miRTarBase - #MIRT084669


—
pre-miRNA Information
pre-miRNA hsa-mir-1277   
Genomic Coordinates chrX: 118386394 - 118386471
Synonyms MIRN1277, hsa-mir-1277, MIR1277
Description Homo sapiens miR-1277 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1277-5p
Sequence 8| AAAUAUAUAUAUAUAUGUACGUAU |31
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 15 X + 118386415 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746499482 2 dbSNP
rs770518695 2 dbSNP
rs1198178052 3 dbSNP
rs781269752 6 dbSNP
rs746163811 8 dbSNP
rs1190574471 13 dbSNP
rs1170658098 19 dbSNP
rs776234383 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BTG3   
Synonyms ANA, ANA/BTG3, APRO4, TOB5, TOB55, TOFA
Description BTG anti-proliferation factor 3
Transcript NM_001130914   
Other Transcripts NM_006806   
Expression
Putative miRNA Targets on BTG3
3'UTR of BTG3
(miRNA target sites are highlighted)		 
>BTG3|NM_001130914|3'UTR
   1 CTTCGTTTTTGATTGTGTTGGTGTCATGTTGAGAAAAAGGTAGAATAAACCTTACTACACATTAAAAGTTAAAAGTTCTT
  81 ACTAATAGTAGTGAAGTTAGATGGGCCAAACCATCAAACTTATTTTTATAGAAGTTATTGAGAATAATCTTTCTTAAAAA
 161 ATATATGCACTTTAGATATTGATATAGTTTGAGAAATTTTATTAAAGTTAGTCAAGTGCCTAAGTTTTTAATATTGGACT
 241 TGAGTATTTATATATTGTGCATCAACTCTGTTGGATACGAGAACACTGTAGAAGTGGACGATTTGTTCTAGCACCTTTGA
 321 GAATTTACTTTATGGAGCGTATGTAAGTTATTTATATACAAGGAAATCTATTTTATGTCGTTGTTTAAGAGAATTGTGTG
 401 AAATCATGTAGTTGCAAATAAAAAATAGTTTGAGGCATGACAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uauGCAUGUA--UAUAUAUAUAUAAa 5'
             :| || |  :||| |||||||| 
Target 5' tatTGGACTTGAGTATTTATATATTg 3'
 232 - 257 163.00 -5.03
2 
miRNA  3' uaUGCAUGUAU---AUAUAUAUAUaaa 5'
            :||||::||   ||| ||||||   
Target 5' gaGCGTATGTAAGTTATTTATATAcaa 3'
 335 - 361 138.00 -7.06
3 
miRNA  3' uaugcAUGUAUAUAUA-UAUAUAAa 5'
               |:::|: | || ||:|| | 
Target 5' agaatTGTGTG-AAATCATGTAGTt 3'
 390 - 413 102.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30113385 4 COSMIC
COSN15314277 5 COSMIC
COSN30459111 20 COSMIC
COSN24395572 149 COSMIC
COSN1254251 151 COSMIC
COSN31582737 153 COSMIC
COSN30526722 183 COSMIC
COSN31538029 299 COSMIC
COSN31779342 321 COSMIC
COSN26634539 322 COSMIC
COSN31961901 327 COSMIC
COSN31541380 349 COSMIC
COSN15101385 379 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs754020311 4 dbSNP
rs74382701 5 dbSNP
rs1257409622 9 dbSNP
rs375106468 11 dbSNP
rs375113180 13 dbSNP
rs766266852 15 dbSNP
rs762968907 18 dbSNP
rs1341712689 20 dbSNP
rs1484625231 21 dbSNP
rs1278068823 26 dbSNP
rs773328592 27 dbSNP
rs1381710519 36 dbSNP
rs764805944 39 dbSNP
rs1465717112 40 dbSNP
rs1035461241 45 dbSNP
rs1172875666 48 dbSNP
rs1466174746 49 dbSNP
rs1362848433 56 dbSNP
rs1490959202 57 dbSNP
rs889062284 58 dbSNP
rs1051615758 61 dbSNP
rs982174753 72 dbSNP
rs1433306760 78 dbSNP
rs1302749350 79 dbSNP
rs966825357 83 dbSNP
rs897627272 86 dbSNP
rs1272926793 88 dbSNP
rs1335323564 88 dbSNP
rs1241185089 93 dbSNP
rs1311115231 94 dbSNP
rs1036118428 104 dbSNP
rs1209938686 108 dbSNP
rs1021129305 115 dbSNP
rs1484228210 123 dbSNP
rs1306538690 127 dbSNP
rs1249247375 138 dbSNP
rs1439874928 147 dbSNP
rs1180102650 152 dbSNP
rs578146672 153 dbSNP
rs1392925888 161 dbSNP
rs1452960987 161 dbSNP
rs1175871917 162 dbSNP
rs887522228 163 dbSNP
rs563413894 164 dbSNP
rs1296479967 167 dbSNP
rs1028548057 173 dbSNP
rs367675835 176 dbSNP
rs936977210 179 dbSNP
rs1447671295 181 dbSNP
rs1311697497 182 dbSNP
rs1369136469 183 dbSNP
rs997518519 185 dbSNP
rs1301734429 190 dbSNP
rs1313843917 196 dbSNP
rs1225181647 199 dbSNP
rs1250740030 204 dbSNP
rs1405471603 205 dbSNP
rs1200058739 211 dbSNP
rs900151319 212 dbSNP
rs1467767045 213 dbSNP
rs982336835 249 dbSNP
rs1426345796 252 dbSNP
rs1347203829 255 dbSNP
rs1040038940 258 dbSNP
rs188071848 260 dbSNP
rs867242330 265 dbSNP
rs1466205573 268 dbSNP
rs988324434 269 dbSNP
rs958397948 270 dbSNP
rs1392484398 272 dbSNP
rs15459 275 dbSNP
rs1355365019 278 dbSNP
rs1172717703 279 dbSNP
rs1008597445 282 dbSNP
rs1369436411 284 dbSNP
rs886222977 287 dbSNP
rs1032376921 289 dbSNP
rs1277478847 290 dbSNP
rs577577077 291 dbSNP
rs374710526 292 dbSNP
rs751383282 294 dbSNP
rs1270728950 295 dbSNP
rs1428667769 300 dbSNP
rs552998857 308 dbSNP
rs1221883038 321 dbSNP
rs2824386 322 dbSNP
rs1489654891 325 dbSNP
rs143261518 333 dbSNP
rs869211999 333 dbSNP
rs920437291 338 dbSNP
rs997810853 339 dbSNP
rs897658073 342 dbSNP
rs1404888395 356 dbSNP
rs1415799071 356 dbSNP
rs1015209614 368 dbSNP
rs573786795 374 dbSNP
rs1055039268 379 dbSNP
rs937950022 380 dbSNP
rs555513644 381 dbSNP
rs537213577 382 dbSNP
rs552951198 386 dbSNP
rs149725830 387 dbSNP
rs1228439270 393 dbSNP
rs1261965177 393 dbSNP
rs1224097595 397 dbSNP
rs1314825003 403 dbSNP
rs146798740 408 dbSNP
rs982145102 410 dbSNP
rs1488880844 415 dbSNP
rs966710564 427 dbSNP
rs1390606038 429 dbSNP
rs1373714313 437 dbSNP
rs1046645514 440 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10950.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 10950.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaugcauguaUAUAUAUAUAUAAa 5'
                    :||| |||||||| 
Target 5' ---------aGUAUUUAUAUAUUg 3'
 		1 - 15
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10950.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000339775.6 | 3UTR | UAUUUAUAUAUUGUGCAUCAACUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000339775.6 | 3UTR | AGUAUUUAUAUAUUGUGCAUCAACUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000339775.6 | 3UTR | UAUUUAUAUAUUGUGCAUCAACUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
619 hsa-miR-1277-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056754 ARID5B AT-rich interaction domain 5B 2 4
MIRT061744 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT061749 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT064112 ERGIC2 ERGIC and golgi 2 2 2
MIRT064651 YAF2 YY1 associated factor 2 2 4
MIRT064836 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT067662 ZIC5 Zic family member 5 2 6
MIRT069282 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 6
MIRT070956 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT071145 NUMB NUMB, endocytic adaptor protein 2 2
MIRT074785 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 6
MIRT075264 SNTB2 syntrophin beta 2 2 4
MIRT075446 PSMD7 proteasome 26S subunit, non-ATPase 7 2 6
MIRT076212 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT084669 BTG3 BTG anti-proliferation factor 3 2 6
MIRT087151 HIC2 HIC ZBTB transcriptional repressor 2 2 6
MIRT088873 FOXN2 forkhead box N2 2 12
MIRT093119 SLC7A11 solute carrier family 7 member 11 2 10
MIRT096246 CANX calnexin 2 2
MIRT097122 TNPO1 transportin 1 2 2
MIRT097389 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT100756 VEGFA vascular endothelial growth factor A 2 4
MIRT100865 CD2AP CD2 associated protein 2 4
MIRT101318 FAM135A family with sequence similarity 135 member A 2 2
MIRT103531 HOXA9 homeobox A9 2 2
MIRT105845 DDHD2 DDHD domain containing 2 2 2
MIRT111511 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT113092 CCND2 cyclin D2 2 4
MIRT116209 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT117356 TGIF1 TGFB induced factor homeobox 1 2 4
MIRT122389 RGMB repulsive guidance molecule family member b 2 4
MIRT126100 USP6NL USP6 N-terminal like 2 10
MIRT163363 PRKCD protein kinase C delta 2 4
MIRT163466 WNT5A Wnt family member 5A 2 4
MIRT164377 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT181785 UHMK1 U2AF homology motif kinase 1 2 4
MIRT182290 POU2F1 POU class 2 homeobox 1 2 2
MIRT193652 RORA RAR related orphan receptor A 2 4
MIRT198842 C18ORF25 chromosome 18 open reading frame 25 2 2
MIRT201466 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT214454 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT223276 TRIM4 tripartite motif containing 4 2 2
MIRT225132 KAT6A lysine acetyltransferase 6A 2 6
MIRT225924 SNX16 sorting nexin 16 2 6
MIRT227867 NFIB nuclear factor I B 2 6
MIRT229421 ZNF275 zinc finger protein 275 2 4
MIRT243203 SERTAD2 SERTA domain containing 2 2 2
MIRT265715 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT267012 ZDHHC5 zinc finger DHHC-type containing 5 2 6
MIRT269383 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT270184 UNG uracil DNA glycosylase 2 6
MIRT271867 ZNF678 zinc finger protein 678 2 2
MIRT273689 HOXC4 homeobox C4 2 8
MIRT274714 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT276556 AKAP11 A-kinase anchoring protein 11 2 2
MIRT277062 NDFIP2 Nedd4 family interacting protein 2 2 4
MIRT277511 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT277911 RBM23 RNA binding motif protein 23 2 4
MIRT282601 IGF1R insulin like growth factor 1 receptor 2 2
MIRT287614 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT296120 TP53RK TP53 regulating kinase 2 4
MIRT297070 NCK2 NCK adaptor protein 2 2 2
MIRT301453 DDX17 DEAD-box helicase 17 2 2
MIRT302777 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT303262 FBXO48 F-box protein 48 2 4
MIRT308605 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT311040 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT312331 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT312420 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT313989 TPPP tubulin polymerization promoting protein 2 6
MIRT316901 ATXN1 ataxin 1 2 2
MIRT316955 QKI QKI, KH domain containing RNA binding 2 2
MIRT317931 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT323683 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT327651 ZXDA zinc finger, X-linked, duplicated A 2 8
MIRT330640 CDK1 cyclin dependent kinase 1 2 2
MIRT331299 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT338170 SP1 Sp1 transcription factor 2 6
MIRT359188 F2RL1 F2R like trypsin receptor 1 2 6
MIRT359673 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 4
MIRT362977 CASD1 CAS1 domain containing 1 2 4
MIRT366901 NONO non-POU domain containing octamer binding 2 2
MIRT379801 APOOL apolipoprotein O like 2 6
MIRT395177 ZNF609 zinc finger protein 609 2 2
MIRT403410 RPS7 ribosomal protein S7 2 2
MIRT408867 BACH2 BTB domain and CNC homolog 2 2 8
MIRT441400 SOX5 SRY-box 5 2 8
MIRT441513 AKR1D1 aldo-keto reductase family 1 member D1 2 2
MIRT441661 COCH cochlin 2 2
MIRT441785 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT441968 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT442041 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442718 TNKS tankyrase 2 2
MIRT443365 CSRP1 cysteine and glycine rich protein 1 2 2
MIRT443403 HMX3 H6 family homeobox 3 2 2
MIRT443422 LIN28B lin-28 homolog B 2 4
MIRT443458 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT444783 ECE1 endothelin converting enzyme 1 2 2
MIRT444794 TMEM251 transmembrane protein 251 2 2
MIRT444829 POLR1B RNA polymerase I subunit B 2 2
MIRT445040 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT445146 KLHL23 kelch like family member 23 2 8
MIRT445904 TBX18 T-box 18 2 6
MIRT446322 GM2A GM2 ganglioside activator 2 2
MIRT446772 ATAD5 ATPase family, AAA domain containing 5 2 2
MIRT446996 UBXN2A UBX domain protein 2A 2 2
MIRT447326 ZSCAN21 zinc finger and SCAN domain containing 21 2 2
MIRT447435 FER FER tyrosine kinase 2 2
MIRT447732 DGKH diacylglycerol kinase eta 2 4
MIRT447885 ERI1 exoribonuclease 1 2 2
MIRT448972 CADM2 cell adhesion molecule 2 2 2
MIRT450008 SLC16A6 solute carrier family 16 member 6 2 4
MIRT450383 GUF1 GUF1 homolog, GTPase 2 2
MIRT450752 POLI DNA polymerase iota 2 2
MIRT454744 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 2 2
MIRT456101 MB21D1 Mab-21 domain containing 1 2 6
MIRT460169 CCL16 C-C motif chemokine ligand 16 2 2
MIRT466574 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466700 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT467423 SNTB1 syntrophin beta 1 2 4
MIRT467733 SLC38A1 solute carrier family 38 member 1 2 2
MIRT469922 PTPRJ protein tyrosine phosphatase, receptor type J 2 8
MIRT470039 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT472972 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT475057 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT475180 INSIG2 insulin induced gene 2 2 6
MIRT477509 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT480614 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT480943 BBX BBX, HMG-box containing 2 8
MIRT481533 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT485089 SLC30A1 solute carrier family 30 member 1 2 4
MIRT496317 GCK glucokinase 2 6
MIRT496323 DOCK9 dedicator of cytokinesis 9 2 2
MIRT497792 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT499299 KCNK1 potassium two pore domain channel subfamily K member 1 2 10
MIRT503233 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 10
MIRT503290 XRCC3 X-ray repair cross complementing 3 2 6
MIRT503330 TET2 tet methylcytosine dioxygenase 2 2 10
MIRT503384 ASB11 ankyrin repeat and SOCS box containing 11 2 4
MIRT503397 C11orf74 chromosome 11 open reading frame 74 2 4
MIRT503520 USP51 ubiquitin specific peptidase 51 2 6
MIRT503575 BTBD19 BTB domain containing 19 2 6
MIRT503697 CTLA4 cytotoxic T-lymphocyte associated protein 4 2 8
MIRT503739 GPATCH11 G-patch domain containing 11 2 10
MIRT503813 CARF calcium responsive transcription factor 2 8
MIRT503835 NCAM2 neural cell adhesion molecule 2 2 6
MIRT503857 CSMD1 CUB and Sushi multiple domains 1 2 4
MIRT503891 ELF2 E74 like ETS transcription factor 2 2 6
MIRT503975 C4orf29 abhydrolase domain containing 18 2 10
MIRT504025 CEP104 centrosomal protein 104 2 4
MIRT504134 RAB3B RAB3B, member RAS oncogene family 2 14
MIRT504249 FAM26E calcium homeostasis modulator family member 5 2 8
MIRT504250 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 10
MIRT504298 ZNF318 zinc finger protein 318 2 6
MIRT504343 COPS8 COP9 signalosome subunit 8 2 6
MIRT504357 VCAM1 vascular cell adhesion molecule 1 2 8
MIRT504385 SLC24A2 solute carrier family 24 member 2 2 6
MIRT504454 MIPOL1 mirror-image polydactyly 1 2 6
MIRT504520 BVES blood vessel epicardial substance 2 6
MIRT504582 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 6
MIRT504583 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 2 6
MIRT504607 MMADHC methylmalonic aciduria and homocystinuria, cblD type 2 6
MIRT504659 CYGB cytoglobin 2 4
MIRT504719 PLEKHA6 pleckstrin homology domain containing A6 2 10
MIRT504730 DGKG diacylglycerol kinase gamma 2 10
MIRT504732 GSK3B glycogen synthase kinase 3 beta 2 8
MIRT504770 CLEC2D C-type lectin domain family 2 member D 2 4
MIRT504818 HOXD10 homeobox D10 2 8
MIRT504862 VAMP4 vesicle associated membrane protein 4 2 6
MIRT504925 IMPG2 interphotoreceptor matrix proteoglycan 2 2 10
MIRT504929 CA12 carbonic anhydrase 12 2 6
MIRT505093 ZBED3 zinc finger BED-type containing 3 2 6
MIRT505175 WDR76 WD repeat domain 76 2 4
MIRT505259 RPS27A ribosomal protein S27a 2 6
MIRT505431 TBPL1 TATA-box binding protein like 1 2 8
MIRT505521 SPATA2 spermatogenesis associated 2 2 10
MIRT505743 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT505762 SEC23IP SEC23 interacting protein 2 6
MIRT506023 PUM1 pumilio RNA binding family member 1 2 6
MIRT506055 PPP4R2 protein phosphatase 4 regulatory subunit 2 2 8
MIRT506141 PLEKHA3 pleckstrin homology domain containing A3 2 6
MIRT506169 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 6
MIRT506303 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506404 NRF1 nuclear respiratory factor 1 2 4
MIRT506473 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 6
MIRT506551 MON1B MON1 homolog B, secretory trafficking associated 2 4
MIRT506612 MARCH6 membrane associated ring-CH-type finger 6 2 10
MIRT506723 LPAR3 lysophosphatidic acid receptor 3 2 10
MIRT506734 LMTK2 lemur tyrosine kinase 2 2 8
MIRT506902 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 6
MIRT507175 G3BP2 G3BP stress granule assembly factor 2 2 2
MIRT507399 EMC7 ER membrane protein complex subunit 7 2 8
MIRT507476 E2F8 E2F transcription factor 8 2 6
MIRT507618 CSRNP3 cysteine and serine rich nuclear protein 3 2 8
MIRT507635 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT507831 CD55 CD55 molecule (Cromer blood group) 2 4
MIRT508102 AMER1 APC membrane recruitment protein 1 2 12
MIRT508195 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 8
MIRT508255 CD226 CD226 molecule 2 8
MIRT508276 ADCYAP1 adenylate cyclase activating polypeptide 1 2 10
MIRT508325 CCDC38 coiled-coil domain containing 38 2 6
MIRT508364 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 2 10
MIRT508419 MYBL1 MYB proto-oncogene like 1 2 6
MIRT508438 ZNF608 zinc finger protein 608 2 4
MIRT508458 SHOX2 short stature homeobox 2 2 6
MIRT508532 RPP14 ribonuclease P/MRP subunit p14 2 6
MIRT508580 ZNF516 zinc finger protein 516 2 6
MIRT508596 CREB1 cAMP responsive element binding protein 1 2 6
MIRT508630 EIF2B1 eukaryotic translation initiation factor 2B subunit alpha 2 8
MIRT508637 RPL23A ribosomal protein L23a 2 6
MIRT508673 TBX20 T-box 20 2 6
MIRT508679 ENTHD1 ENTH domain containing 1 2 6
MIRT508694 NRIP1 nuclear receptor interacting protein 1 2 8
MIRT508764 ETV6 ETS variant 6 2 8
MIRT508781 CDKL1 cyclin dependent kinase like 1 2 10
MIRT508796 NTRK3 neurotrophic receptor tyrosine kinase 3 2 4
MIRT508841 TMCO1 transmembrane and coiled-coil domains 1 2 4
MIRT508970 MLLT3 MLLT3, super elongation complex subunit 2 6
MIRT508985 DCLRE1C DNA cross-link repair 1C 2 6
MIRT508990 TNFRSF9 TNF receptor superfamily member 9 2 6
MIRT509015 CUL2 cullin 2 2 10
MIRT509021 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 6
MIRT509040 AKAP2 A-kinase anchoring protein 2 2 6
MIRT509076 RABGAP1 RAB GTPase activating protein 1 2 8
MIRT509152 SLC25A27 solute carrier family 25 member 27 2 8
MIRT509176 EFHC1 EF-hand domain containing 1 2 4
MIRT509177 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 2 6
MIRT509180 TSPAN2 tetraspanin 2 2 6
MIRT509220 PYHIN1 pyrin and HIN domain family member 1 2 10
MIRT509241 OTX1 orthodenticle homeobox 1 2 6
MIRT509261 SUCNR1 succinate receptor 1 2 10
MIRT509437 SRP72 signal recognition particle 72 2 10
MIRT509443 POU2F2 POU class 2 homeobox 2 2 6
MIRT509464 TRIM2 tripartite motif containing 2 2 4
MIRT509482 LARP1 La ribonucleoprotein domain family member 1 2 10
MIRT509539 RSBN1L round spermatid basic protein 1 like 2 6
MIRT509604 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 6
MIRT509701 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 4
MIRT509759 KIAA2018 upstream transcription factor family member 3 2 6
MIRT509816 SULT1B1 sulfotransferase family 1B member 1 2 8
MIRT509822 GTPBP2 GTP binding protein 2 2 6
MIRT509829 TACR3 tachykinin receptor 3 2 4
MIRT509916 WDR92 WD repeat domain 92 2 2
MIRT509951 ITGA1 integrin subunit alpha 1 2 6
MIRT509956 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 4
MIRT509972 CRIM1 cysteine rich transmembrane BMP regulator 1 2 4
MIRT509983 GTF2H1 general transcription factor IIH subunit 1 2 4
MIRT509998 ARID3A AT-rich interaction domain 3A 2 8
MIRT510049 LRP6 LDL receptor related protein 6 2 12
MIRT510123 COL8A1 collagen type VIII alpha 1 chain 2 8
MIRT510132 C2orf49 chromosome 2 open reading frame 49 2 8
MIRT510170 STARD8 StAR related lipid transfer domain containing 8 2 10
MIRT510207 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 11
MIRT510239 TNFSF9 TNF superfamily member 9 2 6
MIRT510240 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 6
MIRT510262 DDX55 DEAD-box helicase 55 2 10
MIRT510448 ZFHX3 zinc finger homeobox 3 2 6
MIRT510480 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 10
MIRT510676 STRN striatin 2 8
MIRT510707 SPPL2A signal peptide peptidase like 2A 2 8
MIRT510805 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 10
MIRT510830 RTN4RL1 reticulon 4 receptor like 1 2 6
MIRT510839 RCAN2 regulator of calcineurin 2 2 6
MIRT510884 RAB5B RAB5B, member RAS oncogene family 2 6
MIRT510900 PURG purine rich element binding protein G 2 6
MIRT510929 PRRX1 paired related homeobox 1 2 4
MIRT510930 PROX1 prospero homeobox 1 2 6
MIRT510994 PCBP2 poly(rC) binding protein 2 2 8
MIRT511002 PAQR3 progestin and adipoQ receptor family member 3 2 6
MIRT511065 NPTN neuroplastin 2 4
MIRT511117 NDST1 N-deacetylase and N-sulfotransferase 1 2 6
MIRT511128 NABP1 nucleic acid binding protein 1 2 8
MIRT511164 MBNL3 muscleblind like splicing regulator 3 2 6
MIRT511173 MARCKS myristoylated alanine rich protein kinase C substrate 2 6
MIRT511191 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 6
MIRT511222 KPNA4 karyopherin subunit alpha 4 2 4
MIRT511327 KIAA1522 KIAA1522 2 4
MIRT511352 KHSRP KH-type splicing regulatory protein 2 4
MIRT511362 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 4
MIRT511363 IL6ST interleukin 6 signal transducer 2 4
MIRT511369 IKZF4 IKAROS family zinc finger 4 2 6
MIRT511415 HSPA13 heat shock protein family A (Hsp70) member 13 2 4
MIRT511496 HMGXB4 HMG-box containing 4 2 6
MIRT511516 HMGB2 high mobility group box 2 2 4
MIRT511675 HIST1H3B histone cluster 1 H3 family member b 2 8
MIRT511919 FKBP14 FK506 binding protein 14 2 4
MIRT511954 EVI5 ecotropic viral integration site 5 2 6
MIRT511998 DUSP7 dual specificity phosphatase 7 2 4
MIRT512006 DTX4 deltex E3 ubiquitin ligase 4 2 10
MIRT512073 DDX6 DEAD-box helicase 6 2 6
MIRT512150 CFL2 cofilin 2 2 4
MIRT512220 BMP2K BMP2 inducible kinase 2 8
MIRT512266 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 6
MIRT512308 ADCY9 adenylate cyclase 9 2 8
MIRT512335 ABI2 abl interactor 2 2 4
MIRT512713 ZNF134 zinc finger protein 134 2 6
MIRT513001 TRPM6 transient receptor potential cation channel subfamily M member 6 2 4
MIRT514082 MGAT4C MGAT4 family member C 2 4
MIRT514214 LRRC63 leucine rich repeat containing 63 2 4
MIRT514231 EPOR erythropoietin receptor 2 4
MIRT514443 C15orf59 chromosome 15 open reading frame 59 2 10
MIRT514455 KARS lysyl-tRNA synthetase 2 2
MIRT514647 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 2 2
MIRT514703 PHEX phosphate regulating endopeptidase homolog X-linked 2 10
MIRT514751 ACER3 alkaline ceramidase 3 2 8
MIRT514817 TSNARE1 t-SNARE domain containing 1 2 8
MIRT514943 GPR141 G protein-coupled receptor 141 2 2
MIRT515313 SLC35E3 solute carrier family 35 member E3 2 6
MIRT515398 ARHGAP21 Rho GTPase activating protein 21 2 4
MIRT515399 WDR72 WD repeat domain 72 2 6
MIRT515518 CCT4 chaperonin containing TCP1 subunit 4 2 4
MIRT515547 KRT222 keratin 222 2 4
MIRT515610 WDR17 WD repeat domain 17 2 2
MIRT515644 MYBPC1 myosin binding protein C, slow type 2 2
MIRT515776 NLGN4X neuroligin 4, X-linked 2 6
MIRT515823 FOCAD focadhesin 2 2
MIRT515850 AJAP1 adherens junctions associated protein 1 2 6
MIRT515864 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT515868 PLXDC2 plexin domain containing 2 2 4
MIRT515883 FAM182B family with sequence similarity 182 member B 2 8
MIRT515976 C9orf156 tRNA methyltransferase O 2 4
MIRT515982 AR androgen receptor 2 8
MIRT516292 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 6
MIRT516498 GLRX2 glutaredoxin 2 2 6
MIRT516688 ZNF675 zinc finger protein 675 2 6
MIRT516704 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 6
MIRT516763 POT1 protection of telomeres 1 2 4
MIRT516941 SLC35F6 solute carrier family 35 member F6 2 8
MIRT517039 ZC3H6 zinc finger CCCH-type containing 6 2 8
MIRT517149 VHLL VHL like 2 6
MIRT517318 ZNF347 zinc finger protein 347 2 6
MIRT517349 NLRP9 NLR family pyrin domain containing 9 2 4
MIRT517501 GRID1 glutamate ionotropic receptor delta type subunit 1 2 6
MIRT517503 KCNK12 potassium two pore domain channel subfamily K member 12 2 4
MIRT517548 ABCF1 ATP binding cassette subfamily F member 1 2 8
MIRT517563 VENTX VENT homeobox 2 4
MIRT517622 C10orf67 chromosome 10 open reading frame 67 2 4
MIRT517695 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 4
MIRT517897 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT518123 XKR6 XK related 6 2 10
MIRT518154 TMEM133 transmembrane protein 133 2 2
MIRT518234 SCIN scinderin 2 6
MIRT518440 FRRS1 ferric chelate reductase 1 2 10
MIRT518505 DEPTOR DEP domain containing MTOR interacting protein 2 6
MIRT518615 CAPN5 calpain 5 2 6
MIRT518652 SLC2A12 solute carrier family 2 member 12 2 6
MIRT518665 CLVS2 clavesin 2 2 4
MIRT518704 TNIP1 TNFAIP3 interacting protein 1 2 4
MIRT518763 IFNAR1 interferon alpha and beta receptor subunit 1 2 6
MIRT518808 AKAP8 A-kinase anchoring protein 8 2 4
MIRT518881 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 6
MIRT519032 AGPS alkylglycerone phosphate synthase 2 8
MIRT519154 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 4
MIRT519161 CD180 CD180 molecule 2 4
MIRT519350 OBFC1 STN1, CST complex subunit 2 4
MIRT519570 SEMA3F semaphorin 3F 2 6
MIRT519722 ZNF512B zinc finger protein 512B 2 4
MIRT519800 ZMYM2 zinc finger MYM-type containing 2 2 4
MIRT519926 ZER1 zyg-11 related cell cycle regulator 2 6
MIRT520000 ZBTB20 zinc finger and BTB domain containing 20 2 4
MIRT520001 ZBTB16 zinc finger and BTB domain containing 16 2 6
MIRT520101 XRN1 5'-3' exoribonuclease 1 2 4
MIRT520214 WASL Wiskott-Aldrich syndrome like 2 6
MIRT520465 TRIM23 tripartite motif containing 23 2 8
MIRT520478 TRIM13 tripartite motif containing 13 2 8
MIRT520752 THSD7A thrombospondin type 1 domain containing 7A 2 4
MIRT520826 SYPL1 synaptophysin like 1 2 6
MIRT520837 SYP synaptophysin 2 4
MIRT521035 SLC30A4 solute carrier family 30 member 4 2 8
MIRT521122 SIPA1L3 signal induced proliferation associated 1 like 3 2 8
MIRT521257 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT521413 RC3H1 ring finger and CCCH-type domains 1 2 10
MIRT521424 RBBP9 RB binding protein 9, serine hydrolase 2 2
MIRT521652 PRKD3 protein kinase D3 2 2
MIRT521783 PPARGC1A PPARG coactivator 1 alpha 2 10
MIRT521862 PLRG1 pleiotropic regulator 1 2 4
MIRT521878 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 4
MIRT521895 PIAS1 protein inhibitor of activated STAT 1 2 4
MIRT521921 PHIP pleckstrin homology domain interacting protein 2 6
MIRT521937 PHF8 PHD finger protein 8 2 10
MIRT521975 PHACTR2 phosphatase and actin regulator 2 2 10
MIRT521980 PEX5L peroxisomal biogenesis factor 5 like 2 8
MIRT521990 PER1 period circadian clock 1 2 2
MIRT521993 PDCD10 programmed cell death 10 2 6
MIRT522008 PCGF2 polycomb group ring finger 2 2 6
MIRT522029 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 4
MIRT522076 OCIAD2 OCIA domain containing 2 2 2
MIRT522256 NLK nemo like kinase 2 2
MIRT522310 NFIC nuclear factor I C 2 6
MIRT522389 MYADM myeloid associated differentiation marker 2 6
MIRT522465 MMP16 matrix metallopeptidase 16 2 4
MIRT522563 MBTD1 mbt domain containing 1 2 8
MIRT522662 MAN1A2 mannosidase alpha class 1A member 2 2 6
MIRT522735 LRP8 LDL receptor related protein 8 2 4
MIRT522758 LDLR low density lipoprotein receptor 2 6
MIRT522823 KLHL9 kelch like family member 9 2 6
MIRT522835 KLF7 Kruppel like factor 7 2 4
MIRT522838 KIAA2022 neurite extension and migration factor 2 4
MIRT522889 KCNN3 potassium calcium-activated channel subfamily N member 3 2 10
MIRT523039 IGF1 insulin like growth factor 1 2 4
MIRT523143 HOXA11 homeobox A11 2 6
MIRT523374 GSR glutathione-disulfide reductase 2 4
MIRT523384 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 6
MIRT523394 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523403 GRAMD1B GRAM domain containing 1B 2 4
MIRT523601 FZD5 frizzled class receptor 5 2 4
MIRT523742 FBXO9 F-box protein 9 2 4
MIRT523805 FAM19A1 family with sequence similarity 19 member A1, C-C motif chemokine like 2 4
MIRT523881 EPHA5 EPH receptor A5 2 4
MIRT524021 DOCK4 dedicator of cytokinesis 4 2 4
MIRT524094 DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 2 4
MIRT524219 DDI2 DNA damage inducible 1 homolog 2 2 6
MIRT524225 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT524415 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT524468 CHRM3 cholinergic receptor muscarinic 3 2 4
MIRT524537 CDCA4 cell division cycle associated 4 2 2
MIRT524653 C1orf50 chromosome 1 open reading frame 50 2 10
MIRT524724 BRI3BP BRI3 binding protein 2 4
MIRT524752 BMP2 bone morphogenetic protein 2 2 8
MIRT524824 ARSJ arylsulfatase family member J 2 4
MIRT524892 ANKRD44 ankyrin repeat domain 44 2 6
MIRT524911 AMD1 adenosylmethionine decarboxylase 1 2 4
MIRT525016 ABHD13 abhydrolase domain containing 13 2 6
MIRT525212 C19orf12 chromosome 19 open reading frame 12 2 2
MIRT525506 ZNF878 zinc finger protein 878 2 2
MIRT527077 ABCC4 ATP binding cassette subfamily C member 4 2 2
MIRT527139 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT528412 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT528423 CERCAM cerebral endothelial cell adhesion molecule 2 10
MIRT529200 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT530012 ZFP42 ZFP42 zinc finger protein 2 2
MIRT530093 SHISA2 shisa family member 2 2 2
MIRT530180 ZBED2 zinc finger BED-type containing 2 2 2
MIRT534715 RFX7 regulatory factor X7 2 2
MIRT537011 GTF2A1 general transcription factor IIA subunit 1 2 4
MIRT537414 FBXO47 F-box protein 47 2 2
MIRT538277 CTGF connective tissue growth factor 2 6
MIRT538396 CREBRF CREB3 regulatory factor 2 4
MIRT538936 BMPR1A bone morphogenetic protein receptor type 1A 2 6
MIRT540652 NLRP8 NLR family pyrin domain containing 8 2 4
MIRT541074 SAMD12 sterile alpha motif domain containing 12 2 6
MIRT541694 TTC39B tetratricopeptide repeat domain 39B 2 4
MIRT541833 CDON cell adhesion associated, oncogene regulated 2 6
MIRT542101 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT542158 ROCK2 Rho associated coiled-coil containing protein kinase 2 2 6
MIRT542173 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT542213 IRS1 insulin receptor substrate 1 2 4
MIRT542877 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT542911 HSBP1 heat shock factor binding protein 1 2 2
MIRT543035 BCORL1 BCL6 corepressor like 1 2 4
MIRT543105 ZNF556 zinc finger protein 556 2 8
MIRT543651 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT543705 XKR9 XK related 9 2 2
MIRT543983 OSBP2 oxysterol binding protein 2 2 4
MIRT544136 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT544309 TAGLN2 transgelin 2 2 2
MIRT544531 SPPL3 signal peptide peptidase like 3 2 2
MIRT544881 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT545007 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT545132 ANXA5 annexin A5 2 2
MIRT545277 ZNF551 zinc finger protein 551 2 2
MIRT545616 SSPN sarcospan 2 4
MIRT545864 ZNF264 zinc finger protein 264 2 2
MIRT546367 SYF2 SYF2 pre-mRNA splicing factor 2 2
MIRT546390 STOX2 storkhead box 2 2 4
MIRT546967 PRR14L proline rich 14 like 2 2
MIRT548061 GOLGA7 golgin A7 2 2
MIRT548216 FKBP1A FK506 binding protein 1A 2 2
MIRT548412 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT548640 DAPK1 death associated protein kinase 1 2 2
MIRT549237 ATXN3 ataxin 3 2 4
MIRT549293 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT549483 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549626 PELP1 proline, glutamate and leucine rich protein 1 2 4
MIRT549733 NUP37 nucleoporin 37 2 2
MIRT549743 RHCG Rh family C glycoprotein 2 2
MIRT549776 FAR2 fatty acyl-CoA reductase 2 2 2
MIRT550261 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT550271 GNL3 G protein nucleolar 3 2 4
MIRT550282 APOL6 apolipoprotein L6 2 4
MIRT550327 SMAD9 SMAD family member 9 2 2
MIRT550387 TBX4 T-box 4 2 6
MIRT550524 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT550545 MYZAP myocardial zonula adherens protein 2 2
MIRT550747 OPN5 opsin 5 2 2
MIRT550785 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 4
MIRT551090 DDX52 DExD-box helicase 52 2 2
MIRT551169 ATP7A ATPase copper transporting alpha 2 2
MIRT551368 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551423 GIMAP7 GTPase, IMAP family member 7 2 2
MIRT551476 RASSF6 Ras association domain family member 6 2 2
MIRT551808 C4orf33 chromosome 4 open reading frame 33 2 6
MIRT551885 EPHA1 EPH receptor A1 2 2
MIRT552065 RAB11FIP3 RAB11 family interacting protein 3 2 6
MIRT552235 SART3 squamous cell carcinoma antigen recognized by T-cells 3 2 2
MIRT552370 ZNF562 zinc finger protein 562 2 4
MIRT552539 ZHX3 zinc fingers and homeoboxes 3 2 4
MIRT552960 VGLL2 vestigial like family member 2 2 4
MIRT553319 TSPAN14 tetraspanin 14 2 2
MIRT553409 TRIB1 tribbles pseudokinase 1 2 4
MIRT553412 TRAF5 TNF receptor associated factor 5 2 2
MIRT553646 TIMM10 translocase of inner mitochondrial membrane 10 2 4
MIRT554631 RPL37 ribosomal protein L37 2 2
MIRT554945 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT556252 MARCH3 membrane associated ring-CH-type finger 3 2 2
MIRT556610 LDOC1L retrotransposon Gag like 6 2 4
MIRT556781 KLF6 Kruppel like factor 6 2 2
MIRT557190 HOOK1 hook microtubule tethering protein 1 2 6
MIRT557308 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 2
MIRT557608 GNB1 G protein subunit beta 1 2 2
MIRT557748 FUBP1 far upstream element binding protein 1 2 2
MIRT557790 FREM2 FRAS1 related extracellular matrix protein 2 2 4
MIRT557800 FOXP1 forkhead box P1 2 2
MIRT557924 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT557984 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT558078 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 4
MIRT558298 DUSP8 dual specificity phosphatase 8 2 2
MIRT558657 CNKSR3 CNKSR family member 3 2 2
MIRT558969 CALML4 calmodulin like 4 2 2
MIRT559005 CA8 carbonic anhydrase 8 2 2
MIRT559150 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559218 BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 2 4
MIRT559581 AP1AR adaptor related protein complex 1 associated regulatory protein 2 2
MIRT559957 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT560110 ZNF557 zinc finger protein 557 2 2
MIRT560190 SPRTN SprT-like N-terminal domain 2 2
MIRT560727 ZNF529 zinc finger protein 529 2 6
MIRT561880 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT563155 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT563187 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT563634 ZNF460 zinc finger protein 460 2 2
MIRT563716 SVIP small VCP interacting protein 2 4
MIRT563786 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 2 2
MIRT564003 CCL11 C-C motif chemokine ligand 11 2 2
MIRT564568 CCDC80 coiled-coil domain containing 80 2 2
MIRT564583 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT564935 XPOT exportin for tRNA 2 2
MIRT565873 NHS NHS actin remodeling regulator 2 2
MIRT566550 PANK3 pantothenate kinase 3 2 2
MIRT566809 MB21D2 Mab-21 domain containing 2 2 2
MIRT566812 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT567134 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT567150 INO80D INO80 complex subunit D 2 2
MIRT567656 EXOC8 exocyst complex component 8 2 2
MIRT572158 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT572398 CCDC14 coiled-coil domain containing 14 2 2
MIRT574305 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574499 RPS15A ribosomal protein S15a 2 2
MIRT574501 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT576690 Pck1 phosphoenolpyruvate carboxykinase 1, cytosolic 2 6
MIRT607460 PCK1 phosphoenolpyruvate carboxykinase 1 2 9
MIRT608644 ACVR2B activin A receptor type 2B 2 6
MIRT609458 DHX36 DEAH-box helicase 36 2 6
MIRT612169 EMC3 ER membrane protein complex subunit 3 2 2
MIRT612703 NSUN3 NOP2/Sun RNA methyltransferase family member 3 2 2
MIRT613828 LANCL3 LanC like 3 2 4
MIRT614148 CEP97 centrosomal protein 97 2 6
MIRT614555 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 4
MIRT615290 C20orf194 chromosome 20 open reading frame 194 2 2
MIRT615694 NEGR1 neuronal growth regulator 1 2 2
MIRT615832 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 2 2
MIRT616824 KYNU kynureninase 2 6
MIRT622177 SLITRK4 SLIT and NTRK like family member 4 2 2
MIRT624734 ANTXR2 anthrax toxin receptor 2 2 2
MIRT634544 MPP6 membrane palmitoylated protein 6 2 6
MIRT647765 RNF168 ring finger protein 168 2 2
MIRT655886 TSPAN1 tetraspanin 1 2 4
MIRT686847 SLC6A5 solute carrier family 6 member 5 2 4
MIRT687504 NECAB1 N-terminal EF-hand calcium binding protein 1 2 2
MIRT695331 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT697028 EPDR1 ependymin related 1 2 2
MIRT702306 L1CAM L1 cell adhesion molecule 2 4
MIRT706763 PRRC2C proline rich coiled-coil 2C 2 2
MIRT706881 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT706948 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT707038 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT707081 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT707129 IKZF2 IKAROS family zinc finger 2 2 2
MIRT707163 CNTNAP5 contactin associated protein like 5 2 2
MIRT707216 STAM signal transducing adaptor molecule 2 2
MIRT707264 SIK3 SIK family kinase 3 2 2
MIRT707266 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT707280 NBPF10 NBPF member 10 2 2
MIRT707298 ARHGEF11 Rho guanine nucleotide exchange factor 11 2 2
MIRT707329 PCDH7 protocadherin 7 2 2
MIRT707344 MFAP5 microfibril associated protein 5 2 2
MIRT707392 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT707434 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT707524 HHIP hedgehog interacting protein 2 2
MIRT707535 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT707553 IGFBP1 insulin like growth factor binding protein 1 2 2
MIRT707758 ZMAT3 zinc finger matrin-type 3 2 2
MIRT707764 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT707779 WDR12 WD repeat domain 12 2 2
MIRT707782 UNK unkempt family zinc finger 2 2
MIRT707791 TTYH3 tweety family member 3 2 2
MIRT707811 TMEM178B transmembrane protein 178B 2 2
MIRT707849 TAOK1 TAO kinase 1 2 2
MIRT707851 STYX serine/threonine/tyrosine interacting protein 2 2
MIRT707868 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT707871 SNRK SNF related kinase 2 2
MIRT707885 SLC45A4 solute carrier family 45 member 4 2 2
MIRT707901 SLC25A12 solute carrier family 25 member 12 2 2
MIRT707924 PRIMA1 proline rich membrane anchor 1 2 2
MIRT708017 NR2C2 nuclear receptor subfamily 2 group C member 2 2 2
MIRT708037 MED28 mediator complex subunit 28 2 2
MIRT708042 MCAM melanoma cell adhesion molecule 2 2
MIRT708054 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT708088 KIAA1671 KIAA1671 2 2
MIRT708110 HERPUD2 HERPUD family member 2 2 2
MIRT708114 GREB1L growth regulation by estrogen in breast cancer 1 like 2 2
MIRT708154 CADM1 cell adhesion molecule 1 2 2
MIRT708167 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT708176 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT708225 ADD2 adducin 2 2 2
MIRT711911 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT716128 RPL24 ribosomal protein L24 2 2
MIRT719160 FMNL2 formin like 2 2 2
MIRT725009 ZPBP zona pellucida binding protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1277 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1277-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1277-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1277-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1277-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-1277-5p Palbociclib 5330286 NSC758247 approved sensitive cell line (T47D)
hsa-miR-1277-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission