miRTarBase - #MIRT086022


—
pre-miRNA Information
pre-miRNA hsa-mir-4524a   
Genomic Coordinates chr17: 69099564 - 69099632
Description Homo sapiens miR-4524a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524a-5p
Sequence 6| AUAGCAGCAUGAACCUGUCUCA |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322445998 8 dbSNP
rs1350790266 13 dbSNP
rs1263495678 21 dbSNP
Putative Targets

Gene Information
Gene Symbol UBR3   
Synonyms ZNF650
Description ubiquitin protein ligase E3 component n-recognin 3 (putative)
Transcript NM_172070   
Expression
Putative miRNA Targets on UBR3
3'UTR of UBR3
(miRNA target sites are highlighted)		 
>UBR3|NM_172070|3'UTR
   1 CTCTCCACCTCAGCATTGCATCGTATCATCATTTTCGCTACGAATTTATTTTTCAACAATAAGCTTTAACTTAATTTGGG
  81 GGATTAACACTTTTGCTGAGGGAGAAAAAGAAAACATACATTATGAAGCCTTTCCAAAATTAGGTGCTTGGTAATCACGT
 161 TAATGGTATAATTTTTTTTTTTTAATATCTGGAGAACATTAATAACAAGTTAAATTATTCTTTAGTGGTCATTTTTTAAG
 241 TGCACAATTAATAAGAAGCACAACTTGTTCACAAACTCATTCAGAAATGATTCTCCCAACAATGCGTATCAGCTATTCAT
 321 TGATACTTAGAGTGGGTGTGATTTATTTGACATTTTACTGCTTCTTTCTGTCTGTGTGTTTTAATTTGCATCTGCCAAGC
 401 ATAATGCATCTTTTTTCCTCTGCCATTCTTGTGTTGATTGGAGAATTTTTCTGTATGTAATTAGAAAAAAATGTAAAACA
 481 TGATTTATGTGAAATACTGTATAGTAAAAGTTGGTCTAATAGTAGAACTTTAAAATTTTTTCTTATTGTGAGGAATCTGT
 561 TAAAAGTTTAAAGCTTTGCTGAAAACTGAATTCATTCTCAGGAATTTCATAAATCTTCTCCCCAGGTAAATAATTGAAAT
 641 AGCTGTAAAATAAGTAGATAGCTGCTGTTAATATAATACAGTACATTTTGGGGGGCATATGTGTGGTTGGGGGGTCCTTA
 721 AAAATCAAAATTTGCCATTTCAGTTGGATGAATTACTAGAGGTAATAACAAATCTTACTATAAAATCAAGAGGTTTAAGA
 801 ACATACACTGGGCAGATGTTGATTCCGTGCATGCCCACCTTTTATTACCAAACAAGGTTTTGTTTATATGATTGTATTAG
 881 AAATGCTCAGACTTCCCCAGAAATGAACCATAAATTTTGGAACTTCCTTTCAGCTCAAGAGGTTCAGCTATATTGTATTT
 961 GTGCAGTGTAATCACTACTATTTCTGCTCGGTTTCCTAAAAGGAAAAAAAAGGCGCAGTGGTGATGACCCTCATGAATGA
1041 GCCACGCTTCTGCATTCTTCTTAGAAACTGCTGTGAAAAACAATTTATGTTTGCAGGGTTTAAAAATCAGTAAAAATGGG
1121 AATGATTGAGCTAAAACCCACTCTATGAGAAGGAAGATTACTGAAAAGCATGTGACATATTGCTACAAAGATTTTTTTTC
1201 CTAAATGATTCAGTAATTGAATGATTATTTAATATATAGTGCTATCAAGCAATCCCTGGTACTTTGGACTTCCATGGCTT
1281 GTTATATAAAATTACATTTTTACATGTAAAAATAAACTAAACAAATCTAATGATAAAATATGTCAGATCCATGTTCTAAA
1361 AAATTTTTGTAATGACATGACATTACAAGAGTATAAAAATGGACATTAAATCATGGCCTTGCATTAAAATATGGAAAGCA
1441 GAGCAGTACATATTCAAATGTATTCAGAAAGTCAAAAGATTACCTATCGTTCTACAATAAAATACATGGAAATAGCTTGC
1521 TATTTTTATATACATTTCCAAAATATTAAGATAACTTTCTGTAAGAGTCAATGATTCTGTTCGACTAAATAGCTGTCCTT
1601 TCCAACACATTGCTACTTTTTTAAATACTGTATCATAAGTTCAGCCTGTCATACTTTTTGCATTGATCGTTATGAATACC
1681 AGACCATTTGTAAGTGTGGTTGAAGAGCAAAATGCTAATTGACATCTCTAGTAAATACTGTTACAGGATTCATGAACTTG
1761 AATAATTCTACAGTTTGAAACTCTGATGCTATATATACATGGTATAATGTATTCAGACTTTGATTACTACTTATTTAAAA
1841 TGGAATGTTTTATGGTTGTGCATATGGATGTGAAGTGAAAATATTAGCCTTAACTTTAAAATTTGGGTGTTTGATAGTGT
1921 TTATTTTGATATTGGTGAATTAGTCACCAGTAAATTTTAAAAAAGCACTTGGTTGAAAATTGTACTTGAATACATACATG
2001 CATGCTGCTAAACTAGAACTTTAATTTTTCCCCATAACTTTTATAAGTCCCATTTATAAACCCACTTTTAAAAATAACAG
2081 GTCCAAGTTAGAGTGATGTGTGTATATTATTCAAAAAAATGTACTGGTGTGATATCTTGTATGAATGATCATTTAAATAC
2161 AGTACATTACTGTAGAAGCTAAATTGATCTTTATAATTAAGCAGAAATTACAAAACTAGGAATAATCAACATTGTAAGAT
2241 ATGTTAATAAAAACCTGCTGTCATTTGGTTTGTGAAAGGTCCTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acUCUGUCCAAGUACGACGAUa 5'
            | |:|  | |||||||||| 
Target 5' atACATACATGCATGCTGCTAa 3'
 1990 - 2011 164.00 -14.60
2 
miRNA  3' acUCUGUCCAAGUA-CGACGAUa 5'
            | |:| ||  || ||||||: 
Target 5' taAAATAAGTAGATAGCTGCTGt 3'
 646 - 668 140.00 -11.01
3 
miRNA  3' acucUGUCCAAGU-----ACGACGAUa 5'
              |||| || |     || ||||| 
Target 5' ttctACAGTTTGAAACTCTGATGCTAt 3'
 1766 - 1792 126.00 -6.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30106457 2 COSMIC
COSN30537970 17 COSMIC
COSN15314556 37 COSMIC
COSN31581567 38 COSMIC
COSN27348707 43 COSMIC
COSN30147887 45 COSMIC
COSN31613358 84 COSMIC
COSN28880499 87 COSMIC
COSN30107715 111 COSMIC
COSN30128561 167 COSMIC
COSN28851684 184 COSMIC
COSN28887570 184 COSMIC
COSN26768391 220 COSMIC
COSN31525543 221 COSMIC
COSN20068821 238 COSMIC
COSN31546524 344 COSMIC
COSN31570087 402 COSMIC
COSN31530676 421 COSMIC
COSN32013883 531 COSMIC
COSN26564473 567 COSMIC
COSN5489011 940 COSMIC
COSN30014921 974 COSMIC
COSN1806077 995 COSMIC
COSN28651699 1016 COSMIC
COSN5784799 1020 COSMIC
COSN31585189 1058 COSMIC
COSN30538818 1105 COSMIC
COSN30014311 1133 COSMIC
COSN30176602 1148 COSMIC
COSN31582850 1193 COSMIC
COSN31536405 1322 COSMIC
COSN31568946 1328 COSMIC
COSN20097345 1342 COSMIC
COSN31528613 1366 COSMIC
COSN16366586 1513 COSMIC
COSN28781428 1520 COSMIC
COSN7116133 1583 COSMIC
COSN7116134 1623 COSMIC
COSN31517253 1727 COSMIC
COSN31548107 1883 COSMIC
COSN31534761 1904 COSMIC
COSN1806078 1991 COSMIC
COSN31572741 2033 COSMIC
COSN31609084 2042 COSMIC
COSN26101382 2211 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1472796410 10 dbSNP
rs1160217396 12 dbSNP
rs149384803 16 dbSNP
rs1399597010 17 dbSNP
rs770000272 20 dbSNP
rs773798522 21 dbSNP
rs542421794 23 dbSNP
rs771321482 24 dbSNP
rs770035991 25 dbSNP
rs979319880 25 dbSNP
rs1444899832 27 dbSNP
rs1278272164 32 dbSNP
rs774617900 33 dbSNP
rs1298953346 36 dbSNP
rs79645018 37 dbSNP
rs767026112 38 dbSNP
rs375875363 42 dbSNP
rs763604990 43 dbSNP
rs544303840 45 dbSNP
rs1390653179 49 dbSNP
rs530177576 70 dbSNP
rs564460938 71 dbSNP
rs1366896708 87 dbSNP
rs986505788 87 dbSNP
rs944160248 91 dbSNP
rs533088848 95 dbSNP
rs1037594467 106 dbSNP
rs183101808 110 dbSNP
rs931501392 119 dbSNP
rs919759495 121 dbSNP
rs931359109 124 dbSNP
rs1047578482 129 dbSNP
rs908650149 130 dbSNP
rs1048590926 140 dbSNP
rs949414492 147 dbSNP
rs559990116 157 dbSNP
rs529086193 159 dbSNP
rs905409598 161 dbSNP
rs373324886 163 dbSNP
rs1394903177 168 dbSNP
rs1002414696 169 dbSNP
rs1002273053 170 dbSNP
rs1053857305 172 dbSNP
rs548730808 172 dbSNP
rs570016733 172 dbSNP
rs538145335 179 dbSNP
rs1009719229 184 dbSNP
rs1263742863 185 dbSNP
rs1468464028 186 dbSNP
rs1209870793 188 dbSNP
rs1476126196 199 dbSNP
rs1244526801 203 dbSNP
rs1020436091 205 dbSNP
rs1468695684 207 dbSNP
rs17635525 212 dbSNP
rs1197162231 213 dbSNP
rs1448068559 221 dbSNP
rs1186228361 226 dbSNP
rs1216359154 232 dbSNP
rs759299418 240 dbSNP
rs1441907085 243 dbSNP
rs1373536128 246 dbSNP
rs1425174715 253 dbSNP
rs1463870516 256 dbSNP
rs1399405686 257 dbSNP
rs1162148520 262 dbSNP
rs1008299068 264 dbSNP
rs1393060760 272 dbSNP
rs571562990 275 dbSNP
rs1190189851 283 dbSNP
rs1454404017 284 dbSNP
rs963916795 294 dbSNP
rs1177120936 295 dbSNP
rs975341674 298 dbSNP
rs533774753 306 dbSNP
rs1343 307 dbSNP
rs1311022891 316 dbSNP
rs1277982972 318 dbSNP
rs1350241253 327 dbSNP
rs1307388849 332 dbSNP
rs919872457 336 dbSNP
rs1372305941 337 dbSNP
rs952507645 338 dbSNP
rs982678490 341 dbSNP
rs1032251843 344 dbSNP
rs573669013 353 dbSNP
rs949504974 354 dbSNP
rs1230215694 359 dbSNP
rs985847858 361 dbSNP
rs1310715310 362 dbSNP
rs1396455583 363 dbSNP
rs1046790725 364 dbSNP
rs771122590 367 dbSNP
rs1409172337 373 dbSNP
rs912593640 374 dbSNP
rs944049872 375 dbSNP
rs1179382367 386 dbSNP
rs571260758 390 dbSNP
rs972821397 392 dbSNP
rs1237416421 397 dbSNP
rs536299917 400 dbSNP
rs114681312 402 dbSNP
rs1048579678 405 dbSNP
rs894084719 416 dbSNP
rs1239689432 434 dbSNP
rs761119869 444 dbSNP
rs764613413 452 dbSNP
rs1215595180 456 dbSNP
rs906105558 458 dbSNP
rs1225260439 461 dbSNP
rs547397579 465 dbSNP
rs1312219522 467 dbSNP
rs754407066 472 dbSNP
rs1415371490 473 dbSNP
rs1376714988 474 dbSNP
rs1042592266 479 dbSNP
rs902894709 484 dbSNP
rs1364035685 488 dbSNP
rs188181385 492 dbSNP
rs1007978474 498 dbSNP
rs1422468887 499 dbSNP
rs937635452 500 dbSNP
rs1019673104 521 dbSNP
rs899488318 522 dbSNP
rs996540260 523 dbSNP
rs35294426 536 dbSNP
rs1216000370 538 dbSNP
rs1026902939 544 dbSNP
rs74850983 547 dbSNP
rs1217614931 549 dbSNP
rs192925385 554 dbSNP
rs368745155 575 dbSNP
rs1015430207 578 dbSNP
rs896127556 580 dbSNP
rs555750469 587 dbSNP
rs1013671550 598 dbSNP
rs1275697525 603 dbSNP
rs536072254 608 dbSNP
rs1472642674 610 dbSNP
rs1381167675 612 dbSNP
rs1385178827 614 dbSNP
rs1160646364 627 dbSNP
rs1409748345 636 dbSNP
rs1394200957 640 dbSNP
rs1020681375 643 dbSNP
rs971196866 651 dbSNP
rs750829498 660 dbSNP
rs757535987 682 dbSNP
rs1192509708 692 dbSNP
rs902296671 693 dbSNP
rs779388550 694 dbSNP
rs937994534 696 dbSNP
rs989478694 698 dbSNP
rs915482493 701 dbSNP
rs1360650735 705 dbSNP
rs1214114542 709 dbSNP
rs1336778193 709 dbSNP
rs1256115501 714 dbSNP
rs1326484550 715 dbSNP
rs1032202584 736 dbSNP
rs144547651 738 dbSNP
rs750610293 764 dbSNP
rs1354992814 772 dbSNP
rs1410587853 775 dbSNP
rs1290276587 781 dbSNP
rs10930398 783 dbSNP
rs1042909209 788 dbSNP
rs1279908657 791 dbSNP
rs1462977956 793 dbSNP
rs1314335044 802 dbSNP
rs890646854 814 dbSNP
rs148466907 820 dbSNP
rs866073194 826 dbSNP
rs1256378134 827 dbSNP
rs780227550 828 dbSNP
rs564417314 834 dbSNP
rs145246420 835 dbSNP
rs1195125364 849 dbSNP
rs1340054553 851 dbSNP
rs1252493648 857 dbSNP
rs1248955473 868 dbSNP
rs918664456 869 dbSNP
rs1230442785 871 dbSNP
rs1469597692 873 dbSNP
rs1303718842 877 dbSNP
rs747110785 879 dbSNP
rs1375102563 901 dbSNP
rs114994393 905 dbSNP
rs1392471397 907 dbSNP
rs147629549 909 dbSNP
rs1399280537 912 dbSNP
rs1026659223 913 dbSNP
rs1301099520 922 dbSNP
rs888326622 932 dbSNP
rs555518009 935 dbSNP
rs184700373 937 dbSNP
rs1438109023 942 dbSNP
rs937521460 943 dbSNP
rs1361846999 949 dbSNP
rs970572366 956 dbSNP
rs1410643551 958 dbSNP
rs1252615174 960 dbSNP
rs982376831 962 dbSNP
rs1057346363 969 dbSNP
rs917496802 970 dbSNP
rs1280468505 977 dbSNP
rs548768434 990 dbSNP
rs562661752 991 dbSNP
rs1441508904 995 dbSNP
rs1275980371 1002 dbSNP
rs1240218819 1004 dbSNP
rs1370282004 1004 dbSNP
rs531395566 1012 dbSNP
rs868331940 1014 dbSNP
rs1332800172 1015 dbSNP
rs13781 1016 dbSNP
rs915243065 1022 dbSNP
rs1418032676 1029 dbSNP
rs967339161 1029 dbSNP
rs1384532574 1035 dbSNP
rs1000646848 1036 dbSNP
rs978379527 1044 dbSNP
rs1342491270 1045 dbSNP
rs1053546613 1046 dbSNP
rs73021307 1047 dbSNP
rs1212424256 1050 dbSNP
rs1007140629 1053 dbSNP
rs1436744103 1065 dbSNP
rs1283160828 1070 dbSNP
rs527320593 1074 dbSNP
rs1206042042 1079 dbSNP
rs944892222 1081 dbSNP
rs1291869092 1084 dbSNP
rs547383939 1087 dbSNP
rs1248388553 1089 dbSNP
rs140629963 1092 dbSNP
rs1192829013 1094 dbSNP
rs1326022601 1116 dbSNP
rs1019495248 1121 dbSNP
rs1390525632 1127 dbSNP
rs965710550 1133 dbSNP
rs536110976 1137 dbSNP
rs556008412 1140 dbSNP
rs560330870 1141 dbSNP
rs1460801702 1146 dbSNP
rs569477822 1157 dbSNP
rs1170742528 1164 dbSNP
rs1394533145 1169 dbSNP
rs952726536 1171 dbSNP
rs1241068073 1185 dbSNP
rs1448441224 1192 dbSNP
rs920984040 1192 dbSNP
rs1271645306 1200 dbSNP
rs984144430 1205 dbSNP
rs189578838 1206 dbSNP
rs774201114 1207 dbSNP
rs1275620529 1208 dbSNP
rs144163537 1213 dbSNP
rs1361319416 1215 dbSNP
rs993438648 1217 dbSNP
rs1433132790 1224 dbSNP
rs775470141 1240 dbSNP
rs1303178802 1244 dbSNP
rs1439940648 1253 dbSNP
rs1395066744 1256 dbSNP
rs1166985219 1265 dbSNP
rs1004316562 1266 dbSNP
rs1366412144 1269 dbSNP
rs1168048869 1272 dbSNP
rs1476157236 1279 dbSNP
rs578007034 1280 dbSNP
rs917503663 1286 dbSNP
rs946314330 1287 dbSNP
rs1469169325 1292 dbSNP
rs906481857 1294 dbSNP
rs1231006416 1296 dbSNP
rs1307479348 1314 dbSNP
rs9631 1327 dbSNP
rs923574305 1328 dbSNP
rs1209983978 1331 dbSNP
rs1291374502 1335 dbSNP
rs936341557 1335 dbSNP
rs67696809 1337 dbSNP
rs75449999 1340 dbSNP
rs867140038 1340 dbSNP
rs58433925 1342 dbSNP
rs869056338 1343 dbSNP
rs1353873438 1347 dbSNP
rs1328870024 1352 dbSNP
rs572686388 1355 dbSNP
rs1411174810 1360 dbSNP
rs1053496402 1365 dbSNP
rs556399790 1372 dbSNP
rs966718946 1378 dbSNP
rs1397252386 1380 dbSNP
rs978539725 1386 dbSNP
rs759050332 1387 dbSNP
rs191231301 1392 dbSNP
rs1206661032 1399 dbSNP
rs541282861 1405 dbSNP
rs1006718124 1409 dbSNP
rs974869351 1411 dbSNP
rs771733204 1426 dbSNP
rs901075288 1432 dbSNP
rs542553334 1439 dbSNP
rs774937713 1445 dbSNP
rs1372465910 1450 dbSNP
rs1280042767 1458 dbSNP
rs561507124 1459 dbSNP
rs562636250 1474 dbSNP
rs909646516 1476 dbSNP
rs1434884472 1486 dbSNP
rs116024611 1487 dbSNP
rs1389944594 1489 dbSNP
rs530137929 1490 dbSNP
rs1005516940 1495 dbSNP
rs1409241499 1497 dbSNP
rs544861210 1502 dbSNP
rs1316675712 1505 dbSNP
rs1474553149 1506 dbSNP
rs1256882835 1507 dbSNP
rs1325540633 1509 dbSNP
rs1245028627 1516 dbSNP
rs906412910 1527 dbSNP
rs550205658 1532 dbSNP
rs1486739291 1535 dbSNP
rs1003418054 1541 dbSNP
rs565009364 1553 dbSNP
rs1054859887 1557 dbSNP
rs894995739 1564 dbSNP
rs7562311 1572 dbSNP
rs1268700240 1573 dbSNP
rs1466199204 1583 dbSNP
rs115689183 1584 dbSNP
rs1414898143 1585 dbSNP
rs1380830574 1596 dbSNP
rs1286737082 1609 dbSNP
rs1452660071 1613 dbSNP
rs776986813 1620 dbSNP
rs1161898675 1621 dbSNP
rs999499468 1623 dbSNP
rs1417783093 1628 dbSNP
rs1024923132 1632 dbSNP
rs1476214737 1633 dbSNP
rs532594810 1647 dbSNP
rs1259788695 1664 dbSNP
rs1370365729 1668 dbSNP
rs183513364 1670 dbSNP
rs1029278520 1672 dbSNP
rs952173510 1682 dbSNP
rs189419532 1685 dbSNP
rs867337291 1687 dbSNP
rs926195433 1691 dbSNP
rs74327003 1699 dbSNP
rs1459272729 1700 dbSNP
rs1322968612 1703 dbSNP
rs549699613 1708 dbSNP
rs1384741297 1711 dbSNP
rs569431816 1719 dbSNP
rs181733651 1737 dbSNP
rs1381293510 1745 dbSNP
rs1362244171 1753 dbSNP
rs1396927781 1760 dbSNP
rs1439207319 1779 dbSNP
rs939771283 1785 dbSNP
rs1166244834 1787 dbSNP
rs972388360 1792 dbSNP
rs867532111 1794 dbSNP
rs1371392991 1795 dbSNP
rs927638121 1796 dbSNP
rs1353111989 1802 dbSNP
rs1250166841 1809 dbSNP
rs528736209 1812 dbSNP
rs1190213050 1819 dbSNP
rs989182384 1829 dbSNP
rs187013722 1830 dbSNP
rs1331197215 1834 dbSNP
rs1489458783 1835 dbSNP
rs914755048 1841 dbSNP
rs571410214 1857 dbSNP
rs946545507 1863 dbSNP
rs765457984 1868 dbSNP
rs942470061 1889 dbSNP
rs1043959215 1901 dbSNP
rs1040810777 1907 dbSNP
rs900976109 1914 dbSNP
rs533987690 1933 dbSNP
rs773624848 1940 dbSNP
rs1231673336 1952 dbSNP
rs1370709290 1954 dbSNP
rs1260029344 1959 dbSNP
rs553839274 1960 dbSNP
rs1345477380 1967 dbSNP
rs1201904602 1969 dbSNP
rs1394968612 1973 dbSNP
rs1259879565 1976 dbSNP
rs1171979111 1983 dbSNP
rs1454052759 1985 dbSNP
rs1394243608 1987 dbSNP
rs1199327418 1988 dbSNP
rs1434769200 1996 dbSNP
rs1248370343 1997 dbSNP
rs1046927745 1998 dbSNP
rs1194691063 1999 dbSNP
rs1480661615 2003 dbSNP
rs1018920458 2004 dbSNP
rs1484810829 2007 dbSNP
rs1208260370 2008 dbSNP
rs888397589 2011 dbSNP
rs1304541648 2020 dbSNP
rs879523407 2020 dbSNP
rs1034786457 2035 dbSNP
rs571602175 2036 dbSNP
rs1473591292 2039 dbSNP
rs1372483289 2044 dbSNP
rs1014727207 2046 dbSNP
rs952306539 2048 dbSNP
rs1434283306 2050 dbSNP
rs1376297645 2053 dbSNP
rs984940880 2082 dbSNP
rs1024412602 2089 dbSNP
rs967500227 2097 dbSNP
rs977595728 2099 dbSNP
rs1033257174 2105 dbSNP
rs957649779 2111 dbSNP
rs1433695831 2113 dbSNP
rs947571785 2125 dbSNP
rs1185166639 2127 dbSNP
rs1278914713 2130 dbSNP
rs1201869500 2133 dbSNP
rs561039995 2134 dbSNP
rs1260576525 2140 dbSNP
rs1240376378 2143 dbSNP
rs1352884273 2147 dbSNP
rs989144448 2150 dbSNP
rs1291448619 2151 dbSNP
rs534058287 2152 dbSNP
rs189950912 2166 dbSNP
rs961129918 2171 dbSNP
rs1399219031 2175 dbSNP
rs1382489888 2176 dbSNP
rs542590491 2180 dbSNP
rs1157794524 2185 dbSNP
rs1457640822 2197 dbSNP
rs1414134000 2199 dbSNP
rs910848362 2203 dbSNP
rs1474580215 2208 dbSNP
rs927763347 2226 dbSNP
rs942397173 2239 dbSNP
rs939001328 2240 dbSNP
rs976865925 2243 dbSNP
rs1261406076 2248 dbSNP
rs1306216493 2248 dbSNP
rs1331540388 2255 dbSNP
rs750815410 2256 dbSNP
rs116191356 2264 dbSNP
rs140171307 2269 dbSNP
rs763101386 2281 dbSNP
rs941309609 2285 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 130507.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acUCUGUCCAAGUACGACGAUa 5'
            | |:|  | |||||||||| 
Target 5' auACAUACAUGCAUGCUGCUAa 3'
 		15 - 36
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000272793.5 | 3UTR | AAAAUUGUACUUGAAUACAUACAUGCAUGCUGCUAAACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000272793.5 | 3UTR | AAAAUUGUACUUGAAUACAUACAUGCAUGCUGCUAAACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
180 hsa-miR-4524a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055251 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT055826 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT060573 CCND1 cyclin D1 2 2
MIRT061013 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT064694 CCND2 cyclin D2 2 4
MIRT075268 SNTB2 syntrophin beta 2 2 4
MIRT079668 NAPG NSF attachment protein gamma 2 12
MIRT081651 CCNE1 cyclin E1 2 4
MIRT082996 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083463 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT085755 RIF1 replication timing regulatory factor 1 2 2
MIRT086022 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087431 ZNRF3 zinc and ring finger 3 2 2
MIRT088786 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT089221 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT093696 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095090 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT096249 CANX calnexin 2 2
MIRT100215 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100746 VEGFA vascular endothelial growth factor A 2 12
MIRT100904 CD2AP CD2 associated protein 2 2
MIRT102647 UBN2 ubinuclein 2 2 10
MIRT103882 FOXK1 forkhead box K1 2 2
MIRT104246 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106310 ZFHX4 zinc finger homeobox 4 2 6
MIRT107696 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT114943 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117671 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT133799 SKI SKI proto-oncogene 2 2
MIRT140167 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142279 DCTN5 dynactin subunit 5 2 8
MIRT143288 N4BP1 NEDD4 binding protein 1 2 2
MIRT165939 CREBRF CREB3 regulatory factor 2 2
MIRT175251 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT186381 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT191470 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT196480 TAOK1 TAO kinase 1 2 2
MIRT201470 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204615 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204646 MOB4 MOB family member 4, phocein 2 8
MIRT204749 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206031 NUP50 nucleoporin 50 2 6
MIRT211196 FGF2 fibroblast growth factor 2 2 4
MIRT229353 ZNF449 zinc finger protein 449 2 2
MIRT247138 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT249461 ZNF691 zinc finger protein 691 2 4
MIRT256314 CDC42SE2 CDC42 small effector 2 2 2
MIRT258419 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265083 CHEK1 checkpoint kinase 1 2 2
MIRT270561 SETD1B SET domain containing 1B 2 2
MIRT274749 RAB3IP RAB3A interacting protein 2 2
MIRT277515 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT289642 CBX2 chromobox 2 2 2
MIRT301001 MTMR3 myotubularin related protein 3 2 2
MIRT307149 CTDSPL CTD small phosphatase like 2 4
MIRT309021 USP53 ubiquitin specific peptidase 53 2 2
MIRT314100 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT319338 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320619 ZNRF2 zinc and ring finger 2 2 2
MIRT324285 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT446498 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT448437 TLL1 tolloid like 1 2 2
MIRT461537 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463162 ZNF367 zinc finger protein 367 2 10
MIRT463493 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT465154 TSC22D2 TSC22 domain family member 2 2 2
MIRT466418 TFAP2A transcription factor AP-2 alpha 2 8
MIRT468278 SFT2D2 SFT2 domain containing 2 2 2
MIRT469399 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471941 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT473688 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT479618 CDC25A cell division cycle 25A 2 2
MIRT482098 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483995 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485205 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT498763 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT498961 ORC4 origin recognition complex subunit 4 2 8
MIRT499440 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500080 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500305 ZNF622 zinc finger protein 622 2 8
MIRT500410 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500789 TLK1 tousled like kinase 1 2 6
MIRT500930 SRPR SRP receptor alpha subunit 2 6
MIRT500943 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501068 SMAD7 SMAD family member 7 2 8
MIRT501711 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT502627 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502910 CDCA4 cell division cycle associated 4 2 8
MIRT502935 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504531 ZNF620 zinc finger protein 620 2 6
MIRT505106 YTHDC1 YTH domain containing 1 2 6
MIRT505337 TMEM245 transmembrane protein 245 2 6
MIRT505383 TMEM100 transmembrane protein 100 2 2
MIRT505678 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506157 PLAG1 PLAG1 zinc finger 2 8
MIRT506183 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506475 MYO5A myosin VA 2 6
MIRT506826 KIF23 kinesin family member 23 2 6
MIRT507160 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT507511 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT507845 CCNE2 cyclin E2 2 6
MIRT510403 ZNF507 zinc finger protein 507 2 2
MIRT518078 TRIM35 tripartite motif containing 35 2 2
MIRT518982 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521045 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521190 SBNO1 strawberry notch homolog 1 2 6
MIRT522088 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT524846 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT527787 TMEM44 transmembrane protein 44 2 4
MIRT537803 EFNB2 ephrin B2 2 4
MIRT540830 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541140 PISD phosphatidylserine decarboxylase 2 2
MIRT541419 CBX4 chromobox 4 2 2
MIRT543517 PRSS21 protease, serine 21 2 2
MIRT543824 GSG1 germ cell associated 1 2 2
MIRT544959 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545179 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545335 CCDC83 coiled-coil domain containing 83 2 2
MIRT545518 RSL24D1 ribosomal L24 domain containing 1 2 2
MIRT545670 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545931 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546102 USP48 ubiquitin specific peptidase 48 2 4
MIRT546598 SALL1 spalt like transcription factor 1 2 4
MIRT546626 RTN4 reticulon 4 2 2
MIRT547651 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547987 HCFC2 host cell factor C2 2 4
MIRT548717 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548931 CDK17 cyclin dependent kinase 17 2 2
MIRT549067 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549266 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT550460 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550806 FAM229B family with sequence similarity 229 member B 2 2
MIRT552024 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552334 ZNF704 zinc finger protein 704 2 2
MIRT552732 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553795 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554694 RNF149 ring finger protein 149 2 2
MIRT555133 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555264 PRDM4 PR/SET domain 4 2 2
MIRT556848 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557474 GPR27 G protein-coupled receptor 27 2 4
MIRT558018 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558498 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558579 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558610 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT558650 CNKSR3 CNKSR family member 3 2 2
MIRT558986 CA8 carbonic anhydrase 8 2 2
MIRT559141 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559327 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT562021 LANCL1 LanC like 1 2 2
MIRT562869 KIAA1456 KIAA1456 2 2
MIRT563074 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563496 DLGAP3 DLG associated protein 3 2 2
MIRT563890 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564311 CCNT1 cyclin T1 2 2
MIRT564942 XKR7 XK related 7 2 2
MIRT564979 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565423 TEF TEF, PAR bZIP transcription factor 2 2
MIRT566824 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571961 KIF5B kinesin family member 5B 2 2
MIRT575877 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT576523 Txlna taxilin alpha 2 2
MIRT614693 TRAK1 trafficking kinesin protein 1 2 2
MIRT616065 ZC3H14 zinc finger CCCH-type containing 14 2 2
MIRT618838 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT624626 ATXN2 ataxin 2 2 2
MIRT624652 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT640314 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT659248 CUL3 cullin 3 2 2
MIRT680972 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682261 RS1 retinoschisin 1 2 2
MIRT682505 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693904 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT699214 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT699373 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699451 SLC16A9 solute carrier family 16 member 9 2 2
MIRT701230 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT702849 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT706163 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT718990 UTP15 UTP15, small subunit processome component 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4524a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4524a-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission