>PNPLA6|NM_001166111|3'UTR
   1 GGACCTCGACAGGGGTCACCCCCTCCCTCCCACCCCTGGACTGGGCTGGGGGTGGCCCCGTGGGGGTAGCTCACTCCCCC
  81 TCCTGCTGCTATGCCTGTGACCCCCGCGGCCCACACACTGGACTGACCTGCCCTGAGCGGGGATGCAGTGTTGCACTGAT
 161 GACTTGACCAGCCCCTCCCCCAATAAACTCGCCTCTTGGAAATGGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cucuguccGAAUACGACGAUa 5' || |||||||| Target 5' cactccccCTCCTGCTGCTAt 3'	72 - 92	149.00	-11.90
2	miRNA 3' cuCU-GUCCGAA---UACGACGaua 5' || |:|| | :||:||| Target 5' ctGAGCGGGGATGCAGTGTTGCact 3'	133 - 157	95.00	-11.22
3	miRNA 3' cucuGUCCGAAUACGACgaua 5' | || |: |||| Target 5' acccCTGGACTGGGCTGgggg 3'	32 - 52	89.00	-13.90

Mutant ID	Mutant Position	Mutant Source
330540	9	ClinVar
330541	21	ClinVar
1195642	80	ClinVar
893775	90	ClinVar
330542	106	ClinVar
330543	140	ClinVar
893776	184	ClinVar
COSN30146958	14	COSMIC
COSN30481451	23	COSMIC
COSN30164512	136	COSMIC
COSN15859573	139	COSMIC
COSN30169500	203	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs766110451	5	dbSNP
rs1385271108	6	dbSNP
rs1297827432	8	dbSNP
rs561526950	9	dbSNP
rs1227652518	12	dbSNP
rs1272387370	16	dbSNP
rs373786523	18	dbSNP
rs1282891721	19	dbSNP
rs1222925506	20	dbSNP
rs886054698	21	dbSNP
rs530636876	23	dbSNP
rs764341736	24	dbSNP
rs753716382	26	dbSNP
rs1176740860	29	dbSNP
rs754200257	30	dbSNP
rs1368115170	32	dbSNP
rs375402166	33	dbSNP
rs1448342888	34	dbSNP
rs757702031	35	dbSNP
rs765608367	45	dbSNP
rs750948358	46	dbSNP
rs1427050342	47	dbSNP
rs757801938	48	dbSNP
rs1349598247	51	dbSNP
rs1456598668	52	dbSNP
rs1290845040	53	dbSNP
rs944754667	56	dbSNP
rs953595678	57	dbSNP
rs779729052	60	dbSNP
rs541522650	61	dbSNP
rs1295380900	63	dbSNP
rs1410676319	66	dbSNP
rs1310028845	67	dbSNP
rs112486263	69	dbSNP
rs1384935721	78	dbSNP
rs144903832	80	dbSNP
rs781056060	81	dbSNP
rs747880475	83	dbSNP
rs1302378785	84	dbSNP
rs765333636	90	dbSNP
rs1260912243	99	dbSNP
rs1464085691	100	dbSNP
rs1206304364	101	dbSNP
rs777505334	102	dbSNP
rs533101098	103	dbSNP
rs886054699	106	dbSNP
rs749270328	107	dbSNP
rs1048891252	108	dbSNP
rs770905367	108	dbSNP
rs775518600	109	dbSNP
rs760813147	112	dbSNP
rs1456868333	113	dbSNP
rs924661277	126	dbSNP
rs1318656059	127	dbSNP
rs957413547	128	dbSNP
rs1408317159	129	dbSNP
rs1448739369	131	dbSNP
rs1283521373	136	dbSNP
rs1376751494	139	dbSNP
rs534152961	140	dbSNP
rs1288693029	141	dbSNP
rs1167804823	145	dbSNP
rs1328079109	147	dbSNP
rs563538821	149	dbSNP
rs1264478659	157	dbSNP
rs915840205	169	dbSNP
rs1442488032	170	dbSNP
rs1211525028	172	dbSNP
rs1237382462	173	dbSNP
rs1482510738	175	dbSNP
rs1179343675	178	dbSNP
rs868166484	181	dbSNP
rs1472394590	182	dbSNP
rs948612575	184	dbSNP
rs1045614120	189	dbSNP
rs1249849880	190	dbSNP
rs776928530	191	dbSNP
rs1415077623	192	dbSNP
rs762020287	194	dbSNP
rs1357378537	196	dbSNP
rs1444241771	198	dbSNP
rs1380534632	199	dbSNP
rs1036799128	202	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.