miRTarBase - #MIRT083283


—
pre-miRNA Information
pre-miRNA hsa-mir-4728   
Genomic Coordinates chr17: 39726495 - 39726561
Description Homo sapiens miR-4728 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4728-5p
Sequence 2| UGGGAGGGGAGAGGCAGCAAGCA |24
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1419589985 1 dbSNP
rs778443386 2 dbSNP
rs1275042409 3 dbSNP
rs748675090 6 dbSNP
rs772543431 17 dbSNP
rs773610056 18 dbSNP
rs747372658 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BQA97X miR-4728 Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol ZCCHC3   
Synonyms C20orf99
Description zinc finger CCHC-type containing 3
Transcript NM_033089   
Expression
Putative miRNA Targets on ZCCHC3
3'UTR of ZCCHC3
(miRNA target sites are highlighted)		 
>ZCCHC3|NM_033089|3'UTR
   1 ACACCCGCCTGCCTGCCAGGGTGAACACACAGCCAGCTTATCCCTCTTAAGTGCCAAAACTTTTTTTTAAACCATTTTTT
  81 ATCGTTTTTGAAGGAGATCTTTTTAAAACCTACAAGAGACATCTCTCTATGCCTTCTTAAACCGAGTTTACTCCATTTCA
 161 GCCTGTTCTGAATTGGTGACTCTGTCACCAATAACGACTGCGGAGAACTGTAGCGTGCAGATGTGTTGCCCCTCCCTTTT
 241 AAAATTTTATTTTCGTTTTTCTATTGGGTATTTGTTTTGTTTCTTGTACTTTTTCTCTCTCTCCTTGCCCCCCTCCCGCC
 321 CTCCCCGCCCCATACCTTTTCTTCCCCTGGATTTTCACCCTTTGGGCTGCCTTGCTCATCTTTATGCCCCAGCACTAGGT
 401 ACGGGGCCCAACACGTGGTAGGCACTCCATCAGTGTTTGCTGAATTGAAAACATTGTTGACTGTGGCTTCTATCAGAGTG
 481 TCTACCTTTTGCAGCTCTTCCCCTCCCTCATTTAATTTGCTGCTTTTAATCTACGTGGTCTGAGAATTTGTGAAACCAGT
 561 GTTGTTAGAAGTGTATATAATCTGAATCAATAAGCTCTGAATGGTGGCCAAGGGCCTCTCTTATGGCACAAAGATGCATG
 641 GACTTCATGACAGCTCTTTTGGTGGCTCAGAAGCCATTTTTTATAGAATCATGGAATCTAGAATATTCCTGCTGGAAAGA
 721 ACCTGAGAGTTGGTTTGGACCAATTCCCTGGTTTTCCAGCAGATGAAACAGGCCCAAAGAGGTTAAATGACTGGGTGAAA
 801 ATCACATAGCTGTCTGGTGCCAGAGCCAGCCTATAGTAGAGTCCCCTGACCCCAAGCCCGGTGCTCATTCCACTACCTCT
 881 CACACTTCACAACAATTTCCTCAACACTTGAGGGCCCAGAAAGTCTGATCTCTCCAGAATGATCAGCCCAGAGGAATGCT
 961 GAGAAATCACCTGGAGGAGGGAGCAGAAAGAGAAGGTTTTTAAGGAGGGGCTTCTGAATACTTGGGAGATACGGAACGGA
1041 CCAAGGACCACACTCCAGGGTGCATTCGTTGCTCCCTGGGGCACCACTTCTGGATTACAGTGTGCCAGGTCCTTTGGAGG
1121 CCCTACCCCTTCCCCATTCATTGCCACCAGTGAGAAATGGGGGTGCCCCTGTGTAAAGAAACCTACCAAAGGTTTACATT
1201 TGCACCTTAGCCTCAATAGCTACGAACCCTAGAGAAGCAGCTAGCTGGAGCTCATGTGCAACTCCTGATTCTCAGGAGAA
1281 AGATGGATTTTAACCCAAAATTATGAGTGAGCTGTTAACTCTAAAATGTACTTGGGAGATAGGCCAAGCGAGAGGTCATG
1361 GGCCAACTAAGTGTTATCCAGTAGAAAAGACAGTACACTGCTTTTCTTTTAGTGTTTGCTTTTCCTTTGCTATATGTTTT
1441 GCTATTTCCTTGTGGCTTAGAATGTAAAATTGATTGTTAAAAGTTTTGTTCTGAATAAATATTTATCTTTTGTATTGCTA
1521 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acGAACGACGGAGAGGGGAGGGu 5'
            :|||| ||: :||||||||| 
Target 5' ctTTTGCAGCTCTTCCCCTCCCt 3'
 486 - 508 177.00 -28.90
2 
miRNA  3' acGAAC-GACGGAGAG-GGGAGGGu 5'
            |||| |  |||| | ||||||| 
Target 5' tcCTTGCCCCCCTCCCGCCCTCCCc 3'
 302 - 326 165.00 -26.00
3 
miRNA  3' acGAACG---ACGGAGAGGGGAGGGu 5'
            | |||   ||: |: |||||||| 
Target 5' agCGTGCAGATGTGTTGCCCCTCCCt 3'
 212 - 237 161.00 -23.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30511536 7 COSMIC
COSN1082990 59 COSMIC
COSN13244990 69 COSMIC
COSN30525342 75 COSMIC
COSN30123952 100 COSMIC
COSN30116279 319 COSMIC
COSN15627012 332 COSMIC
COSN15627013 428 COSMIC
COSN30133479 433 COSMIC
COSN31548555 471 COSMIC
COSN30534195 612 COSMIC
COSN15627014 615 COSMIC
COSN15627015 632 COSMIC
COSN30544215 763 COSMIC
COSN31572242 806 COSMIC
COSN26637881 813 COSMIC
COSN26190232 909 COSMIC
COSN31482781 964 COSMIC
COSN31489569 964 COSMIC
COSN31540856 1033 COSMIC
COSN21903558 1035 COSMIC
COSN30112209 1068 COSMIC
COSN8610684 1086 COSMIC
COSN23396393 1194 COSMIC
COSN26708746 1221 COSMIC
COSN30143387 1225 COSMIC
COSN31489557 1306 COSMIC
COSN26585103 1351 COSMIC
COSN31529735 1371 COSMIC
COSN5968419 1403 COSMIC
COSN15627017 1425 COSMIC
COSN15627016 1429 COSMIC
COSN15627018 1493 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763872038 4 dbSNP
rs751191179 6 dbSNP
rs371820165 7 dbSNP
rs1027913841 8 dbSNP
rs1206959284 11 dbSNP
rs1247628078 15 dbSNP
rs767113214 17 dbSNP
rs749900419 24 dbSNP
rs541476404 27 dbSNP
rs1232376398 30 dbSNP
rs780406252 31 dbSNP
rs1178246922 38 dbSNP
rs932517594 40 dbSNP
rs1046560 42 dbSNP
rs1455171892 44 dbSNP
rs1157855549 46 dbSNP
rs779108519 50 dbSNP
rs1201000522 61 dbSNP
rs1364271979 61 dbSNP
rs983687778 69 dbSNP
rs1461338953 70 dbSNP
rs1009423738 72 dbSNP
rs1464652242 72 dbSNP
rs1379848970 75 dbSNP
rs907555469 79 dbSNP
rs1021107005 85 dbSNP
rs1246577799 85 dbSNP
rs773297580 87 dbSNP
rs949725500 95 dbSNP
rs981225913 98 dbSNP
rs903643638 100 dbSNP
rs1342340492 103 dbSNP
rs143206307 110 dbSNP
rs1234952464 111 dbSNP
rs1033342766 113 dbSNP
rs1367774082 114 dbSNP
rs1389020332 121 dbSNP
rs1437488359 124 dbSNP
rs924483250 126 dbSNP
rs1294119648 130 dbSNP
rs991667512 131 dbSNP
rs937177959 137 dbSNP
rs1326177769 144 dbSNP
rs1429705488 147 dbSNP
rs867007805 155 dbSNP
rs543635316 156 dbSNP
rs1388655300 160 dbSNP
rs1170846748 162 dbSNP
rs1024572801 163 dbSNP
rs1219584053 167 dbSNP
rs1280513249 168 dbSNP
rs1186468120 169 dbSNP
rs1054256281 171 dbSNP
rs563611902 173 dbSNP
rs1332873255 180 dbSNP
rs568625842 192 dbSNP
rs945995933 199 dbSNP
rs111892073 202 dbSNP
rs982993778 203 dbSNP
rs908613350 206 dbSNP
rs902532413 209 dbSNP
rs548715833 211 dbSNP
rs941466437 214 dbSNP
rs1009286414 215 dbSNP
rs559258427 218 dbSNP
rs921231392 223 dbSNP
rs900550323 225 dbSNP
rs1409338192 231 dbSNP
rs932654944 233 dbSNP
rs1051432121 241 dbSNP
rs1390487632 243 dbSNP
rs1162213577 244 dbSNP
rs996262390 245 dbSNP
rs1474018101 255 dbSNP
rs528174354 256 dbSNP
rs1042256045 262 dbSNP
rs952170165 264 dbSNP
rs1206612060 269 dbSNP
rs903607997 271 dbSNP
rs1288917887 274 dbSNP
rs551106709 276 dbSNP
rs1208235442 291 dbSNP
rs983720367 294 dbSNP
rs1015561308 302 dbSNP
rs1000529446 304 dbSNP
rs1227854321 308 dbSNP
rs143844000 308 dbSNP
rs534402324 308 dbSNP
rs543148031 308 dbSNP
rs1286640631 313 dbSNP
rs894785004 313 dbSNP
rs1349625224 315 dbSNP
rs1384808169 316 dbSNP
rs1401155731 318 dbSNP
rs1280419736 319 dbSNP
rs1354034029 323 dbSNP
rs1202824194 328 dbSNP
rs1409134207 330 dbSNP
rs1313770513 331 dbSNP
rs1409176468 332 dbSNP
rs1046561 333 dbSNP
rs1246102235 333 dbSNP
rs1323550708 334 dbSNP
rs1236924527 336 dbSNP
rs1260243891 338 dbSNP
rs1487889823 341 dbSNP
rs1217333535 343 dbSNP
rs1196438206 344 dbSNP
rs1265043396 344 dbSNP
rs1013270373 347 dbSNP
rs1484595849 352 dbSNP
rs1208355780 356 dbSNP
rs138536096 357 dbSNP
rs1414015225 358 dbSNP
rs1224780739 359 dbSNP
rs1425207223 368 dbSNP
rs971094273 382 dbSNP
rs1156240756 385 dbSNP
rs185299499 388 dbSNP
rs981474126 392 dbSNP
rs1273624686 403 dbSNP
rs374576318 404 dbSNP
rs1362710871 407 dbSNP
rs34131242 407 dbSNP
rs1420837016 410 dbSNP
rs1300656404 417 dbSNP
rs1326096893 422 dbSNP
rs1374007996 424 dbSNP
rs1385743584 430 dbSNP
rs1160627336 436 dbSNP
rs1024959279 442 dbSNP
rs1424362474 446 dbSNP
rs188172008 453 dbSNP
rs1462629141 462 dbSNP
rs572871638 463 dbSNP
rs989845810 464 dbSNP
rs971701251 468 dbSNP
rs1463731836 471 dbSNP
rs1354573948 475 dbSNP
rs1004787800 482 dbSNP
rs1311748458 485 dbSNP
rs1240756355 487 dbSNP
rs146779563 492 dbSNP
rs751424700 502 dbSNP
rs1345677743 504 dbSNP
rs1209098401 510 dbSNP
rs1237850231 530 dbSNP
rs962879913 533 dbSNP
rs974125881 534 dbSNP
rs1362540223 541 dbSNP
rs945860482 545 dbSNP
rs954012411 550 dbSNP
rs986850299 553 dbSNP
rs1358082949 559 dbSNP
rs1332031304 564 dbSNP
rs1436542145 572 dbSNP
rs1439828532 574 dbSNP
rs1395407898 578 dbSNP
rs549939790 587 dbSNP
rs1160945020 589 dbSNP
rs1167708839 589 dbSNP
rs759314956 591 dbSNP
rs1289128502 598 dbSNP
rs139935493 602 dbSNP
rs1187387202 604 dbSNP
rs1177171134 610 dbSNP
rs945350428 612 dbSNP
rs1042697054 617 dbSNP
rs1440270921 619 dbSNP
rs1486271209 623 dbSNP
rs944728742 624 dbSNP
rs1297866165 638 dbSNP
rs925080885 639 dbSNP
rs1040818710 643 dbSNP
rs536111709 653 dbSNP
rs767243172 663 dbSNP
rs1449029998 666 dbSNP
rs936521008 667 dbSNP
rs192747351 674 dbSNP
rs1290931548 677 dbSNP
rs1368621830 677 dbSNP
rs996283177 681 dbSNP
rs1416145825 683 dbSNP
rs572359788 684 dbSNP
rs1307419691 693 dbSNP
rs1279060184 704 dbSNP
rs1427568412 707 dbSNP
rs887956633 709 dbSNP
rs1313799346 710 dbSNP
rs1005425290 714 dbSNP
rs1411956202 715 dbSNP
rs1190117466 716 dbSNP
rs1013656464 719 dbSNP
rs545876059 720 dbSNP
rs1475614707 723 dbSNP
rs752297363 724 dbSNP
rs1201980603 728 dbSNP
rs755752964 734 dbSNP
rs183507323 756 dbSNP
rs1046104961 759 dbSNP
rs1457961754 760 dbSNP
rs1252284798 769 dbSNP
rs1179920563 774 dbSNP
rs558325924 776 dbSNP
rs1291103031 795 dbSNP
rs188169139 804 dbSNP
rs1355607278 806 dbSNP
rs1192342255 816 dbSNP
rs1287583524 818 dbSNP
rs1427670319 821 dbSNP
rs1408609456 822 dbSNP
rs6047890 832 dbSNP
rs1034459530 838 dbSNP
rs142800891 845 dbSNP
rs1015867694 847 dbSNP
rs1180597999 850 dbSNP
rs563459869 850 dbSNP
rs962849559 856 dbSNP
rs73572500 858 dbSNP
rs1487750422 861 dbSNP
rs1215191330 862 dbSNP
rs1323894020 875 dbSNP
rs1334847899 877 dbSNP
rs1266975987 889 dbSNP
rs1393921426 895 dbSNP
rs1236312560 899 dbSNP
rs1307699556 903 dbSNP
rs1028399989 906 dbSNP
rs1368526735 924 dbSNP
rs914295112 930 dbSNP
rs967193835 950 dbSNP
rs1441953700 955 dbSNP
rs1387934262 957 dbSNP
rs752955443 961 dbSNP
rs542858627 972 dbSNP
rs1212547731 977 dbSNP
rs1277358395 983 dbSNP
rs756526310 985 dbSNP
rs1431747223 986 dbSNP
rs912524662 995 dbSNP
rs538374451 996 dbSNP
rs978004424 997 dbSNP
rs1247071624 998 dbSNP
rs528128129 1006 dbSNP
rs115623645 1008 dbSNP
rs1261179104 1010 dbSNP
rs1039603111 1017 dbSNP
rs564666167 1021 dbSNP
rs921943855 1023 dbSNP
rs1424790301 1024 dbSNP
rs931939898 1029 dbSNP
rs1316589514 1032 dbSNP
rs1383987304 1033 dbSNP
rs1385786311 1034 dbSNP
rs916321795 1038 dbSNP
rs949125591 1039 dbSNP
rs1049180704 1040 dbSNP
rs530493281 1054 dbSNP
rs1449311475 1068 dbSNP
rs753365032 1073 dbSNP
rs1190594843 1079 dbSNP
rs1004975429 1083 dbSNP
rs758866968 1085 dbSNP
rs907355778 1091 dbSNP
rs184674478 1101 dbSNP
rs1034540277 1106 dbSNP
rs958379381 1110 dbSNP
rs1011164846 1124 dbSNP
rs995668330 1136 dbSNP
rs1341275925 1137 dbSNP
rs1028537200 1151 dbSNP
rs570191338 1152 dbSNP
rs1021333613 1159 dbSNP
rs529564186 1161 dbSNP
rs889952246 1162 dbSNP
rs1312125972 1165 dbSNP
rs1220060472 1172 dbSNP
rs967564718 1179 dbSNP
rs1377791691 1186 dbSNP
rs977193242 1187 dbSNP
rs1314083575 1193 dbSNP
rs1429447196 1194 dbSNP
rs1394788334 1211 dbSNP
rs150607885 1213 dbSNP
rs1476200430 1215 dbSNP
rs1373338833 1216 dbSNP
rs566236348 1220 dbSNP
rs975756886 1224 dbSNP
rs921144601 1225 dbSNP
rs931979308 1228 dbSNP
rs14181 1230 dbSNP
rs190528845 1233 dbSNP
rs1032206421 1245 dbSNP
rs957981806 1246 dbSNP
rs990700758 1255 dbSNP
rs558164311 1259 dbSNP
rs769152727 1276 dbSNP
rs1231513528 1283 dbSNP
rs940795360 1284 dbSNP
rs1216603329 1289 dbSNP
rs1294370816 1295 dbSNP
rs1409776044 1306 dbSNP
rs775264314 1308 dbSNP
rs34756351 1323 dbSNP
rs1331262312 1337 dbSNP
rs1264329277 1339 dbSNP
rs1396766746 1342 dbSNP
rs1489504830 1342 dbSNP
rs374936391 1342 dbSNP
rs571794160 1346 dbSNP
rs1163838250 1349 dbSNP
rs1186040442 1350 dbSNP
rs1419401395 1350 dbSNP
rs1036436171 1351 dbSNP
rs115121514 1352 dbSNP
rs1473262086 1361 dbSNP
rs181752957 1366 dbSNP
rs2031 1368 dbSNP
rs757993576 1370 dbSNP
rs75572491 1374 dbSNP
rs1037407286 1378 dbSNP
rs894694975 1379 dbSNP
rs542446075 1385 dbSNP
rs1011774706 1390 dbSNP
rs1273910585 1394 dbSNP
rs931511612 1395 dbSNP
rs553265754 1401 dbSNP
rs1158036838 1408 dbSNP
rs902828275 1411 dbSNP
rs1050011332 1417 dbSNP
rs999026413 1420 dbSNP
rs1324728012 1421 dbSNP
rs1019338261 1422 dbSNP
rs371945893 1428 dbSNP
rs965592484 1433 dbSNP
rs1395972120 1437 dbSNP
rs1164982728 1443 dbSNP
rs1399658220 1445 dbSNP
rs748344908 1450 dbSNP
rs889930321 1451 dbSNP
rs1394284507 1454 dbSNP
rs975211740 1455 dbSNP
rs1191926380 1462 dbSNP
rs139209694 1474 dbSNP
rs1019677136 1476 dbSNP
rs1445411814 1480 dbSNP
rs149967120 1485 dbSNP
rs1224834791 1487 dbSNP
rs1344709383 1491 dbSNP
rs984020819 1499 dbSNP
rs909242076 1512 dbSNP
rs1326252176 1515 dbSNP
rs940673724 1516 dbSNP
rs958040446 1519 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acgaacgacgGAGAGGGGAGGGu 5'
                    || ||||||||| 
Target 5' ----------CU-UCCCCUCCCu 3'
 		1 - 12
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acgaacgacgGAG-AGGGGAGGGu 5'
                    ||| ||||||||| 
Target 5' ----------CUCUUCCCCUCCCu 3'
 		1 - 14
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000382352.3 | 3UTR | CUUCCCCUCCCUCAUUUAAUUUGCUGCUUUUAAUCUACGUGGUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000382352.3 | 3UTR | CUCUUCCCCUCCCUCAUUUAAUUUGCUGCUUUUAAUCUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
612 hsa-miR-4728-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT083283 ZCCHC3 zinc finger CCHC-type containing 3 2 4
MIRT112203 BTG2 BTG anti-proliferation factor 2 2 2
MIRT115286 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT115527 MAZ MYC associated zinc finger protein 2 2
MIRT119866 NRBP1 nuclear receptor binding protein 1 2 2
MIRT131979 IER5 immediate early response 5 2 4
MIRT149428 CARM1 coactivator associated arginine methyltransferase 1 2 2
MIRT160081 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT177169 ARL5B ADP ribosylation factor like GTPase 5B 2 4
MIRT260103 KLHL21 kelch like family member 21 2 2
MIRT260351 XRCC6 X-ray repair cross complementing 6 2 6
MIRT266417 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT294650 ZNF548 zinc finger protein 548 2 2
MIRT339335 SESN2 sestrin 2 2 2
MIRT386434 CCL22 C-C motif chemokine ligand 22 2 4
MIRT441468 BEST3 bestrophin 3 2 2
MIRT442283 CCDC108 cilia and flagella associated protein 65 2 4
MIRT446756 ZNF491 zinc finger protein 491 2 2
MIRT449229 RAD51B RAD51 paralog B 2 2
MIRT451011 MYH14 myosin heavy chain 14 2 8
MIRT451099 ZNF584 zinc finger protein 584 2 2
MIRT451412 TJP3 tight junction protein 3 2 4
MIRT451566 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451742 CES3 carboxylesterase 3 2 2
MIRT451949 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452324 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT452417 QDPR quinoid dihydropteridine reductase 2 2
MIRT452569 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452863 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452928 DISC1 disrupted in schizophrenia 1 2 2
MIRT453054 TANGO2 transport and golgi organization 2 homolog 2 4
MIRT453104 HOXC4 homeobox C4 2 2
MIRT453243 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453302 ZNF394 zinc finger protein 394 2 2
MIRT453335 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT453545 PRR12 proline rich 12 2 2
MIRT453600 ZNF557 zinc finger protein 557 2 2
MIRT453801 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT453993 CECR1 adenosine deaminase 2 2 2
MIRT454090 TMEM209 transmembrane protein 209 2 2
MIRT454212 HLA-A major histocompatibility complex, class I, A 2 2
MIRT454293 ZNF134 zinc finger protein 134 2 2
MIRT454456 PPP2R2B protein phosphatase 2 regulatory subunit Bbeta 2 2
MIRT454475 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT454661 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454789 STOML3 stomatin like 3 2 2
MIRT455125 TBC1D25 TBC1 domain family member 25 2 2
MIRT455314 TTLL9 tubulin tyrosine ligase like 9 2 2
MIRT456123 SAMD10 sterile alpha motif domain containing 10 2 2
MIRT456152 TTF2 transcription termination factor 2 2 2
MIRT456304 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 2 2
MIRT456475 SERAC1 serine active site containing 1 2 2
MIRT456558 TOMM20 translocase of outer mitochondrial membrane 20 2 2
MIRT456724 TMEM239 transmembrane protein 239 2 4
MIRT457390 CAMK2A calcium/calmodulin dependent protein kinase II alpha 2 2
MIRT457427 NOL10 nucleolar protein 10 2 2
MIRT457492 SLC35F6 solute carrier family 35 member F6 2 2
MIRT458004 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458136 TLCD2 TLC domain containing 2 2 2
MIRT458596 KCTD2 potassium channel tetramerization domain containing 2 2 2
MIRT459031 ZNF490 zinc finger protein 490 2 4
MIRT459124 FADS6 fatty acid desaturase 6 2 2
MIRT459322 HAVCR2 hepatitis A virus cellular receptor 2 2 2
MIRT459393 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT459421 FAM83B family with sequence similarity 83 member B 2 2
MIRT459498 TACR3 tachykinin receptor 3 2 2
MIRT459566 NLGN2 neuroligin 2 2 2
MIRT459605 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT459667 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459917 HHIP hedgehog interacting protein 2 4
MIRT459983 RFT1 RFT1 homolog 2 2
MIRT460487 FAM105A family with sequence similarity 105 member A 2 6
MIRT460611 FEM1A fem-1 homolog A 2 2
MIRT460650 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460679 RNF157 ring finger protein 157 2 2
MIRT460711 FN3KRP fructosamine 3 kinase related protein 2 2
MIRT460880 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT460927 NOA1 nitric oxide associated 1 2 4
MIRT461080 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461597 DPH2 DPH2 homolog 2 2
MIRT461861 ZNF317 zinc finger protein 317 2 2
MIRT462185 ACADL acyl-CoA dehydrogenase, long chain 2 2
MIRT462452 GCDH glutaryl-CoA dehydrogenase 2 2
MIRT462994 ZNF740 zinc finger protein 740 2 2
MIRT463327 ZFHX3 zinc finger homeobox 3 2 2
MIRT463859 WNT7B Wnt family member 7B 2 2
MIRT464061 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT464318 UST uronyl 2-sulfotransferase 2 2
MIRT464823 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT465409 TP53 tumor protein p53 2 2
MIRT466082 TMEM184C transmembrane protein 184C 2 2
MIRT466525 TBXA2R thromboxane A2 receptor 2 2
MIRT467079 SRRD SRR1 domain containing 2 2
MIRT467153 SREBF2 sterol regulatory element binding transcription factor 2 2 2
MIRT468101 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT468289 SFT2D2 SFT2 domain containing 2 2 4
MIRT468763 SCD stearoyl-CoA desaturase 2 2
MIRT468915 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469161 RNF111 ring finger protein 111 2 2
MIRT469211 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT469748 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT470597 POTEM POTE ankyrin domain family member M 2 2
MIRT470627 POTEG POTE ankyrin domain family member G 2 2
MIRT470772 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT470883 PLXND1 plexin D1 2 2
MIRT470984 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471224 PHAX phosphorylated adaptor for RNA export 2 2
MIRT471254 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471304 PGAM4 phosphoglycerate mutase family member 4 2 2
MIRT471473 PDE7B phosphodiesterase 7B 2 2
MIRT471772 NUP43 nucleoporin 43 2 4
MIRT472062 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT472177 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472220 NGFR nerve growth factor receptor 2 2
MIRT472293 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT473073 MORN4 MORN repeat containing 4 2 2
MIRT473094 MLXIP MLX interacting protein 2 2
MIRT473202 MINK1 misshapen like kinase 1 2 2
MIRT473496 MBD6 methyl-CpG binding domain protein 6 2 2
MIRT473546 MAVS mitochondrial antiviral signaling protein 2 2
MIRT473573 MAT2A methionine adenosyltransferase 2A 2 6
MIRT473632 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT473999 LRRC20 leucine rich repeat containing 20 2 2
MIRT474841 KHSRP KH-type splicing regulatory protein 2 4
MIRT474998 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT475135 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475581 HMGXB4 HMG-box containing 4 2 2
MIRT477305 EPHB2 EPH receptor B2 2 2
MIRT477377 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT477950 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478291 DDX19A DEAD-box helicase 19A 2 4
MIRT478477 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT478593 CTDSP2 CTD small phosphatase 2 2 3
MIRT478629 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT478842 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT479014 COL5A1 collagen type V alpha 1 chain 2 2
MIRT479119 CNBP CCHC-type zinc finger nucleic acid binding protein 2 4
MIRT479172 CLSPN claspin 2 2
MIRT480147 CALR calreticulin 2 2
MIRT481401 ASXL1 additional sex combs like 1, transcriptional regulator 2 2
MIRT482023 AMER1 APC membrane recruitment protein 1 2 2
MIRT482147 AK2 adenylate kinase 2 2 2
MIRT482353 AGO2 argonaute 2, RISC catalytic component 2 12
MIRT482645 FAM195B MAPK regulated corepressor interacting protein 1 2 4
MIRT482812 TRAF6 TNF receptor associated factor 6 2 2
MIRT483331 CHRDL1 chordin like 1 2 8
MIRT483623 NAV2 neuron navigator 2 2 2
MIRT483657 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT483702 ASPH aspartate beta-hydroxylase 2 2
MIRT483808 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 6
MIRT483860 EMID1 EMI domain containing 1 2 2
MIRT483931 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484198 SUMO1 small ubiquitin-like modifier 1 2 4
MIRT484280 AIP aryl hydrocarbon receptor interacting protein 2 4
MIRT484356 GATA6 GATA binding protein 6 2 10
MIRT484417 SNX19 sorting nexin 19 2 2
MIRT484430 RAB7A RAB7A, member RAS oncogene family 2 4
MIRT484575 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT484844 ZNF70 zinc finger protein 70 2 6
MIRT485268 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT485927 PGPEP1 pyroglutamyl-peptidase I 2 6
MIRT485991 YIPF2 Yip1 domain family member 2 2 2
MIRT486092 SLC7A5 solute carrier family 7 member 5 2 4
MIRT486114 INO80E INO80 complex subunit E 2 2
MIRT486310 SIPA1 signal-induced proliferation-associated 1 2 2
MIRT486376 TIGD5 tigger transposable element derived 5 2 2
MIRT486434 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 2 2
MIRT486723 MGAT5B mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B 2 4
MIRT486790 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT486890 TSPYL4 TSPY like 4 2 4
MIRT487040 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487130 NCOR2 nuclear receptor corepressor 2 2 2
MIRT487156 LINGO3 leucine rich repeat and Ig domain containing 3 2 2
MIRT487228 CBS cystathionine-beta-synthase 2 4
MIRT487332 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487414 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487551 TM6SF2 transmembrane 6 superfamily member 2 2 4
MIRT487580 FAM83H family with sequence similarity 83 member H 2 4
MIRT487609 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487681 B3GALT5 beta-1,3-galactosyltransferase 5 2 4
MIRT487692 CDK14 cyclin dependent kinase 14 2 2
MIRT487832 CLSTN1 calsyntenin 1 2 6
MIRT487875 CASZ1 castor zinc finger 1 2 4
MIRT487899 CST9 cystatin 9 2 2
MIRT487950 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT488094 DLGAP3 DLG associated protein 3 2 4
MIRT488188 MAT1A methionine adenosyltransferase 1A 2 2
MIRT488235 DNLZ DNL-type zinc finger 2 2
MIRT488279 PARS2 prolyl-tRNA synthetase 2, mitochondrial 2 2
MIRT488410 NKX6-2 NK6 homeobox 2 2 4
MIRT488533 GPATCH3 G-patch domain containing 3 2 2
MIRT488686 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT489040 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT489052 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT489116 PPFIA3 PTPRF interacting protein alpha 3 2 3
MIRT489170 ANKRD45 ankyrin repeat domain 45 2 4
MIRT489225 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489257 TTLL1 tubulin tyrosine ligase like 1 2 4
MIRT489283 RBM8A RNA binding motif protein 8A 2 8
MIRT489358 SYNGR1 synaptogyrin 1 2 4
MIRT489375 RAB11B RAB11B, member RAS oncogene family 2 6
MIRT489473 SLITRK5 SLIT and NTRK like family member 5 2 2
MIRT489505 CRLF3 cytokine receptor like factor 3 2 4
MIRT489574 SSBP2 single stranded DNA binding protein 2 2 2
MIRT489697 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT489849 ATP2A3 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 2 2
MIRT490074 PRRT2 proline rich transmembrane protein 2 2 4
MIRT490177 TMEM63C transmembrane protein 63C 2 2
MIRT490204 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490277 ZNF562 zinc finger protein 562 2 4
MIRT490286 ISL2 ISL LIM homeobox 2 2 2
MIRT490300 HOXB13 homeobox B13 2 2
MIRT490607 SLC47A1 solute carrier family 47 member 1 2 4
MIRT490679 SSTR1 somatostatin receptor 1 2 2
MIRT490751 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT490914 STRN4 striatin 4 2 2
MIRT491042 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT491092 MSI1 musashi RNA binding protein 1 2 4
MIRT491125 PTPRE protein tyrosine phosphatase, receptor type E 2 2
MIRT491206 MLLT1 MLLT1, super elongation complex subunit 2 6
MIRT491227 KCNA5 potassium voltage-gated channel subfamily A member 5 2 2
MIRT491265 DHX40 DEAH-box helicase 40 2 2
MIRT491392 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT491403 C1D C1D nuclear receptor corepressor 2 2
MIRT491511 CREBL2 cAMP responsive element binding protein like 2 2 2
MIRT491553 YAE1D1 Yae1 domain containing 1 2 2
MIRT491684 MNT MAX network transcriptional repressor 2 4
MIRT491733 SEMA3F semaphorin 3F 2 2
MIRT491817 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT491942 VPS52 VPS52, GARP complex subunit 2 2
MIRT492156 STK11 serine/threonine kinase 11 2 4
MIRT492474 RASD1 ras related dexamethasone induced 1 2 4
MIRT492531 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT492562 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 4
MIRT492684 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT492728 PHF12 PHD finger protein 12 2 2
MIRT492841 NRGN neurogranin 2 2
MIRT492877 NFIX nuclear factor I X 2 4
MIRT492907 NFIC nuclear factor I C 2 2
MIRT492934 NEUROD2 neuronal differentiation 2 2 2
MIRT493221 MEX3A mex-3 RNA binding family member A 2 2
MIRT493450 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493672 HAP1 huntingtin associated protein 1 2 2
MIRT493875 FAM73B mitoguardin 2 2 4
MIRT494031 DUSP7 dual specificity phosphatase 7 2 4
MIRT494171 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT494366 SOLH calpain 15 1 1
MIRT494466 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT494506 BDNF-AS BDNF antisense RNA 2 2
MIRT494621 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT494660 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT494697 ARHGAP31 Rho GTPase activating protein 31 2 2
MIRT494791 ANKRD13B ankyrin repeat domain 13B 2 4
MIRT494940 IFFO2 intermediate filament family orphan 2 2 2
MIRT496591 TAGLN transgelin 2 2
MIRT497041 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT498592 KRT8 keratin 8 2 2
MIRT498730 SNTN sentan, cilia apical structure protein 2 6
MIRT499389 PLCG2 phospholipase C gamma 2 2 4
MIRT499798 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT499987 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500446 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT501888 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 4
MIRT503422 SLC25A45 solute carrier family 25 member 45 2 6
MIRT507784 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT508894 METTL14 methyltransferase like 14 2 2
MIRT509631 RRP7A ribosomal RNA processing 7 homolog A 2 4
MIRT510111 IRAK3 interleukin 1 receptor associated kinase 3 2 8
MIRT510143 PDGFRA platelet derived growth factor receptor alpha 2 4
MIRT510628 TMEM167A transmembrane protein 167A 2 4
MIRT511025 NRF1 nuclear respiratory factor 1 2 2
MIRT512365 CPM carboxypeptidase M 2 4
MIRT512904 UBL4A ubiquitin like 4A 2 2
MIRT514349 DNAH17 dynein axonemal heavy chain 17 2 4
MIRT515021 SUMF2 sulfatase modifying factor 2 2 2
MIRT515254 DUSP28 dual specificity phosphatase 28 2 2
MIRT516212 RPP30 ribonuclease P/MRP subunit p30 2 2
MIRT516674 ZNF860 zinc finger protein 860 2 4
MIRT518382 ZNF250 zinc finger protein 250 2 2
MIRT518942 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT519913 ZFAND4 zinc finger AN1-type containing 4 2 2
MIRT519952 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT520328 UBXN2A UBX domain protein 2A 2 2
MIRT520617 TMEM41B transmembrane protein 41B 2 2
MIRT520670 TMEM11 transmembrane protein 11 2 2
MIRT520860 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT521450 RAD51 RAD51 recombinase 2 2
MIRT522338 NCKIPSD NCK interacting protein with SH3 domain 2 8
MIRT523488 GNG4 G protein subunit gamma 4 2 2
MIRT523680 FOPNL FGFR1OP N-terminal like 2 2
MIRT523724 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523876 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 4
MIRT524057 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT524179 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524936 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT526837 PHC1 polyhomeotic homolog 1 2 2
MIRT527088 VSTM5 V-set and transmembrane domain containing 5 2 2
MIRT540687 BMP3 bone morphogenetic protein 3 2 2
MIRT541761 KLF8 Kruppel like factor 8 2 2
MIRT544292 TSPYL1 TSPY like 1 2 2
MIRT549412 ADAR adenosine deaminase, RNA specific 2 2
MIRT553369 TRIM44 tripartite motif containing 44 2 2
MIRT561757 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT562829 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT562909 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT564459 SLC35E2 solute carrier family 35 member E2 2 4
MIRT568901 ATP6V1B1 ATPase H+ transporting V1 subunit B1 2 2
MIRT569120 ONECUT3 one cut homeobox 3 2 2
MIRT569232 SUSD1 sushi domain containing 1 2 2
MIRT569724 GPR173 G protein-coupled receptor 173 2 2
MIRT569762 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT569858 KRT80 keratin 80 2 2
MIRT570283 ARPC3 actin related protein 2/3 complex subunit 3 2 2
MIRT570476 THRA thyroid hormone receptor, alpha 2 2
MIRT570854 GPRC5C G protein-coupled receptor class C group 5 member C 2 2
MIRT571198 C9orf62 chromosome 9 open reading frame 62 2 2
MIRT571322 TPCN2 two pore segment channel 2 2 2
MIRT572083 EXOC8 exocyst complex component 8 2 2
MIRT572126 DNAJC24 DnaJ heat shock protein family (Hsp40) member C24 2 2
MIRT573004 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT573491 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT573659 HES6 hes family bHLH transcription factor 6 2 2
MIRT574351 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT576453 Itga11 integrin alpha 11 2 3
MIRT608047 UBLCP1 ubiquitin like domain containing CTD phosphatase 1 2 2
MIRT608252 ITGA11 integrin subunit alpha 11 2 3
MIRT613668 KIAA1210 KIAA1210 2 2
MIRT615642 ATF6 activating transcription factor 6 2 2
MIRT618581 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT618869 MBL2 mannose binding lectin 2 2 2
MIRT618969 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT619119 CD40LG CD40 ligand 2 2
MIRT619180 SLC16A4 solute carrier family 16 member 4 2 2
MIRT620306 AQP6 aquaporin 6 2 2
MIRT620691 RFTN2 raftlin family member 2 2 2
MIRT621646 UBXN2B UBX domain protein 2B 2 2
MIRT622004 STK4 serine/threonine kinase 4 2 2
MIRT622429 NUDT19 nudix hydrolase 19 2 2
MIRT622580 PRRG4 proline rich and Gla domain 4 2 2
MIRT622811 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 4
MIRT624793 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT624975 ZNF665 zinc finger protein 665 2 4
MIRT625486 SMAD9 SMAD family member 9 2 2
MIRT626604 ACAA2 acetyl-CoA acyltransferase 2 2 2
MIRT626716 TRIM65 tripartite motif containing 65 2 2
MIRT626982 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT627494 STRIP2 striatin interacting protein 2 2 2
MIRT628511 ZNF878 zinc finger protein 878 2 2
MIRT628541 ZNF701 zinc finger protein 701 2 2
MIRT628598 TMEM251 transmembrane protein 251 2 2
MIRT628825 SLC25A34 solute carrier family 25 member 34 2 2
MIRT628904 IGSF6 immunoglobulin superfamily member 6 2 2
MIRT628966 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 2
MIRT629016 OSBPL10 oxysterol binding protein like 10 2 2
MIRT629067 KIF1C kinesin family member 1C 2 2
MIRT629197 PAPOLA poly(A) polymerase alpha 2 2
MIRT629353 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT629455 WIZ widely interspaced zinc finger motifs 2 2
MIRT629703 XKR4 XK related 4 2 2
MIRT629745 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT629904 SPATA5 spermatogenesis associated 5 2 2
MIRT629961 GLP2R glucagon like peptide 2 receptor 2 2
MIRT630031 MTL5 testis expressed metallothionein like protein 2 2
MIRT630397 MYH9 myosin heavy chain 9 2 4
MIRT631140 SYNJ2 synaptojanin 2 2 2
MIRT631391 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT631566 TRAF3IP2 TRAF3 interacting protein 2 2 2
MIRT631623 PCDHB11 protocadherin beta 11 2 2
MIRT631942 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 4
MIRT632453 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT632695 MTMR10 myotubularin related protein 10 2 2
MIRT632748 MED28 mediator complex subunit 28 2 2
MIRT632838 IGF1 insulin like growth factor 1 2 2
MIRT632917 FRRS1 ferric chelate reductase 1 2 2
MIRT633037 DNAL1 dynein axonemal light chain 1 2 2
MIRT633388 FBXW8 F-box and WD repeat domain containing 8 2 2
MIRT633448 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633871 ATP6V1A ATPase H+ transporting V1 subunit A 2 2
MIRT633916 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT633958 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT634050 NUP155 nucleoporin 155 2 2
MIRT634274 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634381 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT634443 PDE7A phosphodiesterase 7A 2 2
MIRT634580 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 4
MIRT634704 DSEL dermatan sulfate epimerase-like 2 2
MIRT634776 CD3D CD3d molecule 2 2
MIRT635032 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT636078 ZNF280C zinc finger protein 280C 2 2
MIRT636708 ARSK arylsulfatase family member K 2 2
MIRT637447 ZNF324B zinc finger protein 324B 2 2
MIRT637590 PLD6 phospholipase D family member 6 2 2
MIRT637679 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 2 2
MIRT637893 SLC19A3 solute carrier family 19 member 3 2 4
MIRT638362 RBMS2 RNA binding motif single stranded interacting protein 2 2 4
MIRT638604 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT638831 CRTAP cartilage associated protein 2 2
MIRT638885 CEP97 centrosomal protein 97 2 4
MIRT639663 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT645001 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT645067 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 2 2
MIRT646957 UPK3BL uroplakin 3B like 1 2 2
MIRT648307 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 4
MIRT649051 SLC1A2 solute carrier family 1 member 2 2 2
MIRT649893 SLFN12L schlafen family member 12 like 2 2
MIRT650204 DOCK7 dedicator of cytokinesis 7 2 2
MIRT652054 TTC39B tetratricopeptide repeat domain 39B 2 2
MIRT654797 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT655930 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT655978 NAV1 neuron navigator 1 2 2
MIRT657721 GPC4 glypican 4 2 2
MIRT659309 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT659851 CAPZB capping actin protein of muscle Z-line beta subunit 2 2
MIRT661483 CHMP1B charged multivesicular body protein 1B 2 2
MIRT661914 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT661981 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 4
MIRT662074 ZNF284 zinc finger protein 284 2 2
MIRT662500 ANGPT4 angiopoietin 4 2 2
MIRT662669 LRRC47 leucine rich repeat containing 47 2 2
MIRT663174 FGFR1OP FGFR1 oncogene partner 2 2
MIRT663385 ZNF770 zinc finger protein 770 2 4
MIRT664000 WDR75 WD repeat domain 75 2 2
MIRT664167 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT664497 POLR3K RNA polymerase III subunit K 2 2
MIRT665065 CCDC77 coiled-coil domain containing 77 2 2
MIRT665088 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT665725 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT665930 TBC1D19 TBC1 domain family member 19 2 4
MIRT666097 SSR1 signal sequence receptor subunit 1 2 2
MIRT666850 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT667390 MOB1B MOB kinase activator 1B 2 2
MIRT667583 LONRF2 LON peptidase N-terminal domain and ring finger 2 2 2
MIRT667904 ING1 inhibitor of growth family member 1 2 2
MIRT667985 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT668205 GCNT4 glucosaminyl (N-acetyl) transferase 4, core 2 2 2
MIRT668286 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT668393 FAT3 FAT atypical cadherin 3 2 2
MIRT668450 FAM208A family with sequence similarity 208 member A 2 2
MIRT669005 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT669459 ATL3 atlastin GTPase 3 2 2
MIRT669667 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT669897 KIAA0754 KIAA0754 2 4
MIRT669983 SSR3 signal sequence receptor subunit 3 2 2
MIRT670160 SLC29A4 solute carrier family 29 member 4 2 2
MIRT670245 TRIM13 tripartite motif containing 13 2 2
MIRT670282 CBY3 chibby family member 3 2 2
MIRT670363 ULBP3 UL16 binding protein 3 2 4
MIRT670635 BVES blood vessel epicardial substance 2 2
MIRT670739 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670778 TRIM66 tripartite motif containing 66 2 2
MIRT670921 DESI1 desumoylating isopeptidase 1 2 2
MIRT671374 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT671406 ERCC6L2 ERCC excision repair 6 like 2 2 2
MIRT671436 TOX4 TOX high mobility group box family member 4 2 2
MIRT671661 TRUB2 TruB pseudouridine synthase family member 2 2 4
MIRT671718 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT672043 SMTNL2 smoothelin like 2 2 2
MIRT672145 PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 2 2
MIRT672406 SLC10A6 solute carrier family 10 member 6 2 2
MIRT672513 GGCX gamma-glutamyl carboxylase 2 2
MIRT672580 RNF24 ring finger protein 24 2 2
MIRT673207 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT673380 ZNF124 zinc finger protein 124 2 2
MIRT673503 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT673861 CAPN7 calpain 7 2 2
MIRT673935 ZNF500 zinc finger protein 500 2 2
MIRT673990 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT674090 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT674132 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT674306 THAP5 THAP domain containing 5 2 2
MIRT674378 POLR3D RNA polymerase III subunit D 2 2
MIRT674650 NKRF NFKB repressing factor 2 2
MIRT674671 PLCE1 phospholipase C epsilon 1 2 2
MIRT674733 ZNF451 zinc finger protein 451 2 4
MIRT674787 NPR1 natriuretic peptide receptor 1 2 2
MIRT674901 RASSF9 Ras association domain family member 9 2 2
MIRT675025 SNX1 sorting nexin 1 2 2
MIRT675350 KLHL26 kelch like family member 26 2 2
MIRT675424 CLEC7A C-type lectin domain containing 7A 2 2
MIRT675505 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT675745 AHR aryl hydrocarbon receptor 2 2
MIRT675869 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT675999 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT676221 TMEM91 transmembrane protein 91 2 2
MIRT677307 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT677838 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT677876 ABI2 abl interactor 2 2 2
MIRT677974 ITGB3 integrin subunit beta 3 2 2
MIRT678184 CRCP CGRP receptor component 2 2
MIRT678282 PTRH2 peptidyl-tRNA hydrolase 2 2 2
MIRT679469 RHOF ras homolog family member F, filopodia associated 2 2
MIRT679521 RAB36 RAB36, member RAS oncogene family 2 2
MIRT679921 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 2 2
MIRT680038 OSBPL2 oxysterol binding protein like 2 2 4
MIRT680254 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 2 2
MIRT680287 AKIP1 A-kinase interacting protein 1 2 2
MIRT680507 PRIM2 DNA primase subunit 2 2 2
MIRT680637 KIAA1456 KIAA1456 2 2
MIRT680827 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT680879 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT681006 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT681128 INTS7 integrator complex subunit 7 2 2
MIRT681166 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT681228 DUSP19 dual specificity phosphatase 19 2 2
MIRT681311 IKZF3 IKAROS family zinc finger 3 2 2
MIRT681348 BRI3BP BRI3 binding protein 2 2
MIRT681615 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT681785 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681898 SLC11A2 solute carrier family 11 member 2 2 2
MIRT682091 ITGA3 integrin subunit alpha 3 2 4
MIRT682144 SMS spermine synthase 2 2
MIRT682170 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682227 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682350 PLEKHB2 pleckstrin homology domain containing B2 2 2
MIRT682374 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682543 EXOSC2 exosome component 2 2 2
MIRT682628 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT683549 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT683650 ZNF695 zinc finger protein 695 2 2
MIRT684449 MFSD4 major facilitator superfamily domain containing 4A 2 2
MIRT684863 ZNF749 zinc finger protein 749 2 2
MIRT684963 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT685054 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685102 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 2 2
MIRT685817 SLC27A1 solute carrier family 27 member 1 2 2
MIRT685918 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT686672 TMEM120B transmembrane protein 120B 2 2
MIRT687125 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687746 KIAA1328 KIAA1328 2 2
MIRT688069 GLUL glutamate-ammonia ligase 2 2
MIRT688776 CDH7 cadherin 7 2 2
MIRT688949 ATXN3 ataxin 3 2 2
MIRT689691 TMPRSS12 transmembrane protease, serine 12 2 2
MIRT689746 PRR13 proline rich 13 2 2
MIRT689942 MANSC1 MANSC domain containing 1 2 2
MIRT690099 PNMA2 paraneoplastic Ma antigen 2 2 2
MIRT690197 C5orf45 MRN complex interacting protein 2 2
MIRT690255 CAMLG calcium modulating ligand 2 2
MIRT690426 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT691118 ADIPOQ adiponectin, C1Q and collagen domain containing 2 2
MIRT691238 DFNB59 pejvakin 2 2
MIRT691305 ZNF681 zinc finger protein 681 2 2
MIRT691374 GP5 glycoprotein V platelet 2 2
MIRT691809 WARS tryptophanyl-tRNA synthetase 2 2
MIRT692153 CEP104 centrosomal protein 104 2 2
MIRT692354 AGTRAP angiotensin II receptor associated protein 2 2
MIRT692582 NCMAP non-compact myelin associated protein 2 2
MIRT692656 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT692752 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 2 2
MIRT693101 SCNM1 sodium channel modifier 1 2 2
MIRT693261 HBS1L HBS1 like translational GTPase 2 2
MIRT693303 SYTL3 synaptotagmin like 3 2 2
MIRT693396 ZNF460 zinc finger protein 460 2 2
MIRT693494 MOB3A MOB kinase activator 3A 2 2
MIRT693541 ZNF708 zinc finger protein 708 2 2
MIRT693569 PIGR polymeric immunoglobulin receptor 2 2
MIRT694496 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT694741 LLGL1 LLGL1, scribble cell polarity complex component 2 2
MIRT694872 ZNF417 zinc finger protein 417 2 2
MIRT695079 ZNF17 zinc finger protein 17 2 2
MIRT695462 COX18 COX18, cytochrome c oxidase assembly factor 2 2
MIRT695730 ZNF117 zinc finger protein 117 2 2
MIRT695905 MED16 mediator complex subunit 16 2 2
MIRT696268 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT696519 C3 complement C3 2 2
MIRT696570 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696652 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696798 DHODH dihydroorotate dehydrogenase (quinone) 2 2
MIRT696828 PLLP plasmolipin 2 2
MIRT696972 CCDC80 coiled-coil domain containing 80 2 2
MIRT697092 GPKOW G-patch domain and KOW motifs 2 2
MIRT697170 INMT indolethylamine N-methyltransferase 2 2
MIRT697213 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697339 ZNF641 zinc finger protein 641 2 2
MIRT697589 YME1L1 YME1 like 1 ATPase 2 2
MIRT698626 TES testin LIM domain protein 2 2
MIRT698957 SPAST spastin 2 2
MIRT699091 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT699439 SLC1A5 solute carrier family 1 member 5 2 2
MIRT699561 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT700333 RAB4A RAB4A, member RAS oncogene family 2 2
MIRT700365 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT700466 PURB purine rich element binding protein B 2 2
MIRT701687 MYADM myeloid associated differentiation marker 2 2
MIRT701765 MSL2 MSL complex subunit 2 2 2
MIRT703186 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT703213 GOLGA3 golgin A3 2 2
MIRT703369 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT703433 FYTTD1 forty-two-three domain containing 1 2 2
MIRT703609 FBXO45 F-box protein 45 2 2
MIRT703708 FAM134A reticulophagy regulator family member 2 2 2
MIRT703818 EVI5 ecotropic viral integration site 5 2 2
MIRT703922 EPG5 ectopic P-granules autophagy protein 5 homolog 2 2
MIRT704242 DHDDS dehydrodolichyl diphosphate synthase subunit 2 2
MIRT704653 CLCC1 chloride channel CLIC like 1 2 2
MIRT704939 CCDC120 coiled-coil domain containing 120 2 2
MIRT705168 C11orf58 chromosome 11 open reading frame 58 2 2
MIRT705538 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT705668 ANKRD40 ankyrin repeat domain 40 2 2
MIRT706151 ZNF674 zinc finger protein 674 2 2
MIRT706480 SNX27 sorting nexin family member 27 2 2
MIRT708784 CD200R1 CD200 receptor 1 2 2
MIRT708845 SCAND3 zinc finger BED-type containing 9 1 1
MIRT709844 SNX12 sorting nexin 12 2 2
MIRT710445 BTNL3 butyrophilin like 3 2 2
MIRT711092 OGG1 8-oxoguanine DNA glycosylase 4 2
MIRT711334 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT713369 STK35 serine/threonine kinase 35 2 2
MIRT717125 SOWAHA sosondowah ankyrin repeat domain family member A 2 2
MIRT717408 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT722232 ZNF503 zinc finger protein 503 2 2
MIRT722670 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4728 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4728 Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4728 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4728 Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4728 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-mir-4728 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-4728 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-4728 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-4728 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4728-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4728-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4728-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4728-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4728-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4728-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4728-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4728-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4728-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission