miRTarBase - #MIRT082474


—
pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PPP1R37
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 284352.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguGGUAACGAUUUCACGUUAa 5'
             |: || || ||||||||| 
Target 5' uuuCUUUUUCUCAAGUGCAAUa 3'
 		2 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000221462.4 | 3UTR | CUUUCUUUUUCUCAAGUGCAAUAAAUCUAUCAGGGAGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.665 6.6e-3 -0.595 1.6e-2 13 Click to see details
GSE21687 Ependynoma primary tumors -0.302 7.6e-3 -0.155 1.1e-1 64 Click to see details
GSE17498 Multiple myeloma -0.301 3.0e-2 -0.214 9.2e-2 40 Click to see details
GSE28544 Breast cancer 0.336 5.4e-2 0.477 9.2e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.316 7.1e-2 -0.362 4.5e-2 23 Click to see details
GSE32688 Pancreatic cancer -0.166 1.8e-1 -0.429 7.1e-3 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.178 2.0e-1 -0.274 9.3e-2 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.484 2.0e-1 -0.300 3.1e-1 5 Click to see details
GSE17306 Multiple myeloma -0.088 2.7e-1 0.350 6.8e-3 49 Click to see details
GSE19350 CNS germ cell tumors 0.121 3.5e-1 0.140 3.3e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.079 3.7e-1 0.164 2.4e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.079 3.7e-1 0.164 2.4e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission