1320732254 488 dbSNP
rs188381085 489 dbSNP
rs1471938255 492 dbSNP
rs770843132 496 dbSNP
rs1369558938 498 dbSNP
rs1287113309 501 dbSNP
rs1451704653 502 dbSNP
rs1159440347 503 dbSNP
rs1355112083 503 dbSNP
rs937080414 504 dbSNP
rs1198526888 505 dbSNP
rs1055540960 506 dbSNP
rs1270085594 507 dbSNP
rs1487660621 509 dbSNP
rs1484235917 510 dbSNP
rs898361027 513 dbSNP
rs1255804579 514 dbSNP
rs1443003906 517 dbSNP
rs1043422033 520 dbSNP
rs540560175 521 dbSNP
rs565197750 522 dbSNP
rs1001151730 532 dbSNP
rs747069012 534 dbSNP
rs1054963425 535 dbSNP
rs1401934805 538 dbSNP
rs1373787893 540 dbSNP
rs1172278760 541 dbSNP
rs1466857100 542 dbSNP
rs559788591 546 dbSNP
rs1420254193 547 dbSNP
rs1477754669 560 dbSNP
rs914713738 563 dbSNP
rs386805725 566 dbSNP
rs1195131304 567 dbSNP
rs1342939928 572 dbSNP
rs1484442860 574 dbSNP
rs1255031258 578 dbSNP
rs1024786309 588 dbSNP
rs375515934 589 dbSNP
rs1302915712 593 dbSNP
rs887042026 594 dbSNP
rs1449988564 601 dbSNP
rs181565951 602 dbSNP
rs1353703090 604 dbSNP
rs1016307610 607 dbSNP
rs1008078544 609 dbSNP
rs1018906571 610 dbSNP
rs1223715831 612 dbSNP
rs1465438215 614 dbSNP
rs1282695993 617 dbSNP
rs1173524837 618 dbSNP
rs1473927293 618 dbSNP
rs1314442291 620 dbSNP
rs768795280 621 dbSNP
rs779041980 622 dbSNP
rs901818985 629 dbSNP
rs1458097489 631 dbSNP
rs202074571 631 dbSNP
rs3214177 631 dbSNP
rs368669353 631 dbSNP
rs397741757 631 dbSNP
rs1259894674 633 dbSNP
rs1210991806 639 dbSNP
rs201632557 641 dbSNP
rs1211788449 642 dbSNP
rs1255455994 642 dbSNP
rs1460188633 646 dbSNP
rs563487538 647 dbSNP
rs1239784281 648 dbSNP
rs1283626096 648 dbSNP
rs1245632527 652 dbSNP
rs1440014474 655 dbSNP
rs1342420896 656 dbSNP
rs772308362 662 dbSNP
rs1446492167 665 dbSNP
rs954966169 669 dbSNP
rs987615467 669 dbSNP
rs1405787329 670 dbSNP
rs957795203 671 dbSNP
rs1390672078 672 dbSNP
rs1163272453 680 dbSNP
rs913415408 684 dbSNP
rs946089405 691 dbSNP
rs978870948 694 dbSNP
rs926069573 696 dbSNP
rs1416071787 698 dbSNP
rs1211618072 706 dbSNP
rs1450906991 707 dbSNP
rs1176221382 708 dbSNP
rs1290517154 709 dbSNP
rs1210506253 717 dbSNP
rs1358636728 723 dbSNP
rs1284120485 727 dbSNP
rs1239748712 728 dbSNP
rs1311853630 732 dbSNP
rs778602720 737 dbSNP
rs1020843631 739 dbSNP
rs540579006 740 dbSNP
rs1406585501 743 dbSNP
rs895046569 746 dbSNP
rs949319847 747 dbSNP
rs185763616 759 dbSNP
rs1381795848 760 dbSNP
rs981656178 765 dbSNP
rs886278975 766 dbSNP
rs947536980 766 dbSNP
rs1477614072 767 dbSNP
rs1247203856 768 dbSNP
rs928319466 768 dbSNP
rs549050647 769 dbSNP
rs1261070227 770 dbSNP
rs567549081 772 dbSNP
rs898940120 773 dbSNP
rs1442005600 776 dbSNP
rs1275935298 780 dbSNP
rs1278139790 783 dbSNP
rs995825138 783 dbSNP
rs776809738 785 dbSNP
rs190708330 786 dbSNP
rs1220293104 787 dbSNP
rs546757696 790 dbSNP
rs571919525 791 dbSNP
rs1200773275 792 dbSNP
rs987730252 794 dbSNP
rs943968315 795 dbSNP
rs550793852 798 dbSNP
rs967567859 799 dbSNP
rs760013596 800 dbSNP
rs1437461255 801 dbSNP
rs866447477 802 dbSNP
rs762076233 803 dbSNP
rs1442172223 806 dbSNP
rs926044518 809 dbSNP
rs893234433 816 dbSNP
rs1316528088 817 dbSNP
rs141382834 820 dbSNP
rs765577801 821 dbSNP
rs917260055 822 dbSNP
rs949267939 827 dbSNP
rs1359403316 828 dbSNP
rs1020458052 829 dbSNP
rs556967037 831 dbSNP
rs967531344 833 dbSNP
rs1171364743 834 dbSNP
rs770782004 834 dbSNP
rs886392439 837 dbSNP
rs1357738081 844 dbSNP
rs1479135343 845 dbSNP
rs1003165373 846 dbSNP
rs940524824 847 dbSNP
rs1035924068 849 dbSNP
rs552896405 851 dbSNP
rs958385732 853 dbSNP
rs991182196 857 dbSNP
rs1212684271 863 dbSNP
rs1172171238 864 dbSNP
rs773511856 873 dbSNP
rs919560375 875 dbSNP
rs1309901987 877 dbSNP
rs952499022 880 dbSNP
rs898892725 886 dbSNP
rs995941071 887 dbSNP
rs763252872 890 dbSNP
rs890129216 895 dbSNP
rs1008606509 896 dbSNP
rs982906420 898 dbSNP
rs764262821 899 dbSNP
rs1162692831 902 dbSNP
rs1020526628 903 dbSNP
rs1185713935 912 dbSNP
rs568748895 915 dbSNP
rs1237914005 918 dbSNP
rs943873500 923 dbSNP
rs1000349535 925 dbSNP
rs1264206782 926 dbSNP
rs536384737 928 dbSNP
rs1033612095 929 dbSNP
rs1321856518 933 dbSNP
rs1291546183 938 dbSNP
rs1237556032 941 dbSNP
rs55923173 944 dbSNP
rs1303015686 946 dbSNP
rs1375729853 951 dbSNP
rs761965323 951 dbSNP
rs991538532 952 dbSNP
rs1350581707 953 dbSNP
rs574382481 953 dbSNP
rs1040964046 955 dbSNP
rs1379932097 957 dbSNP
rs146271397 958 dbSNP
rs752049877 959 dbSNP
rs1212979549 961 dbSNP
rs1488502041 962 dbSNP
rs572944103 963 dbSNP
rs1213852532 966 dbSNP
rs1050469065 967 dbSNP
rs540442687 968 dbSNP
rs558742825 969 dbSNP
rs367825254 976 dbSNP
rs544175689 977 dbSNP
rs1387238737 980 dbSNP
rs1369669008 992 dbSNP
rs1041820557 995 dbSNP
rs903373165 996 dbSNP
rs759532151 997 dbSNP
rs931681418 1000 dbSNP
rs1050170069 1002 dbSNP
rs1299093469 1010 dbSNP
rs1003026475 1016 dbSNP
rs58612681 1017 dbSNP
rs866770445 1018 dbSNP
rs1434208398 1019 dbSNP
rs1432098506 1020 dbSNP
rs1190876500 1023 dbSNP
rs958959627 1028 dbSNP
rs903410933 1029 dbSNP
rs1013548630 1030 dbSNP
rs1026661071 1038 dbSNP
rs1033144779 1039 dbSNP
rs958865070 1040 dbSNP
rs952477504 1041 dbSNP
rs755762330 1043 dbSNP
rs1024333135 1051 dbSNP
rs777580279 1058 dbSNP
rs764315137 1061 dbSNP
rs1302569596 1063 dbSNP
rs56136663 1063 dbSNP
rs1466877654 1064 dbSNP
rs976568960 1070 dbSNP
rs1408927835 1071 dbSNP
rs1169229661 1074 dbSNP
rs575528885 1075 dbSNP
rs542584464 1076 dbSNP
rs757031860 1082 dbSNP
rs530593560 1084 dbSNP
rs947356237 1085 dbSNP
rs1050279319 1087 dbSNP
rs911624652 1096 dbSNP
rs1256054446 1099 dbSNP
rs1041851762 1101 dbSNP
rs561064033 1102 dbSNP
rs528526382 1106 dbSNP
rs903279638 1107 dbSNP
rs778878268 1108 dbSNP
rs936225872 1109 dbSNP
rs938723514 1110 dbSNP
rs1396953863 1111 dbSNP
rs1290714917 1112 dbSNP
rs546796324 1113 dbSNP
rs182270980 1114 dbSNP
rs1401681592 1120 dbSNP
rs1169076637 1123 dbSNP
rs1261855770 1129 dbSNP
rs1367516953 1131 dbSNP
rs745837505 1131 dbSNP
rs1013203485 1133 dbSNP
rs1446196509 1133 dbSNP
rs374038485 1134 dbSNP
rs764889676 1136 dbSNP
rs1236092407 1138 dbSNP
rs1177793401 1139 dbSNP
rs1458110866 1140 dbSNP
rs1027649812 1146 dbSNP
rs888145458 1149 dbSNP
rs1024447894 1150 dbSNP
rs868531697 1151 dbSNP
rs1238912610 1157 dbSNP
rs1385297478 1158 dbSNP
rs1307455658 1164 dbSNP
rs1446515539 1165 dbSNP
rs1212760312 1170 dbSNP
rs907268571 1174 dbSNP
rs1004714326 1177 dbSNP
rs1163401417 1179 dbSNP
rs1389437751 1181 dbSNP
rs1426109386 1182 dbSNP
rs1383722181 1184 dbSNP
rs1378107984 1190 dbSNP
rs1422097466 1193 dbSNP
rs1440152107 1195 dbSNP
rs1234512865 1196 dbSNP
rs1196722593 1197 dbSNP
rs1004274071 1198 dbSNP
rs532884414 1203 dbSNP
rs1223338266 1204 dbSNP
rs1361777604 1210 dbSNP
rs1284230114 1218 dbSNP
rs1399083461 1218 dbSNP
rs963031564 1221 dbSNP
rs974135300 1221 dbSNP
rs1015185733 1223 dbSNP
rs1281747759 1227 dbSNP
rs1027560113 1229 dbSNP
rs528970793 1230 dbSNP
rs953297712 1238 dbSNP
rs1358222811 1239 dbSNP
rs1297259195 1240 dbSNP
rs1420053732 1241 dbSNP
rs1336238203 1244 dbSNP
rs1170621743 1246 dbSNP
rs985938155 1246 dbSNP
rs1378139771 1248 dbSNP
rs1200231365 1251 dbSNP
rs1341335868 1251 dbSNP
rs911739263 1253 dbSNP
rs976433143 1256 dbSNP
rs1452158172 1259 dbSNP
rs1028146547 1265 dbSNP
rs1314134671 1266 dbSNP
rs954010027 1267 dbSNP
rs1242230839 1273 dbSNP
rs1261179068 1274 dbSNP
rs1280859022 1282 dbSNP
rs1284555320 1283 dbSNP
rs935655246 1284 dbSNP
rs568860870 1287 dbSNP
rs1337829609 1288 dbSNP
rs768705374 1293 dbSNP
rs1346614215 1294 dbSNP
rs1331882616 1298 dbSNP
rs915128049 1301 dbSNP
rs1482514567 1302 dbSNP
rs536272662 1311 dbSNP
rs548172923 1314 dbSNP
rs1481439943 1315 dbSNP
rs1461509326 1317 dbSNP
rs1193064118 1324 dbSNP
rs945281704 1325 dbSNP
rs948987981 1326 dbSNP
rs1442264588 1327 dbSNP
rs1182557633 1329 dbSNP
rs1206081212 1329 dbSNP
rs1241693036 1330 dbSNP
rs1256806931 1332 dbSNP
rs1316621073 1332 dbSNP
rs543915315 1333 dbSNP
rs924565520 1338 dbSNP
rs938757829 1339 dbSNP
rs566580705 1341 dbSNP
rs539991105 1342 dbSNP
rs1363788872 1352 dbSNP
rs894684023 1353 dbSNP
rs1174435683 1356 dbSNP
rs1402938420 1357 dbSNP
rs1469509540 1359 dbSNP
rs1169748318 1360 dbSNP
rs776756677 1365 dbSNP
rs1016087252 1366 dbSNP
rs1180387277 1366 dbSNP
rs1472611163 1367 dbSNP
rs1048669629 1368 dbSNP
rs1185828179 1369 dbSNP
rs748227796 1372 dbSNP
rs1335151507 1373 dbSNP
rs530441600 1375 dbSNP
rs1227343084 1381 dbSNP
rs1028345777 1389 dbSNP
rs1316815874 1394 dbSNP
rs1276139733 1403 dbSNP
rs558763464 1409 dbSNP
rs1376057713 1412 dbSNP
rs576954226 1414 dbSNP
rs538169580 1415 dbSNP
rs1260934230 1420 dbSNP
rs556207027 1421 dbSNP
rs1386100793 1424 dbSNP
rs1424193540 1424 dbSNP
rs1165858002 1429 dbSNP
rs574357614 1430 dbSNP
rs542623087 1431 dbSNP
rs773339466 1435 dbSNP
rs1178328211 1438 dbSNP
rs1417873795 1438 dbSNP
rs1244420562 1439 dbSNP
rs1018748700 1446 dbSNP
rs1430076059 1447 dbSNP
rs560902373 1449 dbSNP
rs1174349883 1451 dbSNP
rs1307577868 1454 dbSNP
rs1426097431 1455 dbSNP
rs1291791383 1456 dbSNP
rs1462669158 1460 dbSNP
rs1298557038 1463 dbSNP
rs1305244473 1467 dbSNP
rs1395457140 1469 dbSNP
rs924339394 1472 dbSNP
rs935784385 1476 dbSNP
rs989747661 1483 dbSNP
rs915586875 1485 dbSNP
rs948935555 1487 dbSNP
rs1045960292 1496 dbSNP
rs1346059231 1497 dbSNP
rs573050129 1497 dbSNP
rs1191069029 1505 dbSNP
rs1222445568 1508 dbSNP
rs1280767867 1510 dbSNP
rs1487774495 1513 dbSNP
rs1319614090 1517 dbSNP
rs1227633979 1519 dbSNP
rs1222961367 1521 dbSNP
rs1285312311 1521 dbSNP
rs1310364531 1521 dbSNP
rs1346280581 1521 dbSNP
rs1398334330 1521 dbSNP
rs1423697276 1521 dbSNP
rs1384538268 1522 dbSNP
rs1251134744 1524 dbSNP
rs1456020672 1529 dbSNP
rs928936932 1529 dbSNP
rs1455733949 1530 dbSNP
rs1176397562 1531 dbSNP
rs867722965 1531 dbSNP
rs1037224598 1532 dbSNP
rs1174643689 1532 dbSNP
rs1262075544 1532 dbSNP
rs1427489224 1532 dbSNP
rs868721468 1532 dbSNP
rs540322704 1535 dbSNP
rs1482183617 1537 dbSNP
rs1262404066 1541 dbSNP
rs111237884 1542 dbSNP
rs1212166213 1544 dbSNP
rs1265018317 1544 dbSNP
rs1216878177 1545 dbSNP
rs1270309575 1546 dbSNP
rs200805351 1547 dbSNP
rs1336518279 1548 dbSNP
rs1490320790 1549 dbSNP
rs565511121 1552 dbSNP
rs1428033346 1554 dbSNP
rs995616910 1561 dbSNP
rs1197424672 1562 dbSNP
rs1167913744 1565 dbSNP
rs62128846 1566 dbSNP
rs1429374159 1567 dbSNP
rs1172142899 1569 dbSNP
rs1035769055 1570 dbSNP
rs1421723905 1571 dbSNP
rs1242256369 1573 dbSNP
rs1183988286 1579 dbSNP
rs896796395 1580 dbSNP
rs1372299668 1585 dbSNP
rs1462543804 1586 dbSNP
rs367909064 1589 dbSNP
rs997929606 1590 dbSNP
rs994506647 1593 dbSNP
rs1028472896 1596 dbSNP
rs1355138409 1598 dbSNP
rs143980274 1599 dbSNP
rs1194133136 1621 dbSNP
rs372413545 1622 dbSNP
rs1338877713 1623 dbSNP
rs1011167438 1632 dbSNP
rs774909449 1642 dbSNP
rs1229831969 1643 dbSNP
rs1022102285 1646 dbSNP
rs111244362 1647 dbSNP
rs966014354 1649 dbSNP
rs977967972 1652 dbSNP
rs1329974648 1653 dbSNP
rs1390284587 1654 dbSNP
rs1396545965 1657 dbSNP
rs1169168426 1661 dbSNP
rs867177409 1663 dbSNP
rs117875320 1670 dbSNP
rs957316403 1673 dbSNP
rs1446278170 1674 dbSNP
rs989862254 1675 dbSNP
rs1382442924 1679 dbSNP
rs1251271456 1684 dbSNP
rs992938728 1690 dbSNP
rs1294339270 1691 dbSNP
rs915970680 1692 dbSNP
rs915701634 1693 dbSNP
rs768145247 1694 dbSNP
rs981103332 1695 dbSNP
rs928862020 1696 dbSNP
rs952547908 1697 dbSNP
rs530376314 1698 dbSNP
rs1006726974 1700 dbSNP
rs548209644 1701 dbSNP
rs1017737287 1704 dbSNP
rs780226319 1704 dbSNP
rs920113118 1707 dbSNP
rs1486200613 1710 dbSNP
rs187281160 1711 dbSNP
rs1259990911 1715 dbSNP
rs549148884 1716 dbSNP
rs889906593 1717 dbSNP
rs1470437439 1719 dbSNP
rs1008215413 1721 dbSNP
rs1041072567 1739 dbSNP
rs368267124 1740 dbSNP
rs998793087 1741 dbSNP
rs1161528297 1743 dbSNP
rs1031883738 1745 dbSNP
rs1282526348 1745 dbSNP
rs1490909606 1745 dbSNP
rs146414867 1746 dbSNP
rs1011398621 1748 dbSNP
rs1344362298 1750 dbSNP
rs1287777956 1751 dbSNP
rs1343084417 1752 dbSNP
rs1359493272 1753 dbSNP
rs563124489 1754 dbSNP
rs1316207570 1758 dbSNP
rs1382403972 1760 dbSNP
rs1170791371 1764 dbSNP
rs1469258242 1766 dbSNP
rs1428628506 1768 dbSNP
rs1200250919 1769 dbSNP
rs1244435961 1770 dbSNP
rs1022657092 1774 dbSNP
rs1212389715 1779 dbSNP
rs969803880 1780 dbSNP
rs1286916705 1788 dbSNP
rs1202283138 1789 dbSNP
rs1288851057 1795 dbSNP
rs1402131165 1800 dbSNP
rs976168447 1802 dbSNP
rs1259021982 1806 dbSNP
rs1269281543 1808 dbSNP
rs1484375062 1808 dbSNP
rs113914995 1809 dbSNP
rs1274697601 1809 dbSNP
rs1416296875 1809 dbSNP
rs1417604851 1809 dbSNP
rs1491392781 1809 dbSNP
rs369098138 1809 dbSNP
rs752905728 1809 dbSNP
rs112921143 1811 dbSNP
rs1243535859 1812 dbSNP
rs1244145521 1815 dbSNP
rs961894715 1817 dbSNP
rs1443724352 1821 dbSNP
rs1461205846 1821 dbSNP
rs1244365849 1822 dbSNP
rs1305297316 1824 dbSNP
rs397977680 1824 dbSNP
rs1181513415 1825 dbSNP
rs1037241971 1828 dbSNP
rs900870284 1831 dbSNP
rs997793827 1832 dbSNP
rs1341057097 1835 dbSNP
rs1157760997 1837 dbSNP
rs1342887828 1838 dbSNP
rs1049373772 1839 dbSNP
rs1383427642 1848 dbSNP
rs1336914046 1857 dbSNP
rs889549469 1863 dbSNP
rs931459239 1867 dbSNP
rs570501052 1871 dbSNP
rs1010614473 1872 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            ||| |    ||||||| 
Target 5' --CCAAC----CUUCCCCa 3'
 		1 - 13
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            ||| |    ||||||| 
Target 5' --CCAAC----CUUCCCCa 3'
 		1 - 13
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_177401 | 3UTR | UUCAUGGGCUUUGCUUCCUACCUCCUUCACCCUUCACUCCUGCCCUCCUCUUCCUCCUCCUCCUCCUCCUCCGUCUGUCUCCUUUCACCUCUGCGCCAGGUCGGUCCUCCCUGCCAACCUUCCCCAGCUCCAAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903826
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_NS
Location of target site NM_177401 | 3UTR | UUCACCCUUCACUCCUGCCCUCCUCUUCCUCCUCCUCCUCCUCCUCCGUCUGUCUCCUUUCACCUCUGCGCCAGGUCGGUCCUCCCUGCCAACCUUCCCCAGCUCCAAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903827
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_9124
Location of target site NM_177401 | 3UTR | AGGUCGGUCCUCCCUGCCAACCUUCCCCAGCUCCAAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903828
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_9124
Location of target site NM_177401 | 3UTR | UCUGCGCCAGGUCGGUCCUCCCUGCCAACCUUCCCCAGCUCCAAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_177401 | 3UTR | GUUUUUGGAUUUUUUUCCCCACUCACUUUUUAUUUUUUAAUGAUAAUGGAGAUGUCUGGACCCUUCCUCACCCCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_177401 | 3UTR | UGGAUUUUUUUCCCCACUCACUUUUUAUUUUUUAAUGAUAAUGGAGAUGUCUGGACCCUUCCUCACCCCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000591446.2 | 3UTR | CGUCUGUCUCCUUUCACCUCUGCGCCAGGUCGGUCCUCCCUGCCAACCUUCCCCAGCUCCAAUAUGUAGCAGUCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000591446.2 | 3UTR | CCAACCUUCCCCAGCUCCAAUAUGUAGCAGUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission