miRTarBase - #MIRT082513


—
pre-miRNA Information
pre-miRNA hsa-mir-6077   
Genomic Coordinates chr1: 148388282 - 148388363
Description Homo sapiens miR-6077 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6077
Sequence 13| GGGAAGAGCUGUACGGCCUUC |33
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1462165071 1 dbSNP
rs1265010670 5 dbSNP
rs1217611018 9 dbSNP
rs1344561872 12 dbSNP
rs1280409926 14 dbSNP
rs1239463516 15 dbSNP
rs1337271015 21 dbSNP
Putative Targets

Gene Information
Gene Symbol CALM3   
Synonyms CaM, CaMIII, HEL-S-72, PHKD, PHKD3
Description calmodulin 3
Transcript NM_005184   
Expression
Putative miRNA Targets on CALM3
3'UTR of CALM3
(miRNA target sites are highlighted)		 
>CALM3|NM_005184|3'UTR
   1 AGGCCCCCCGGGCAGCTGGCGATGCCCGTTCTCTTGATCTCTCTCTTCTCGCGCGCGCACTCTCTCTTCAACACTCCCCT
  81 GCGTACCCCGGTTCTAGCAAACACCAATTGATTGACTGAGAATCTGATAAAGCAACAAAAGATTTGTCCCAAGCTGCATG
 161 ATTGCTCTTTCTCCTTCTTCCCTGAGTCTCTCTCCATGCCCCTCATCTCTTCCTTTTGCCCTCGCCTCTTCCATCCATGT
 241 CTTCCAAGGCCTGATGCATTCATAAGTTGAAGCCCTCCCCAGATCCCCTTGGGGAGCCTCTGCCCTCCTCCAGCCCGGAT
 321 GGCTCTCCTCCATTTTGGTTTGTTTCCTCTTGTTTGTCATCTTATTTTGGGTGCTGGGGTGGCTGCCAGCCCTGTCCCGG
 401 GACCTGCTGGGAGGGACAAGAGGCCCTCCCCCAGGCAGAAGAGCATGCCCTTTGCCGTTGCATGCAACCAGCCCTGTGAT
 481 TCCACGTGCAGATCCCAGCAGCCTGTTGGGGCAGGGGTGCCAAGAGAGGCATTCCAGAAGGACTGAGGGGGCGTTGAGGA
 561 ATTGTGGCGTTGACTGGATGTGGCCCAGGAGGGGGTCGAGGGGGCCAACTCACAGAAGGGGACTGACAGTGGGCAACACT
 641 CACATCCCACTGGCTGCTGTTCTGAAACCATCTGATTGGCTTTCTGAGGTTTGGCTGGGTGGGGACTGCTCATTTGGCCA
 721 CTCTGCAAATTGGACTTGCCCGCGTTCCTGAAGCGCTCTCGAGCTGTTCTGTAAATACCTGGTGCTAACATCCCATGCCG
 801 CTCCCTCCTCACGATGCACCCACCGCCCTGAGGGCCCGTCCTAGGAATGGATGTGGGGATGGTCGCTTTGTAATGTGCTG
 881 GTTCTCTTTTTTTTTCTTTCCCCTCTATGGCCCTTAAGACTTTCATTTTGTTCAGAACCATGCTGGGCTAGCTAAAGGGT
 961 GGGGAGAGGGAAGATGGGCCCCACCACGCTCTCAAGAGAACGCACCTGCAATAAAACAGTCTTGTCGGCCAGCTGCCCAG
1041 GGGACGGCAGCTACAGCAGCCTCTGCGTCCTGGTCCGCCAGCACCTCCCGCTTCTCCGTGGTGACTTGGCGCCGCTTCCT
1121 CACATCTGTGCTCCGTGCCCTCTTCCCTGCCTCTTCCCTCGCCCACCTGCCTGCCCCCATACTCCCCCAGCGGAGAGCAT
1201 GATCCGTGCCCTTGCTTCTGACTTTCGCCTCTGGGACAAGTAAGTCAATGTGGGCAGTTCAGTCGTCTGGGTTTTTTCCC
1281 CTTTTCTGTTCATTTCATCTGGCTCCCCCCACCACCTCCCCACCCCACCCCCCACCCCCTGCTTCCCCTCACTGCCCAGG
1361 TCGATCAAGTGGCTTTTCCTGGGACCTGCCCAGCTTTGAGAATCTCTTCTCATCCACCCTCTGGCACCCAGCCTCTGAGG
1441 GAAGGAGGGATGGGGCATAGTGGGAGACCCAGCCAAGAGCTGAGGGTAAGGGCAGGTAGGCGTGAGGCTGTGGACATTTT
1521 CGGAATGTTTTGGTTTTGTTTTTTTTAAACCGGGCAATATTGTGTTCAGTTCAAGCTGTGAAGAAAAATATATATCAATG
1601 TTTTCCAATAAAATACAGTGACTACCTGAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUCCGGCAUGUCGAGAAGGg 5'
            | |||   || ||||||| 
Target 5' ccATGCCCCTCATCTCTTCCt 3'
 194 - 214 155.00 -15.50
2 
miRNA  3' cuuccGGCAUGUCGAGAAGGg 5'
               ||||:|  ||||||| 
Target 5' gtgctCCGTGC-CCTCTTCCc 3'
 1128 - 1147 155.00 -23.20
3 
miRNA  3' cuUCCGGCAUGU----CGAGAAGGg 5'
            |||:||  ||    |||:|||| 
Target 5' ccAGGTCGATCAAGTGGCTTTTCCt 3'
 1356 - 1380 145.00 -19.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1186207 4 ClinVar
392931 20 ClinVar
1175610 239 ClinVar
COSN30139644 9 COSMIC
COSN22896901 10 COSMIC
COSN26969046 10 COSMIC
COSN30473252 11 COSMIC
COSN13815729 22 COSMIC
COSN28825058 22 COSMIC
COSN30110163 24 COSMIC
COSN30171460 27 COSMIC
COSN30508306 47 COSMIC
COSN30138341 53 COSMIC
COSN30752169 54 COSMIC
COSN30505767 56 COSMIC
COSN19771661 83 COSMIC
COSN19730792 84 COSMIC
COSN24306932 88 COSMIC
COSN30714324 105 COSMIC
COSN25139404 255 COSMIC
COSN5761206 263 COSMIC
COSN31513585 658 COSMIC
COSN16724744 696 COSMIC
COSN26549075 729 COSMIC
COSN23779637 739 COSMIC
COSN16653089 761 COSMIC
COSN26568337 762 COSMIC
COSN30165527 831 COSMIC
COSN24545389 859 COSMIC
COSN27465841 896 COSMIC
COSN16477878 911 COSMIC
COSN29715246 1039 COSMIC
COSN26637244 1073 COSMIC
COSN31571928 1106 COSMIC
COSN15095270 1245 COSMIC
COSN7446986 1315 COSMIC
COSN8973942 1328 COSMIC
COSN31661331 1467 COSMIC
COSN31594588 1547 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1357366971 2 dbSNP
rs758159285 4 dbSNP
rs772262461 4 dbSNP
rs1021871838 5 dbSNP
rs373639939 6 dbSNP
rs776273060 7 dbSNP
rs1185923613 8 dbSNP
rs1330512261 9 dbSNP
rs762466010 10 dbSNP
rs773792527 11 dbSNP
rs1186310161 12 dbSNP
rs763262846 18 dbSNP
rs766718548 19 dbSNP
rs368104478 20 dbSNP
rs767653657 21 dbSNP
rs2229577 22 dbSNP
rs750311120 28 dbSNP
rs760289559 29 dbSNP
rs746703455 31 dbSNP
rs1357645531 36 dbSNP
rs1310738179 38 dbSNP
rs763914591 42 dbSNP
rs754643698 44 dbSNP
rs1402292147 45 dbSNP
rs780937181 48 dbSNP
rs747668761 49 dbSNP
rs371492420 51 dbSNP
rs533341328 52 dbSNP
rs370437245 53 dbSNP
rs373845333 54 dbSNP
rs143416579 55 dbSNP
rs1280834750 56 dbSNP
rs566425717 57 dbSNP
rs528957115 58 dbSNP
rs1007562909 60 dbSNP
rs758987936 60 dbSNP
rs1039326977 62 dbSNP
rs1460217874 63 dbSNP
rs1397050924 64 dbSNP
rs186233475 65 dbSNP
rs902082630 67 dbSNP
rs1334658746 69 dbSNP
rs1457128739 72 dbSNP
rs1406392233 82 dbSNP
rs370746699 83 dbSNP
rs1026461427 84 dbSNP
rs538139194 90 dbSNP
rs1245727896 91 dbSNP
rs1005936586 95 dbSNP
rs1273528784 96 dbSNP
rs1342089474 107 dbSNP
rs375150686 108 dbSNP
rs969737189 109 dbSNP
rs1223909182 113 dbSNP
rs1366217586 120 dbSNP
rs1300810178 136 dbSNP
rs1043729277 149 dbSNP
rs750435544 153 dbSNP
rs1373671590 157 dbSNP
rs979722071 161 dbSNP
rs1327047958 164 dbSNP
rs1457014166 165 dbSNP
rs1344010304 166 dbSNP
rs1249974976 170 dbSNP
rs1401365939 174 dbSNP
rs1443047606 174 dbSNP
rs1185706625 175 dbSNP
rs1172032568 178 dbSNP
rs1455785719 181 dbSNP
rs928586014 188 dbSNP
rs1484762215 191 dbSNP
rs1243790024 193 dbSNP
rs959956569 201 dbSNP
rs879785123 203 dbSNP
rs1002168064 205 dbSNP
rs1444187260 206 dbSNP
rs1277504108 209 dbSNP
rs1235818765 210 dbSNP
rs1348199989 220 dbSNP
rs1056801056 221 dbSNP
rs375625847 224 dbSNP
rs1463523159 225 dbSNP
rs10113 239 dbSNP
rs1432048286 240 dbSNP
rs1359074892 246 dbSNP
rs1311184804 247 dbSNP
rs1436657789 249 dbSNP
rs112654432 252 dbSNP
rs1469896995 255 dbSNP
rs979548998 258 dbSNP
rs1426523008 259 dbSNP
rs1005372074 263 dbSNP
rs533960079 276 dbSNP
rs1018497390 286 dbSNP
rs925340309 288 dbSNP
rs1212480767 289 dbSNP
rs56161516 289 dbSNP
rs766421117 293 dbSNP
rs1273476895 304 dbSNP
rs553459886 311 dbSNP
rs372613705 312 dbSNP
rs902109850 317 dbSNP
rs190593283 318 dbSNP
rs1328547525 321 dbSNP
rs923285138 322 dbSNP
rs148364198 325 dbSNP
rs886643938 329 dbSNP
rs710889 331 dbSNP
rs1311581440 336 dbSNP
rs58879748 337 dbSNP
rs1416714005 353 dbSNP
rs1376075615 358 dbSNP
rs988897302 359 dbSNP
rs183554340 361 dbSNP
rs187698430 362 dbSNP
rs1356470051 364 dbSNP
rs1261276595 371 dbSNP
rs1170929939 372 dbSNP
rs1001171777 377 dbSNP
rs564423714 379 dbSNP
rs1189452448 380 dbSNP
rs1223580269 392 dbSNP
rs1193548305 395 dbSNP
rs1481434470 396 dbSNP
rs1262239543 397 dbSNP
rs753130601 398 dbSNP
rs1189052583 399 dbSNP
rs1334544120 400 dbSNP
rs937614110 401 dbSNP
rs1235636091 402 dbSNP
rs960235453 415 dbSNP
rs1057386435 418 dbSNP
rs1356199812 418 dbSNP
rs988776093 419 dbSNP
rs1389711187 420 dbSNP
rs895523050 423 dbSNP
rs1298944647 427 dbSNP
rs929608846 427 dbSNP
rs1391966989 428 dbSNP
rs3729764 429 dbSNP
rs1177972061 431 dbSNP
rs1363132064 436 dbSNP
rs1403259119 442 dbSNP
rs968604781 443 dbSNP
rs1289061356 445 dbSNP
rs1250817016 446 dbSNP
rs540494480 448 dbSNP
rs1380921232 457 dbSNP
rs749865929 458 dbSNP
rs1215916517 466 dbSNP
rs1005691690 468 dbSNP
rs1018109502 470 dbSNP
rs771584904 472 dbSNP
rs560704391 475 dbSNP
rs1337546556 483 dbSNP
rs753854456 486 dbSNP
rs549014226 487 dbSNP
rs1281531374 490 dbSNP
rs1322902354 524 dbSNP
rs1327722167 529 dbSNP
rs1441367274 535 dbSNP
rs1384241547 536 dbSNP
rs1156686339 539 dbSNP
rs370887036 544 dbSNP
rs563558784 548 dbSNP
rs768215757 552 dbSNP
rs1172647707 554 dbSNP
rs562390054 555 dbSNP
rs1484987956 556 dbSNP
rs1203176356 569 dbSNP
rs531320877 570 dbSNP
rs1195966194 572 dbSNP
rs1469176880 581 dbSNP
rs988784347 585 dbSNP
rs1020217643 587 dbSNP
rs776350182 588 dbSNP
rs1261438052 591 dbSNP
rs1233618522 592 dbSNP
rs1346078883 593 dbSNP
rs191463363 595 dbSNP
rs1305886844 596 dbSNP
rs886674130 598 dbSNP
rs761599896 599 dbSNP
rs1316168339 605 dbSNP
rs1334803955 609 dbSNP
rs979218740 610 dbSNP
rs1201482067 613 dbSNP
rs113733185 614 dbSNP
rs905641203 615 dbSNP
rs1001204545 619 dbSNP
rs534051400 623 dbSNP
rs769636506 626 dbSNP
rs1372818655 628 dbSNP
rs532047125 629 dbSNP
rs1264530516 634 dbSNP
rs993102321 634 dbSNP
rs567413636 635 dbSNP
rs1010296772 636 dbSNP
rs1211813954 637 dbSNP
rs1338527778 640 dbSNP
rs1451107714 643 dbSNP
rs188057901 644 dbSNP
rs1288663976 661 dbSNP
rs1327021892 663 dbSNP
rs1292583114 672 dbSNP
rs1366581267 678 dbSNP
rs1407362526 681 dbSNP
rs969010758 687 dbSNP
rs1046783177 692 dbSNP
rs531766111 694 dbSNP
rs575269566 697 dbSNP
rs1166586829 703 dbSNP
rs1476588932 708 dbSNP
rs964799164 709 dbSNP
rs1424992412 714 dbSNP
rs974859633 725 dbSNP
rs10405893 729 dbSNP
rs1238594861 739 dbSNP
rs377339619 742 dbSNP
rs997957676 743 dbSNP
rs1029564470 744 dbSNP
rs983847090 746 dbSNP
rs892400246 747 dbSNP
rs112684696 751 dbSNP
rs141632852 756 dbSNP
rs540882337 758 dbSNP
rs1231331481 759 dbSNP
rs1357266154 762 dbSNP
rs978908303 764 dbSNP
rs1333685607 767 dbSNP
rs560525172 770 dbSNP
rs933909157 778 dbSNP
rs1401434607 783 dbSNP
rs1164857968 790 dbSNP
rs937505463 792 dbSNP
rs1056904952 793 dbSNP
rs993008989 794 dbSNP
rs574171902 800 dbSNP
rs542396792 801 dbSNP
rs766442907 802 dbSNP
rs1162014896 806 dbSNP
rs1365523111 813 dbSNP
rs757560245 814 dbSNP
rs562552565 815 dbSNP
rs982998463 816 dbSNP
rs1443478210 819 dbSNP
rs746172119 825 dbSNP
rs562175328 826 dbSNP
rs909583932 830 dbSNP
rs534038664 831 dbSNP
rs941023872 832 dbSNP
rs1000080684 835 dbSNP
rs921001147 838 dbSNP
rs751616368 839 dbSNP
rs1439147375 841 dbSNP
rs1361803611 843 dbSNP
rs1397390394 851 dbSNP
rs1166033209 856 dbSNP
rs201258056 865 dbSNP
rs531360926 866 dbSNP
rs1803240 868 dbSNP
rs1440595459 872 dbSNP
rs1252608854 876 dbSNP
rs892263451 881 dbSNP
rs1009470690 883 dbSNP
rs1321057969 886 dbSNP
rs1044032897 887 dbSNP
rs1444805923 887 dbSNP
rs1234174825 892 dbSNP
rs1030446665 893 dbSNP
rs954932003 896 dbSNP
rs1243411790 897 dbSNP
rs1000590419 903 dbSNP
rs551418446 908 dbSNP
rs959062424 914 dbSNP
rs1014309860 925 dbSNP
rs1370100220 928 dbSNP
rs1430579650 933 dbSNP
rs564833355 933 dbSNP
rs1343917853 936 dbSNP
rs907830285 942 dbSNP
rs1320449740 947 dbSNP
rs781278068 952 dbSNP
rs1420369423 960 dbSNP
rs951518791 963 dbSNP
rs759750636 978 dbSNP
rs983073556 985 dbSNP
rs963338251 986 dbSNP
rs767640929 988 dbSNP
rs753038671 989 dbSNP
rs1474407049 994 dbSNP
rs527600068 1001 dbSNP
rs927528403 1002 dbSNP
rs756530520 1003 dbSNP
rs962435977 1005 dbSNP
rs1057476347 1006 dbSNP
rs917023861 1012 dbSNP
rs1485023609 1017 dbSNP
rs1277754091 1019 dbSNP
rs1212526742 1026 dbSNP
rs945746023 1027 dbSNP
rs1214347571 1028 dbSNP
rs547668241 1028 dbSNP
rs547674606 1033 dbSNP
rs920898320 1034 dbSNP
rs1280586122 1035 dbSNP
rs192964295 1037 dbSNP
rs1311318515 1040 dbSNP
rs1374889508 1040 dbSNP
rs1436873521 1042 dbSNP
rs904224496 1046 dbSNP
rs776131232 1047 dbSNP
rs1274993401 1054 dbSNP
rs1039666487 1056 dbSNP
rs945192894 1058 dbSNP
rs899738926 1059 dbSNP
rs1043676074 1068 dbSNP
rs1254708219 1074 dbSNP
rs1189418619 1075 dbSNP
rs998044031 1077 dbSNP
rs1029889385 1086 dbSNP
rs954821813 1089 dbSNP
rs536431447 1090 dbSNP
rs1005344789 1091 dbSNP
rs1263144298 1098 dbSNP
rs1002103511 1099 dbSNP
rs1219737926 1102 dbSNP
rs1056202235 1107 dbSNP
rs549239108 1111 dbSNP
rs569035039 1112 dbSNP
rs973361122 1113 dbSNP
rs1188610208 1114 dbSNP
rs537917821 1115 dbSNP
rs557741221 1117 dbSNP
rs1004777961 1123 dbSNP
rs959188896 1125 dbSNP
rs1017076590 1127 dbSNP
rs993013464 1130 dbSNP
rs1460899581 1134 dbSNP
rs1415540923 1135 dbSNP
rs917370352 1136 dbSNP
rs1408388877 1138 dbSNP
rs963310110 1139 dbSNP
rs1336299123 1141 dbSNP
rs975654944 1144 dbSNP
rs1240471262 1151 dbSNP
rs1358405369 1153 dbSNP
rs1334834564 1154 dbSNP
rs920961769 1161 dbSNP
rs577571062 1162 dbSNP
rs977614767 1165 dbSNP
rs1322331351 1167 dbSNP
rs1306598487 1168 dbSNP
rs925674214 1175 dbSNP
rs1389840622 1176 dbSNP
rs1379369884 1179 dbSNP
rs1271667059 1180 dbSNP
rs757732447 1192 dbSNP
rs1390805819 1193 dbSNP
rs1217930678 1205 dbSNP
rs935682696 1206 dbSNP
rs986536235 1207 dbSNP
rs1325041829 1215 dbSNP
rs1201427233 1220 dbSNP
rs534269672 1225 dbSNP
rs1156290259 1227 dbSNP
rs1277510931 1228 dbSNP
rs1441211780 1247 dbSNP
rs1380527893 1249 dbSNP
rs867386761 1250 dbSNP
rs1468269875 1252 dbSNP
rs945099633 1257 dbSNP
rs1039359957 1259 dbSNP
rs779565546 1261 dbSNP
rs933864400 1265 dbSNP
rs554435949 1266 dbSNP
rs1488290657 1277 dbSNP
rs1200768192 1278 dbSNP
rs28678916 1279 dbSNP
rs371134338 1289 dbSNP
rs1175754029 1305 dbSNP
rs1368468341 1305 dbSNP
rs1325474478 1306 dbSNP
rs1409015616 1310 dbSNP
rs1055044328 1311 dbSNP
rs1191840557 1311 dbSNP
rs911022883 1312 dbSNP
rs1360777306 1314 dbSNP
rs1402609361 1314 dbSNP
rs942551075 1315 dbSNP
rs563042406 1316 dbSNP
rs1343202359 1317 dbSNP
rs1201430756 1318 dbSNP
rs1376232582 1318 dbSNP
rs1434292775 1318 dbSNP
rs1261635448 1320 dbSNP
rs1399379531 1322 dbSNP
rs1038506637 1323 dbSNP
rs1287050999 1323 dbSNP
rs898225911 1328 dbSNP
rs887205902 1330 dbSNP
rs1004278784 1334 dbSNP
rs994352552 1335 dbSNP
rs3209098 1336 dbSNP
rs1325847501 1339 dbSNP
rs1381235574 1340 dbSNP
rs1017525532 1341 dbSNP
rs1350944660 1342 dbSNP
rs1225112822 1343 dbSNP
rs12978611 1343 dbSNP
rs1340551379 1349 dbSNP
rs1282672315 1350 dbSNP
rs576220714 1354 dbSNP
rs886978440 1355 dbSNP
rs1403862515 1358 dbSNP
rs1174748528 1363 dbSNP
rs1466861146 1364 dbSNP
rs1056342 1381 dbSNP
rs1192080106 1384 dbSNP
rs898653996 1389 dbSNP
rs1271722658 1395 dbSNP
rs545083458 1398 dbSNP
rs1489989429 1402 dbSNP
rs997544640 1404 dbSNP
rs1198268582 1405 dbSNP
rs1004029999 1412 dbSNP
rs1338427876 1417 dbSNP
rs1014989405 1418 dbSNP
rs1028511570 1431 dbSNP
rs1341026625 1454 dbSNP
rs1292175407 1458 dbSNP
rs376180231 1463 dbSNP
rs1412380609 1468 dbSNP
rs1341953441 1481 dbSNP
rs899224750 1485 dbSNP
rs955068795 1486 dbSNP
rs1168956582 1502 dbSNP
rs1020553332 1503 dbSNP
rs994816403 1514 dbSNP
rs564875414 1522 dbSNP
rs958993694 1523 dbSNP
rs746513170 1528 dbSNP
rs1437037992 1531 dbSNP
rs527269928 1533 dbSNP
rs1236183829 1534 dbSNP
rs1157021985 1536 dbSNP
rs1378294772 1538 dbSNP
rs937857879 1539 dbSNP
rs993520003 1541 dbSNP
rs1418895681 1542 dbSNP
rs1163926097 1543 dbSNP
rs1024558278 1546 dbSNP
rs1237944333 1553 dbSNP
rs967975089 1559 dbSNP
rs1333594573 1568 dbSNP
rs977574122 1573 dbSNP
rs917828787 1579 dbSNP
rs1329818616 1583 dbSNP
rs1449456450 1587 dbSNP
rs1401685316 1590 dbSNP
rs1325737104 1593 dbSNP
rs1403702741 1593 dbSNP
rs1415987356 1598 dbSNP
rs1163885647 1599 dbSNP
rs1469851781 1601 dbSNP
rs1378692101 1602 dbSNP
rs1180337601 1604 dbSNP
rs749880138 1608 dbSNP
rs1412023998 1609 dbSNP
rs1252332775 1619 dbSNP
rs925705869 1623 dbSNP
rs1219222865 1625 dbSNP
rs768287150 1626 dbSNP
rs949256077 1630 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuuccggcaugucGAGAAGGg 5'
                       ||||||| 
Target 5' ------------cCUCUUCCa 3'
 		1 - 9
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 808.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuuccggcaugucGAGAAGGg 5'
                       ||||||| 
Target 5' ------------cCUCUUCCa 3'
 		1 - 9
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 808.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177631. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_9 PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000291295.9 | 3UTR | CCUCUUCCAUCCAUGUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000291295.9 | 3UTR | CCUCUUCCAUCCAUGUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000291295.9 | 3UTR | UCUCUCUCCAUGCCCCUCAUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000291295.9 | 3UTR | CCUCUUCCAUCCAUGUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000291295.9 | 3UTR | CCUCUUCCAUCCAUGUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000291295.9 | 3UTR | CCUCUUCCAUCCAUGUCUUCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
230 hsa-miR-6077 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060569 CCND1 cyclin D1 2 2
MIRT061579 BTG2 BTG anti-proliferation factor 2 2 4
MIRT074383 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT079444 FOXK2 forkhead box K2 2 4
MIRT082513 CALM3 calmodulin 3 2 10
MIRT086211 HOXD13 homeobox D13 2 2
MIRT097031 MAP1B microtubule associated protein 1B 2 4
MIRT119867 NRBP1 nuclear receptor binding protein 1 2 2
MIRT124576 PRRC2B proline rich coiled-coil 2B 2 2
MIRT150043 MIDN midnolin 2 4
MIRT152597 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT161909 FXR1 FMR1 autosomal homolog 1 2 2
MIRT189355 KPNA6 karyopherin subunit alpha 6 2 2
MIRT197844 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT219933 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 2
MIRT235611 ASXL1 additional sex combs like 1, transcriptional regulator 2 2
MIRT266233 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266636 CHTOP chromatin target of PRMT1 2 2
MIRT270563 SETD1B SET domain containing 1B 2 2
MIRT273829 RPL41 ribosomal protein L41 2 2
MIRT309928 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT342370 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT369368 SF3B3 splicing factor 3b subunit 3 2 2
MIRT375181 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT402071 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT445016 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT445174 TFPI tissue factor pathway inhibitor 2 2
MIRT445453 EXT1 exostosin glycosyltransferase 1 2 2
MIRT446601 AKAP1 A-kinase anchoring protein 1 2 2
MIRT447806 EMX1 empty spiracles homeobox 1 2 2
MIRT449827 TLR4 toll like receptor 4 2 2
MIRT450678 SEMA4F ssemaphorin 4F 2 2
MIRT451774 USP36 ubiquitin specific peptidase 36 2 2
MIRT451827 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT452791 FAM136A family with sequence similarity 136 member A 2 2
MIRT453957 ENTHD1 ENTH domain containing 1 2 2
MIRT454413 SEPT6 septin 6 2 2
MIRT454666 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454734 ARSK arylsulfatase family member K 2 2
MIRT455329 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT455565 TRAF1 TNF receptor associated factor 1 2 2
MIRT455733 CDCA8 cell division cycle associated 8 2 2
MIRT455755 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT456156 TTF2 transcription termination factor 2 2 2
MIRT456629 ARMCX6 armadillo repeat containing, X-linked 6 2 2
MIRT456684 LDB1 LIM domain binding 1 2 2
MIRT457225 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 2
MIRT457846 RNASEH2B ribonuclease H2 subunit B 2 4
MIRT457911 ZNF212 zinc finger protein 212 2 2
MIRT459482 CCL11 C-C motif chemokine ligand 11 2 2
MIRT459540 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 2 2
MIRT460002 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT460306 FLCN folliculin 2 2
MIRT460625 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460687 RNF157 ring finger protein 157 2 2
MIRT460751 FBLN5 fibulin 5 2 2
MIRT461028 SDF4 stromal cell derived factor 4 2 2
MIRT462243 PRSS16 protease, serine 16 2 2
MIRT462690 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT462872 ZXDB zinc finger, X-linked, duplicated B 2 2
MIRT463037 ZNF689 zinc finger protein 689 2 2
MIRT463242 ZIC5 Zic family member 5 2 2
MIRT463683 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT463778 YOD1 YOD1 deubiquitinase 2 2
MIRT463914 WNT3 Wnt family member 3 2 2
MIRT463949 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT464081 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT465044 TTC14 tetratricopeptide repeat domain 14 2 2
MIRT465330 TPM3 tropomyosin 3 2 2
MIRT465657 TNPO2 transportin 2 2 2
MIRT466490 TEAD1 TEA domain transcription factor 1 2 2
MIRT467550 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 4
MIRT467770 SLC2A4 solute carrier family 2 member 4 2 2
MIRT469007 RNF41 ring finger protein 41 2 2
MIRT469032 RNF38 ring finger protein 38 2 6
MIRT469757 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT469794 RAB15 RAB15, member RAS oncogene family 2 2
MIRT471159 PHF12 PHD finger protein 12 2 2
MIRT471336 PERP PERP, TP53 apoptosis effector 2 2
MIRT471598 PAQR5 progestin and adipoQ receptor family member 5 2 8
MIRT471899 NUAK2 NUAK family kinase 2 2 2
MIRT471914 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT471932 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT472500 NACC2 NACC family member 2 2 2
MIRT472746 MTSS1L MTSS1L, I-BAR domain containing 2 2
MIRT473098 MLXIP MLX interacting protein 2 2
MIRT473820 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT475423 ICK intestinal cell kinase 2 2
MIRT475649 HIF3A hypoxia inducible factor 3 alpha subunit 2 4
MIRT475761 HDLBP high density lipoprotein binding protein 2 2
MIRT476085 GRB2 growth factor receptor bound protein 2 2 2
MIRT476605 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT476784 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT477312 EPHB2 EPH receptor B2 2 2
MIRT479075 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT479871 CCDC6 coiled-coil domain containing 6 2 2
MIRT480028 CANX calnexin 2 6
MIRT480052 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT480890 BCL9L B-cell CLL/lymphoma 9 like 2 2
MIRT480927 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT481448 ARRB2 arrestin beta 2 2 2
MIRT482357 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT483260 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483434 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483843 UNC5B unc-5 netrin receptor B 2 4
MIRT484343 EPN1 epsin 1 2 4
MIRT484707 RNF11 ring finger protein 11 2 4
MIRT485705 CBX7 chromobox 7 2 2
MIRT485947 BRSK1 BR serine/threonine kinase 1 2 2
MIRT486528 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486692 GLYR1 glyoxylate reductase 1 homolog 2 2
MIRT487838 CLSTN1 calsyntenin 1 2 4
MIRT487995 RXRB retinoid X receptor beta 2 2
MIRT488030 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488479 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488817 TBC1D28 TBC1 domain family member 28 2 2
MIRT488884 ASTN2 astrotactin 2 2 4
MIRT490493 GLRA3 glycine receptor alpha 3 2 2
MIRT490878 OSBP oxysterol binding protein 2 2
MIRT490926 GRIN2D glutamate ionotropic receptor NMDA type subunit 2D 2 4
MIRT491036 ALPK3 alpha kinase 3 2 2
MIRT491412 SSPN sarcospan 2 4
MIRT491583 USB1 U6 snRNA biogenesis phosphodiesterase 1 2 2
MIRT494037 DUSP7 dual specificity phosphatase 7 2 2
MIRT495713 PADI1 peptidyl arginine deiminase 1 2 2
MIRT498826 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 8
MIRT498930 TMEM106B transmembrane protein 106B 2 8
MIRT499201 TJAP1 tight junction associated protein 1 2 2
MIRT499586 INTU inturned planar cell polarity protein 2 4
MIRT499678 MRE11A MRE11 homolog, double strand break repair nuclease 2 4
MIRT499769 SLC29A2 solute carrier family 29 member 2 2 2
MIRT500120 ZNF106 zinc finger protein 106 2 4
MIRT501739 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT503315 FICD FIC domain containing 2 4
MIRT503449 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT507136 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT511906 FKBP1A FK506 binding protein 1A 2 2
MIRT513103 DYNAP dynactin associated protein 2 2
MIRT520500 TRAM2 translocation associated membrane protein 2 2 6
MIRT524337 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT525321 SNX29 sorting nexin 29 2 2
MIRT526804 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT530935 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2 2
MIRT537471 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT538696 CASP16 caspase 16, pseudogene 2 4
MIRT541101 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT545632 GGCX gamma-glutamyl carboxylase 2 2
MIRT545660 TMEM97 transmembrane protein 97 2 4
MIRT545919 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT546411 SPRED3 sprouty related EVH1 domain containing 3 2 2
MIRT546520 SERTAD3 SERTA domain containing 3 2 2
MIRT547205 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548142 FYCO1 FYVE and coiled-coil domain containing 1 2 2
MIRT548961 CCNT2 cyclin T2 2 2
MIRT549400 AKAP11 A-kinase anchoring protein 11 2 2
MIRT551661 KIAA1143 KIAA1143 2 4
MIRT552470 ZNF275 zinc finger protein 275 2 4
MIRT557120 HOXA3 homeobox A3 2 2
MIRT557324 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT557442 GTPBP2 GTP binding protein 2 2 2
MIRT557680 GATA6 GATA binding protein 6 2 2
MIRT559844 RBM23 RNA binding motif protein 23 2 2
MIRT559872 ATXN3 ataxin 3 2 2
MIRT559929 SOD2 superoxide dismutase 2 2 2
MIRT559977 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT560091 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560103 ZNF557 zinc finger protein 557 2 2
MIRT560118 RAB6C RAB6C, member RAS oncogene family 2 2
MIRT560126 PRDM6 PR/SET domain 6 2 2
MIRT560175 COA1 cytochrome c oxidase assembly factor 1 homolog 2 2
MIRT560261 TMEM236 transmembrane protein 236 2 2
MIRT560311 EFHD2 EF-hand domain family member D2 2 2
MIRT560372 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT560425 ANGPTL3 angiopoietin like 3 2 2
MIRT560467 SMIM9 small integral membrane protein 9 2 2
MIRT560471 ENSA endosulfine alpha 2 2
MIRT560496 KCNJ10 potassium voltage-gated channel subfamily J member 10 2 2
MIRT560509 POGK pogo transposable element derived with KRAB domain 2 2
MIRT560554 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT560560 MYLK myosin light chain kinase 2 2
MIRT560593 FAM114A1 family with sequence similarity 114 member A1 2 2
MIRT560610 TRIM38 tripartite motif containing 38 2 2
MIRT560615 ANKRD36 ankyrin repeat domain 36 2 2
MIRT560808 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT560888 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT560914 PA2G4 proliferation-associated 2G4 2 2
MIRT560949 POTED POTE ankyrin domain family member D 2 2
MIRT560958 WRN Werner syndrome RecQ like helicase 2 2
MIRT561001 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT561080 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT561104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT561198 LDHD lactate dehydrogenase D 2 2
MIRT561207 ZXDA zinc finger, X-linked, duplicated A 2 2
MIRT561286 ZCCHC14 zinc finger CCHC-type containing 14 2 2
MIRT561370 UBXN2B UBX domain protein 2B 2 2
MIRT561488 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT561516 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT561677 RAD54L2 RAD54 like 2 2 2
MIRT561838 NREP neuronal regeneration related protein 2 2
MIRT561959 LSM12 LSM12 homolog 2 2
MIRT562342 EXOSC2 exosome component 2 2 2
MIRT562386 EN2 engrailed homeobox 2 2 2
MIRT562399 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT562477 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT563631 ZNF460 zinc finger protein 460 2 2
MIRT563991 SLFN11 schlafen family member 11 2 2
MIRT564294 MED26 mediator complex subunit 26 2 2
MIRT565594 SLC35G1 solute carrier family 35 member G1 2 2
MIRT567200 IGFBP5 insulin like growth factor binding protein 5 2 4
MIRT567410 GOLPH3L golgi phosphoprotein 3 like 2 2
MIRT568367 ATXN1 ataxin 1 2 2
MIRT569870 KLK10 kallikrein related peptidase 10 2 2
MIRT571258 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT571688 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT572702 SRPK1 SRSF protein kinase 1 2 2
MIRT573931 CNTNAP2 contactin associated protein like 2 2 2
MIRT573965 LINGO1 leucine rich repeat and Ig domain containing 1 2 2
MIRT618154 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT619123 CD40LG CD40 ligand 2 2
MIRT620228 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT640243 DERL2 derlin 2 2 2
MIRT652912 SYNPO2L synaptopodin 2 like 2 2
MIRT661918 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT697846 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT701989 MIER3 MIER family member 3 2 2
MIRT702213 LPCAT1 lysophosphatidylcholine acyltransferase 1 2 2
MIRT705575 ARHGEF12 Rho guanine nucleotide exchange factor 12 2 2
MIRT708500 FAM9C family with sequence similarity 9 member C 2 2
MIRT716273 NUP85 nucleoporin 85 2 2
MIRT723698 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6077 Anlotinib 25017411 NSC832523 sensitive Low Lung Adenocarcinoma cell line (A549, PDC)
hsa-miR-6077 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6077 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission