miRTarBase - #MIRT085677


—
pre-miRNA Information
pre-miRNA hsa-mir-5692b   
Genomic Coordinates chr21: 42950928 - 42951014
Description Homo sapiens miR-5692b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5692b
Sequence 10| AAUAAUAUCACAGUAGGUGU |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs451887 2 dbSNP
rs1429076615 3 dbSNP
rs965523939 9 dbSNP
rs754088235 11 dbSNP
rs1299566879 13 dbSNP
Putative Targets

Gene Information
Gene Symbol EPC2   
Synonyms EPC-LIKE
Description enhancer of polycomb homolog 2
Transcript NM_015630   
Expression
Putative miRNA Targets on EPC2
3'UTR of EPC2
(miRNA target sites are highlighted)		 
>EPC2|NM_015630|3'UTR
   1 CCTAAAACACGTGGCTCTGACCTGTGCTGATGGTGTGCAGTCATTCATATTCCAGCTGAATGCAAAAGGCAACACTCTGT
  81 GGATCACAGAGTGTAACAATGGACCTAAATGGACTATAGTATATTGGATGTTAAATCCATATATGATGTATATTTTGTAA
 161 AATTGGGAAAATCACTACCTTGTAAAATAGTTTATTTGTATCATCAATATTATTTCTGTTACTTGAATAGTAGATATTCA
 241 TCATCATGCTTTTGCACTTGAATTTGCAACTGAATGGATTTTAAAAAATAATTCTTTAATGGGATCATGAGCATGAAATG
 321 GGATCCTGCATCACTTGTTTTAACTATTTATTTTGCCATGTTTACATTTTGTATCTTGTAAAAATAAATCCAACTTTGTG
 401 TCTAAAAAGTTAAAGATTCATAGCTAGGAAATGAAATTCTTGTAATTTTTTTCTAAAGGAACTGTAAAGTTTTCACTTGG
 481 TTCATTTTGTTTCACAATTTGACTAGATGGACTTTTTGGTAAATACTTTAGTGGCATTTCACTGTCAAATATGAAGTTCA
 561 AGGCAAAATAGTATTTTCTATTACTGTGCAGGGGAAAGGGATGGATCGATACATGCAAATTTAATGTAGTAACTCACTTT
 641 TCCATATATTTTGAATGTATATTTCTATTTATGATACCAATTTATAAAAAATAATTACACAGAAAAAATGGAATAGGAAA
 721 AATTATGCATCTAGCACATTTAAACTGTGCAAATATGAAAATTTTTCGAGGATTACATTTTATCTGAAGGCTGCATATTT
 801 TAACTGGCTTTAAAACTGTAACACATCACATAAAAGATACTTTACCAGGTATGTATTGCATTATATCATTGCAATAATTA
 881 TTGGAAGTCTAGATATCGAGCCATCCCAGGTGTTGGGCGGGGGGAGGGTTGTGGCAAGATTGTCTTTTCAATTTTGGAGA
 961 GTTTTCCTGTGGCTACAAGGCAAGTAACGGGTTGGAAAAAGTCTGACTGTAAGCGTTGGACACCTTCATAGTGTAGTGTT
1041 TTAGTGACTTTTTTTATACGGTTCTTGTAAATTAGATACGTGTAGTGGTGTTTCAGAATGTTTGTTTATGCACTAGTTCA
1121 GACAACTTTCCCTGTTACTTGTTCTTGATAAGTGAAAACTGCAGGGAAATAAAAAATACATATCAAAACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUGGA--UGACA-CUAUAA-UAa 5'
            ||:|  |: || |||||| || 
Target 5' ttACTTGAATAGTAGATATTCATc 3'
 219 - 242 124.00 -5.54
2 
miRNA  3' uguggAUGACACUAUAAUaa 5'
               ||:|| |||:|||  
Target 5' tagtaTATTG-GATGTTAaa 3'
 117 - 135 122.00 -7.40
3 
miRNA  3' ugUGGAUGAC--AC-UAUAAUAa 5'
            |:||:  |  || ||||| | 
Target 5' ttATCTGAAGGCTGCATATTTTa 3'
 780 - 802 116.00 -5.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30472435 4 COSMIC
COSN30456051 14 COSMIC
COSN31499931 23 COSMIC
COSN30115911 28 COSMIC
COSN30535951 43 COSMIC
COSN30532010 44 COSMIC
COSN31588955 76 COSMIC
COSN20056028 142 COSMIC
COSN28852932 213 COSMIC
COSN30112156 217 COSMIC
COSN31608828 295 COSMIC
COSN25309073 305 COSMIC
COSN31609948 307 COSMIC
COSN31486458 316 COSMIC
COSN5783096 347 COSMIC
COSN26553871 443 COSMIC
COSN31550727 513 COSMIC
COSN31528616 579 COSMIC
COSN20829912 605 COSMIC
COSN31568655 608 COSMIC
COSN8607662 694 COSMIC
COSN31517830 696 COSMIC
COSN20097230 709 COSMIC
COSN31544609 785 COSMIC
COSN20664595 963 COSMIC
COSN26552776 1019 COSMIC
COSN31607162 1060 COSMIC
COSN31603621 1097 COSMIC
COSN8607663 1120 COSMIC
COSN31571032 1178 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755417047 2 dbSNP
rs1172243497 5 dbSNP
rs1400271938 6 dbSNP
rs372607923 11 dbSNP
rs375928788 12 dbSNP
rs764995429 29 dbSNP
rs778057095 30 dbSNP
rs1327764617 31 dbSNP
rs1371137729 33 dbSNP
rs1231829309 34 dbSNP
rs370575562 36 dbSNP
rs1341087759 37 dbSNP
rs757215663 39 dbSNP
rs1179601356 40 dbSNP
rs374285570 41 dbSNP
rs1457550520 47 dbSNP
rs1379363256 50 dbSNP
rs746024888 51 dbSNP
rs544117435 53 dbSNP
rs1205210597 69 dbSNP
rs1199511224 70 dbSNP
rs897213156 71 dbSNP
rs1260801487 75 dbSNP
rs562838299 75 dbSNP
rs1479563877 77 dbSNP
rs1488438652 77 dbSNP
rs995636005 80 dbSNP
rs1269103398 81 dbSNP
rs1027148497 82 dbSNP
rs1196566999 85 dbSNP
rs1346489318 85 dbSNP
rs1425234303 86 dbSNP
rs1274861695 89 dbSNP
rs540364349 100 dbSNP
rs1340401311 120 dbSNP
rs1276757698 121 dbSNP
rs1171791504 126 dbSNP
rs1001822324 127 dbSNP
rs779265526 129 dbSNP
rs1333743901 136 dbSNP
rs1060084 139 dbSNP
rs117521189 141 dbSNP
rs112903103 144 dbSNP
rs1047713352 147 dbSNP
rs887602289 151 dbSNP
rs559949955 157 dbSNP
rs1421358703 163 dbSNP
rs1006082280 164 dbSNP
rs189265219 172 dbSNP
rs865836292 174 dbSNP
rs988853478 195 dbSNP
rs1236596258 205 dbSNP
rs1184977105 207 dbSNP
rs1366368009 208 dbSNP
rs1443717899 210 dbSNP
rs1038842219 213 dbSNP
rs1197437571 230 dbSNP
rs1317880011 235 dbSNP
rs1256713580 236 dbSNP
rs1220915192 238 dbSNP
rs912987355 243 dbSNP
rs527382834 270 dbSNP
rs552172790 284 dbSNP
rs1002587151 295 dbSNP
rs1446134394 314 dbSNP
rs1301363809 317 dbSNP
rs1342434419 321 dbSNP
rs191151146 324 dbSNP
rs1398105402 330 dbSNP
rs1171625545 331 dbSNP
rs1172715449 335 dbSNP
rs1034993171 342 dbSNP
rs1412804514 345 dbSNP
rs1466024573 345 dbSNP
rs1364239670 347 dbSNP
rs978503025 364 dbSNP
rs960905956 365 dbSNP
rs1237666529 367 dbSNP
rs1009774839 372 dbSNP
rs1021199266 374 dbSNP
rs968610717 382 dbSNP
rs1294818829 390 dbSNP
rs764541655 391 dbSNP
rs1456060019 395 dbSNP
rs758201702 396 dbSNP
rs1305726703 397 dbSNP
rs1308561313 399 dbSNP
rs1289640582 406 dbSNP
rs1226939545 409 dbSNP
rs979649313 409 dbSNP
rs760487232 412 dbSNP
rs1292239041 423 dbSNP
rs1017741050 427 dbSNP
rs931787809 435 dbSNP
rs1374783131 437 dbSNP
rs1219870694 443 dbSNP
rs777277751 445 dbSNP
rs1349208882 446 dbSNP
rs1447461890 446 dbSNP
rs964499996 447 dbSNP
rs1264680114 451 dbSNP
rs1406874792 455 dbSNP
rs1414147228 456 dbSNP
rs1157693720 463 dbSNP
rs975704511 463 dbSNP
rs1437366522 467 dbSNP
rs531367477 468 dbSNP
rs1178666671 471 dbSNP
rs911770768 498 dbSNP
rs1185466199 499 dbSNP
rs1246602986 524 dbSNP
rs1219907293 527 dbSNP
rs944062076 528 dbSNP
rs1037402631 530 dbSNP
rs1239701087 531 dbSNP
rs1351729862 533 dbSNP
rs1427274685 534 dbSNP
rs1311584680 541 dbSNP
rs897161065 546 dbSNP
rs1165786370 553 dbSNP
rs551273391 554 dbSNP
rs543785980 556 dbSNP
rs569580624 558 dbSNP
rs1291703082 564 dbSNP
rs1438451763 567 dbSNP
rs922926649 569 dbSNP
rs1297317617 572 dbSNP
rs536438443 576 dbSNP
rs928989955 581 dbSNP
rs1158763438 595 dbSNP
rs1432085887 599 dbSNP
rs1048450973 601 dbSNP
rs1189995424 608 dbSNP
rs906064767 609 dbSNP
rs1270090930 614 dbSNP
rs140250215 617 dbSNP
rs909154700 619 dbSNP
rs941833499 625 dbSNP
rs1044250437 626 dbSNP
rs775206413 626 dbSNP
rs1216664536 634 dbSNP
rs1311695187 637 dbSNP
rs1035958848 638 dbSNP
rs1431521127 641 dbSNP
rs905242611 645 dbSNP
rs960534310 647 dbSNP
rs566806763 655 dbSNP
rs144317729 660 dbSNP
rs1277385982 666 dbSNP
rs1019999484 673 dbSNP
rs1342055736 686 dbSNP
rs548328764 686 dbSNP
rs1465179494 692 dbSNP
rs751641502 692 dbSNP
rs1056512186 695 dbSNP
rs1358528360 699 dbSNP
rs1243281556 700 dbSNP
rs397796843 703 dbSNP
rs59505782 703 dbSNP
rs201387159 707 dbSNP
rs953253191 710 dbSNP
rs896484838 716 dbSNP
rs1339130490 718 dbSNP
rs1265724324 725 dbSNP
rs1187336174 727 dbSNP
rs1009554046 728 dbSNP
rs1317170515 740 dbSNP
rs987678638 746 dbSNP
rs1212315351 748 dbSNP
rs746919218 753 dbSNP
rs1021145623 757 dbSNP
rs1324247759 758 dbSNP
rs1257335152 762 dbSNP
rs911816887 763 dbSNP
rs904124605 768 dbSNP
rs1186025068 769 dbSNP
rs1244101217 776 dbSNP
rs1001405927 778 dbSNP
rs1380454628 785 dbSNP
rs1444442806 791 dbSNP
rs558491129 794 dbSNP
rs576814500 804 dbSNP
rs1401515463 814 dbSNP
rs1464462772 817 dbSNP
rs1375177770 821 dbSNP
rs971999008 831 dbSNP
rs1423513450 835 dbSNP
rs965283589 838 dbSNP
rs1254304455 850 dbSNP
rs1183735715 853 dbSNP
rs1461812827 856 dbSNP
rs1158392919 858 dbSNP
rs918616776 864 dbSNP
rs34683026 883 dbSNP
rs544229485 890 dbSNP
rs975818984 896 dbSNP
rs1337356633 898 dbSNP
rs1030115122 899 dbSNP
rs34263068 905 dbSNP
rs1319594337 907 dbSNP
rs950344600 913 dbSNP
rs1381989578 915 dbSNP
rs1445249836 919 dbSNP
rs1450129945 919 dbSNP
rs983132734 920 dbSNP
rs1457719137 922 dbSNP
rs1373528706 926 dbSNP
rs1366995487 929 dbSNP
rs1165714320 932 dbSNP
rs1445391806 934 dbSNP
rs905927233 938 dbSNP
rs1222916353 952 dbSNP
rs937532253 960 dbSNP
rs556184614 961 dbSNP
rs1209080565 965 dbSNP
rs895982263 970 dbSNP
rs1010936531 971 dbSNP
rs768459156 975 dbSNP
rs1352469148 976 dbSNP
rs1306521172 985 dbSNP
rs1264256408 986 dbSNP
rs980304551 989 dbSNP
rs574682477 993 dbSNP
rs1308316236 1002 dbSNP
rs1338119376 1002 dbSNP
rs1386644066 1009 dbSNP
rs1389028482 1009 dbSNP
rs1305295069 1010 dbSNP
rs904209950 1015 dbSNP
rs529260533 1016 dbSNP
rs551019477 1017 dbSNP
rs1198084116 1018 dbSNP
rs184749782 1021 dbSNP
rs938553784 1026 dbSNP
rs1056463772 1033 dbSNP
rs1176891010 1036 dbSNP
rs767620239 1036 dbSNP
rs1283438143 1037 dbSNP
rs1218241173 1039 dbSNP
rs1019229635 1043 dbSNP
rs961891128 1046 dbSNP
rs896600443 1047 dbSNP
rs1233194731 1049 dbSNP
rs746353766 1049 dbSNP
rs945356692 1052 dbSNP
rs1042376658 1056 dbSNP
rs920488432 1056 dbSNP
rs147788240 1058 dbSNP
rs1405196123 1059 dbSNP
rs931326318 1060 dbSNP
rs1172024182 1061 dbSNP
rs1468174287 1061 dbSNP
rs1464528187 1065 dbSNP
rs1431316907 1074 dbSNP
rs904061875 1081 dbSNP
rs1477367576 1097 dbSNP
rs1260691542 1099 dbSNP
rs1354950575 1099 dbSNP
rs563138410 1106 dbSNP
rs1447173535 1114 dbSNP
rs927383108 1116 dbSNP
rs1382158772 1121 dbSNP
rs1294138008 1122 dbSNP
rs937460588 1126 dbSNP
rs560312592 1128 dbSNP
rs1057207577 1131 dbSNP
rs1265537872 1135 dbSNP
rs1224570395 1137 dbSNP
rs1317689890 1139 dbSNP
rs895998569 1142 dbSNP
rs1305242221 1148 dbSNP
rs1433184489 1149 dbSNP
rs1277447429 1157 dbSNP
rs1347038712 1171 dbSNP
rs1001120003 1181 dbSNP
rs1223540476 1182 dbSNP
rs781233085 1184 dbSNP
rs1282105377 1191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26122.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000258484.6 | 3UTR | UAUCAUCAAUAUUAUUUCUGUUACUUGAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
166 hsa-miR-5692b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT085677 EPC2 enhancer of polycomb homolog 2 2 2
MIRT105850 DDHD2 DDHD domain containing 2 2 2
MIRT113098 CCND2 cyclin D2 2 4
MIRT114814 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT144343 NFAT5 nuclear factor of activated T-cells 5 2 8
MIRT154384 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT163380 PRKCD protein kinase C delta 2 4
MIRT170946 FOXK1 forkhead box K1 2 2
MIRT194929 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT201475 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT233433 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT264528 KCNC4 potassium voltage-gated channel subfamily C member 4 2 2
MIRT267016 ZDHHC5 zinc finger DHHC-type containing 5 2 6
MIRT288448 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT297079 NCK2 NCK adaptor protein 2 2 2
MIRT315681 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT329146 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT338140 SP1 Sp1 transcription factor 2 6
MIRT444287 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT444494 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT445038 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT445223 TYRP1 tyrosinase related protein 1 2 2
MIRT446770 ATAD5 ATPase family, AAA domain containing 5 2 2
MIRT450465 ENOX1 ecto-NOX disulfide-thiol exchanger 1 2 2
MIRT454286 FXN frataxin 2 2
MIRT457588 NCOA3 nuclear receptor coactivator 3 2 2
MIRT466631 TAOK1 TAO kinase 1 2 4
MIRT467728 SLC38A1 solute carrier family 38 member 1 2 2
MIRT472965 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT473222 MIER3 MIER family member 3 2 6
MIRT480627 BTBD3 BTB domain containing 3 2 4
MIRT483212 C9orf170 chromosome 9 open reading frame 170 2 6
MIRT499847 AVPR1A arginine vasopressin receptor 1A 2 4
MIRT502441 FZD6 frizzled class receptor 6 2 4
MIRT502982 CCND1 cyclin D1 2 10
MIRT503229 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 8
MIRT504737 GSK3B glycogen synthase kinase 3 beta 2 8
MIRT507395 EMC7 ER membrane protein complex subunit 7 2 8
MIRT507885 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 2 4
MIRT508043 ATXN1 ataxin 1 2 6
MIRT509159 SLC25A27 solute carrier family 25 member 27 2 8
MIRT510205 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 8
MIRT510236 TNFSF9 TNF superfamily member 9 2 6
MIRT510271 DDX55 DEAD-box helicase 55 2 10
MIRT510444 ZIC5 Zic family member 5 2 6
MIRT510478 ZBED3 zinc finger BED-type containing 3 2 4
MIRT511673 HIST1H3B histone cluster 1 H3 family member b 2 8
MIRT515641 MYBPC1 myosin binding protein C, slow type 2 2
MIRT515822 FOCAD focadhesin 2 2
MIRT516488 RAB32 RAB32, member RAS oncogene family 2 4
MIRT517543 ABCF1 ATP binding cassette subfamily F member 1 2 8
MIRT518084 TRIM35 tripartite motif containing 35 2 2
MIRT519925 ZER1 zyg-11 related cell cycle regulator 2 6
MIRT520233 VEGFA vascular endothelial growth factor A 2 2
MIRT520476 TRIM2 tripartite motif containing 2 2 4
MIRT520635 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT520834 SYP synaptophysin 2 4
MIRT521186 SCAF4 SR-related CTD associated factor 4 2 2
MIRT521885 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 4
MIRT521973 PHACTR2 phosphatase and actin regulator 2 2 8
MIRT521987 PER1 period circadian clock 1 2 2
MIRT522820 KLHL9 kelch like family member 9 2 6
MIRT523141 HOXA11 homeobox A11 2 6
MIRT523373 GSR glutathione-disulfide reductase 2 4
MIRT523600 FZD5 frizzled class receptor 5 2 4
MIRT525393 SHISA9 shisa family member 9 2 4
MIRT530011 ZFP42 ZFP42 zinc finger protein 2 2
MIRT530831 MAPK7 mitogen-activated protein kinase 7 2 2
MIRT531054 SLC9A4 solute carrier family 9 member A4 2 4
MIRT532080 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT532967 ZNF148 zinc finger protein 148 2 2
MIRT533016 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533286 UST uronyl 2-sulfotransferase 2 2
MIRT535525 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT535872 MLLT3 MLLT3, super elongation complex subunit 2 4
MIRT537009 GTF2A1 general transcription factor IIA subunit 1 2 4
MIRT537422 FBXO22 F-box protein 22 2 2
MIRT537563 ETNK1 ethanolamine kinase 1 2 2
MIRT540022 C4orf29 abhydrolase domain containing 18 2 2
MIRT542608 YOD1 YOD1 deubiquitinase 2 2
MIRT542905 HSBP1 heat shock factor binding protein 1 2 2
MIRT543125 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT543323 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT543442 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543553 ZNF516 zinc finger protein 516 2 2
MIRT543702 XKR9 XK related 9 2 2
MIRT543992 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544179 ANGPTL3 angiopoietin like 3 2 2
MIRT544241 CCBL2 kynurenine aminotransferase 3 2 2
MIRT544549 ZNF383 zinc finger protein 383 2 2
MIRT544759 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT544800 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545281 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545400 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT545541 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT545587 ZCCHC9 zinc finger CCHC-type containing 9 2 4
MIRT545803 ZNF652 zinc finger protein 652 2 2
MIRT545937 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT545985 XKR4 XK related 4 2 2
MIRT546133 UBE3A ubiquitin protein ligase E3A 2 2
MIRT546338 TFDP1 transcription factor Dp-1 2 4
MIRT546366 SYF2 SYF2 pre-mRNA splicing factor 2 2
MIRT546437 SNX5 sorting nexin 5 2 2
MIRT546788 RC3H1 ring finger and CCCH-type domains 1 2 2
MIRT546964 PRR14L proline rich 14 like 2 2
MIRT547109 PIGW phosphatidylinositol glycan anchor biosynthesis class W 2 2
MIRT547182 PDE12 phosphodiesterase 12 2 2
MIRT547246 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT547607 LIN28B lin-28 homolog B 2 2
MIRT547620 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT547873 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT548211 FKBP1A FK506 binding protein 1A 2 2
MIRT549154 BOLA3 bolA family member 3 2 2
MIRT549816 LUZP2 leucine zipper protein 2 2 2
MIRT550031 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT550230 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT550270 GNL3 G protein nucleolar 3 2 4
MIRT550299 ZNF681 zinc finger protein 681 2 2
MIRT550481 TMEM241 transmembrane protein 241 2 2
MIRT550659 ZFP37 ZFP37 zinc finger protein 2 2
MIRT551087 DDX52 DExD-box helicase 52 2 2
MIRT551100 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT551614 ZNF267 zinc finger protein 267 2 2
MIRT552229 SART3 squamous cell carcinoma antigen recognized by T-cells 3 2 2
MIRT552953 VGLL2 vestigial like family member 2 2 4
MIRT553787 TACC1 transforming acidic coiled-coil containing protein 1 2 2
MIRT554932 RAP1B RAP1B, member of RAS oncogene family 2 2
MIRT554942 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT554973 RAC1 Rac family small GTPase 1 2 4
MIRT555240 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT555516 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555574 PITX2 paired like homeodomain 2 2 2
MIRT556030 MXD1 MAX dimerization protein 1 2 2
MIRT556978 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558295 DUSP8 dual specificity phosphatase 8 2 2
MIRT558999 CA8 carbonic anhydrase 8 2 2
MIRT559146 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559954 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT561031 ADD3 adducin 3 2 2
MIRT562684 ACVR2B activin A receptor type 2B 2 2
MIRT564566 CCDC80 coiled-coil domain containing 80 2 2
MIRT564923 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT565295 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565870 NHS NHS actin remodeling regulator 2 2
MIRT566546 PANK3 pantothenate kinase 3 2 2
MIRT566609 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT566690 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT566858 LRRC58 leucine rich repeat containing 58 2 2
MIRT567655 EXOC8 exocyst complex component 8 2 2
MIRT613824 LANCL3 LanC like 3 2 4
MIRT634543 MPP6 membrane palmitoylated protein 6 2 4
MIRT638977 ARHGAP6 Rho GTPase activating protein 6 2 2
MIRT672437 RAPGEFL1 Rap guanine nucleotide exchange factor like 1 2 4
MIRT686754 STX16 syntaxin 16 2 2
MIRT694566 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT697026 EPDR1 ependymin related 1 2 2
MIRT699603 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT702303 LAMP3 lysosomal associated membrane protein 3 2 2
MIRT707173 CNTNAP5 contactin associated protein like 5 2 2
MIRT707256 SIK3 SIK family kinase 3 2 2
MIRT707342 MFAP5 microfibril associated protein 5 2 2
MIRT707376 SVIP small VCP interacting protein 2 2
MIRT707521 HHIP hedgehog interacting protein 2 2
MIRT707532 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT708185 BACH2 BTB domain and CNC homolog 2 2 2
MIRT708220 ADD2 adducin 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-5692b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-5692b Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission