miRTarBase - #MIRT081653


—
pre-miRNA Information
pre-miRNA hsa-mir-4524b   
Genomic Coordinates chr17: 69099542 - 69099656
Description Homo sapiens miR-4524b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524b-5p
Sequence 29| AUAGCAGCAUAAGCCUGUCUC |49
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs759455017 2 dbSNP
rs533917606 5 dbSNP
rs1216135231 7 dbSNP
rs1285986118 8 dbSNP
rs987457648 15 dbSNP
rs1224511037 16 dbSNP
rs561046090 17 dbSNP
Putative Targets

Gene Information
Gene Symbol CCNE1   
Synonyms CCNE, pCCNE1
Description cyclin E1
Transcript NM_001238   
Expression
Putative miRNA Targets on CCNE1
3'UTR of CCNE1
(miRNA target sites are highlighted)		 
>CCNE1|NM_001238|3'UTR
   1 CCACCCCATCCTTCTCCACCAAAGACAGTTGCGCGCCTGCTCCACGTTCTCTTCTGTCTGTTGCAGCGGAGGCGTGCGTT
  81 TGCTTTTACAGATATCTGAATGGAAGAGTGTTTCTTCCACAACAGAAGTATTTCTGTGGATGGCATCAAACAGGGCAAAG
 161 TGTTTTTTATTGAATGCTTATAGGTTTTTTTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACACCAGTGCGTGC
 241 TCCCGATGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGTGGAGGGCCACG
 321 GTGGCGTGGCTCTCCTCGCAGGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGTTGCGGGCAAGCGTTGTGCAGA
 401 GCCCATAGCCAGCTGGGCAGGGGGCTGCCCTCTCCACATTATCAGTTGACAGTGTACAATGCCTTTGATGAACTGTTTTG
 481 TAAGTGCTGCTATATCTATCCATTTTTTAATAAAGATAATACTGTTTTTGAGACAGCTGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cucUGUCCGA---AUACGACGAUa 5'
             :|: |||    ||||||||| 
Target 5' agtGCGTGCTCCCGATGCTGCTAt 3'
 232 - 255 154.00 -16.80
2 
miRNA  3' cucUGUCCGAA----UACGACGAUa 5'
             || | :||    :|||||||| 
Target 5' tgaACTGTTTTGTAAGTGCTGCTAt 3'
 469 - 493 152.00 -12.30
3 
miRNA  3' cuCUGUCCGAAUACGACGAUa 5'
            |:|: || | |||| :|| 
Target 5' gaGGCGTGCGTTTGCTTTTAc 3'
 69 - 89 115.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30480490 8 COSMIC
COSN30457465 12 COSMIC
COSN24396057 34 COSMIC
COSN24400322 36 COSMIC
COSN30498150 37 COSMIC
COSN30143164 46 COSMIC
COSN30499882 47 COSMIC
COSN30102280 55 COSMIC
COSN13796013 68 COSMIC
COSN30514505 75 COSMIC
COSN30187906 76 COSMIC
COSN20046611 78 COSMIC
COSN31514875 79 COSMIC
COSN31587757 135 COSMIC
COSN8605557 144 COSMIC
COSN31526675 157 COSMIC
COSN31532566 193 COSMIC
COSN31562027 200 COSMIC
COSN31570069 383 COSMIC
COSN31528433 451 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778967626 4 dbSNP
rs748164154 7 dbSNP
rs1306982894 11 dbSNP
rs1348426165 14 dbSNP
rs1437595879 14 dbSNP
rs371960938 18 dbSNP
rs1307699658 20 dbSNP
rs772121723 22 dbSNP
rs1423303439 24 dbSNP
rs1182857220 32 dbSNP
rs1230899340 33 dbSNP
rs773487372 34 dbSNP
rs368525829 35 dbSNP
rs771378452 36 dbSNP
rs1251328261 40 dbSNP
rs776814675 41 dbSNP
rs760124807 46 dbSNP
rs1409433079 47 dbSNP
rs765772570 52 dbSNP
rs1317543699 63 dbSNP
rs1271996385 65 dbSNP
rs1283302737 68 dbSNP
rs878995611 69 dbSNP
rs977000598 71 dbSNP
rs1282300744 74 dbSNP
rs530453430 75 dbSNP
rs202195306 78 dbSNP
rs932866935 79 dbSNP
rs1043236848 84 dbSNP
rs1463717760 89 dbSNP
rs1353606557 93 dbSNP
rs570331880 96 dbSNP
rs1407497130 102 dbSNP
rs1412091075 105 dbSNP
rs1181716294 118 dbSNP
rs561079816 122 dbSNP
rs1240046158 135 dbSNP
rs1486087005 136 dbSNP
rs189158036 137 dbSNP
rs1051213653 140 dbSNP
rs546729018 141 dbSNP
rs566562252 145 dbSNP
rs889857228 148 dbSNP
rs934463761 167 dbSNP
rs1052846561 170 dbSNP
rs1425955828 177 dbSNP
rs777389026 182 dbSNP
rs1444028494 184 dbSNP
rs1372144185 185 dbSNP
rs1293692227 193 dbSNP
rs1013907834 195 dbSNP
rs1438170629 204 dbSNP
rs142360338 207 dbSNP
rs750689376 212 dbSNP
rs1044064016 216 dbSNP
rs1174190895 219 dbSNP
rs1420818820 229 dbSNP
rs1382743347 232 dbSNP
rs1156925520 235 dbSNP
rs552526974 237 dbSNP
rs1454660662 238 dbSNP
rs1300362939 241 dbSNP
rs994053033 243 dbSNP
rs770491148 245 dbSNP
rs368989147 246 dbSNP
rs1487641622 247 dbSNP
rs1303298354 250 dbSNP
rs1221526173 253 dbSNP
rs773867144 255 dbSNP
rs745388220 256 dbSNP
rs533007909 258 dbSNP
rs896175805 267 dbSNP
rs1013655139 268 dbSNP
rs965374463 274 dbSNP
rs1023417465 276 dbSNP
rs118142197 286 dbSNP
rs1242071817 294 dbSNP
rs1453718303 300 dbSNP
rs1002014698 308 dbSNP
rs1269783145 309 dbSNP
rs181971575 317 dbSNP
rs112118851 320 dbSNP
rs1223096659 321 dbSNP
rs73925742 326 dbSNP
rs1198409859 327 dbSNP
rs1477994329 330 dbSNP
rs1265062420 332 dbSNP
rs3218073 333 dbSNP
rs1485513603 335 dbSNP
rs1382075551 338 dbSNP
rs760544447 339 dbSNP
rs987200809 343 dbSNP
rs1440488320 347 dbSNP
rs1160880902 354 dbSNP
rs1052877786 356 dbSNP
rs186190859 357 dbSNP
rs911352459 360 dbSNP
rs1352087272 370 dbSNP
rs1403592793 370 dbSNP
rs1455941554 371 dbSNP
rs949755495 376 dbSNP
rs1044093704 383 dbSNP
rs577392030 384 dbSNP
rs748153237 385 dbSNP
rs145951198 392 dbSNP
rs1405461309 399 dbSNP
rs1171573418 405 dbSNP
rs796304226 407 dbSNP
rs1467407719 410 dbSNP
rs562877398 424 dbSNP
rs1406 429 dbSNP
rs543852265 430 dbSNP
rs865984037 431 dbSNP
rs1375849036 432 dbSNP
rs1459543689 437 dbSNP
rs190557131 445 dbSNP
rs778737557 447 dbSNP
rs776582571 451 dbSNP
rs1018711306 467 dbSNP
rs529759974 479 dbSNP
rs965441073 481 dbSNP
rs1457802599 487 dbSNP
rs1256528382 490 dbSNP
rs1341584116 493 dbSNP
rs3218074 493 dbSNP
rs1028363177 499 dbSNP
rs1315377686 502 dbSNP
rs1394808508 509 dbSNP
rs181434503 517 dbSNP
rs1332150725 520 dbSNP
rs979063781 521 dbSNP
rs186353947 523 dbSNP
rs777341273 525 dbSNP
rs1165935653 533 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cucuguccgaauACGACGAUa 5'
                      |||||||| 
Target 5' ------------UGCUGCUAu 3'
 		1 - 9
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 898.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cucuguccgaaUACGACGAUa 5'
                     :|||||||| 
Target 5' ----uuuguaaGUGCUGCUAu 3'
 		1 - 17
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000262643.3 | 3UTR | UGCUGCUAUAUCUAUCCAUUUUUUAAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000262643.3 | 3UTR | UUUGUAAGUGCUGCUAUAUCUAUCCAUUUUUUAAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4524b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055253 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT055828 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT060575 CCND1 cyclin D1 2 2
MIRT061015 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT064695 CCND2 cyclin D2 2 4
MIRT075269 SNTB2 syntrophin beta 2 2 4
MIRT079670 NAPG NSF attachment protein gamma 2 12
MIRT081653 CCNE1 cyclin E1 2 4
MIRT083002 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083465 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT085756 RIF1 replication timing regulatory factor 1 2 2
MIRT086024 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087433 ZNRF3 zinc and ring finger 3 2 2
MIRT088789 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT089223 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT093698 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095093 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT096251 CANX calnexin 2 2
MIRT100219 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100748 VEGFA vascular endothelial growth factor A 2 12
MIRT100905 CD2AP CD2 associated protein 2 2
MIRT102650 UBN2 ubinuclein 2 2 10
MIRT103886 FOXK1 forkhead box K1 2 2
MIRT104249 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106311 ZFHX4 zinc finger homeobox 4 2 6
MIRT107698 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT114946 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117674 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT133806 SKI SKI proto-oncogene 2 2
MIRT140171 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142281 DCTN5 dynactin subunit 5 2 8
MIRT143297 N4BP1 NEDD4 binding protein 1 2 2
MIRT165945 CREBRF CREB3 regulatory factor 2 2
MIRT175255 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT186383 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT191472 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT196481 TAOK1 TAO kinase 1 2 2
MIRT201472 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204619 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204650 MOB4 MOB family member 4, phocein 2 8
MIRT204751 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206032 NUP50 nucleoporin 50 2 6
MIRT211197 FGF2 fibroblast growth factor 2 2 4
MIRT229356 ZNF449 zinc finger protein 449 2 2
MIRT247139 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT249464 ZNF691 zinc finger protein 691 2 4
MIRT256318 CDC42SE2 CDC42 small effector 2 2 2
MIRT258420 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265085 CHEK1 checkpoint kinase 1 2 2
MIRT270562 SETD1B SET domain containing 1B 2 2
MIRT274751 RAB3IP RAB3A interacting protein 2 2
MIRT277517 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT289644 CBX2 chromobox 2 2 2
MIRT301002 MTMR3 myotubularin related protein 3 2 2
MIRT307150 CTDSPL CTD small phosphatase like 2 4
MIRT309026 USP53 ubiquitin specific peptidase 53 2 2
MIRT314102 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT319339 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320624 ZNRF2 zinc and ring finger 2 2 2
MIRT324286 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT446497 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT448436 TLL1 tolloid like 1 2 2
MIRT461536 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463161 ZNF367 zinc finger protein 367 2 10
MIRT463492 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT465153 TSC22D2 TSC22 domain family member 2 2 2
MIRT466417 TFAP2A transcription factor AP-2 alpha 2 8
MIRT468277 SFT2D2 SFT2 domain containing 2 2 2
MIRT469398 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471940 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT473687 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT479617 CDC25A cell division cycle 25A 2 2
MIRT482097 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483994 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485204 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT498762 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT498960 ORC4 origin recognition complex subunit 4 2 8
MIRT499439 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500079 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500303 ZNF622 zinc finger protein 622 2 8
MIRT500409 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500788 TLK1 tousled like kinase 1 2 6
MIRT500929 SRPR SRP receptor alpha subunit 2 6
MIRT500942 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501067 SMAD7 SMAD family member 7 2 8
MIRT501710 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT502626 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502909 CDCA4 cell division cycle associated 4 2 8
MIRT502934 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504530 ZNF620 zinc finger protein 620 2 6
MIRT505105 YTHDC1 YTH domain containing 1 2 6
MIRT505336 TMEM245 transmembrane protein 245 2 6
MIRT505382 TMEM100 transmembrane protein 100 2 2
MIRT505677 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506156 PLAG1 PLAG1 zinc finger 2 8
MIRT506182 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506474 MYO5A myosin VA 2 6
MIRT506825 KIF23 kinesin family member 23 2 6
MIRT507159 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT507510 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT507844 CCNE2 cyclin E2 2 6
MIRT510402 ZNF507 zinc finger protein 507 2 2
MIRT518077 TRIM35 tripartite motif containing 35 2 2
MIRT518981 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521044 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521189 SBNO1 strawberry notch homolog 1 2 6
MIRT522087 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT524845 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT527786 TMEM44 transmembrane protein 44 2 4
MIRT537802 EFNB2 ephrin B2 2 4
MIRT540829 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541139 PISD phosphatidylserine decarboxylase 2 2
MIRT541418 CBX4 chromobox 4 2 2
MIRT543516 PRSS21 protease, serine 21 2 2
MIRT543823 GSG1 germ cell associated 1 2 2
MIRT544958 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545178 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545333 CCDC83 coiled-coil domain containing 83 2 2
MIRT545517 RSL24D1 ribosomal L24 domain containing 1 2 2
MIRT545668 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545930 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546101 USP48 ubiquitin specific peptidase 48 2 4
MIRT546597 SALL1 spalt like transcription factor 1 2 4
MIRT546625 RTN4 reticulon 4 2 2
MIRT547650 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547986 HCFC2 host cell factor C2 2 4
MIRT548716 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548930 CDK17 cyclin dependent kinase 17 2 2
MIRT549066 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549265 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT550458 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550805 FAM229B family with sequence similarity 229 member B 2 2
MIRT552023 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552333 ZNF704 zinc finger protein 704 2 2
MIRT552731 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553794 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554693 RNF149 ring finger protein 149 2 2
MIRT555131 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555263 PRDM4 PR/SET domain 4 2 2
MIRT556847 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557473 GPR27 G protein-coupled receptor 27 2 4
MIRT558017 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558497 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558578 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558609 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT558649 CNKSR3 CNKSR family member 3 2 2
MIRT558984 CA8 carbonic anhydrase 8 2 2
MIRT559140 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559326 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT562020 LANCL1 LanC like 1 2 2
MIRT562868 KIAA1456 KIAA1456 2 2
MIRT563073 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563495 DLGAP3 DLG associated protein 3 2 2
MIRT563889 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564310 CCNT1 cyclin T1 2 2
MIRT564941 XKR7 XK related 7 2 2
MIRT564978 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565422 TEF TEF, PAR bZIP transcription factor 2 2
MIRT566823 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571960 KIF5B kinesin family member 5B 2 2
MIRT575876 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT576522 Txlna taxilin alpha 2 2
MIRT614692 TRAK1 trafficking kinesin protein 1 2 2
MIRT616064 ZC3H14 zinc finger CCCH-type containing 14 2 2
MIRT618837 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT624625 ATXN2 ataxin 2 2 2
MIRT624651 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT640313 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT659247 CUL3 cullin 3 2 2
MIRT680971 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682260 RS1 retinoschisin 1 2 2
MIRT682504 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693903 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT699213 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT699372 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699450 SLC16A9 solute carrier family 16 member 9 2 2
MIRT701229 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT702848 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT706162 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT718989 UTP15 UTP15, small subunit processome component 2 2
MIRT755921 ALDH1A3 aldehyde dehydrogenase 1 family member A3 1 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4524b Tripterygium wilfordii Hook F resistant tissue

Error report submission