miRTarBase - #MIRT086429


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol NABP1   
Synonyms OBFC2A, SOSS-B2, SSB2
Description nucleic acid binding protein 1
Transcript NM_001031716   
Expression
Putative miRNA Targets on NABP1
3'UTR of NABP1
(miRNA target sites are highlighted)		 
>NABP1|NM_001031716|3'UTR
   1 CCTATGCTAAATACTCATGTGTAGTTTTTATACTACATGCCCTACTTGAACACTTATTGCACTTTTATTTATTGTTAACT
  81 GTGAAAAGTACGTCCTTTATTGGGTTTCCTTTTATATTCTTGGTTTGTTAAGAAGAATGGTTTGTTTTTATAGCAAAACT
 161 GTTAAGCTGCTCGAGTCTCCTGTTGAAGAATGGGAACACTGAAAAGTAGGGGCATTTATTTTTAGAGTAAAAAGATTATT
 241 GGATAGCCTTTAAAAAACCTGCACCCATTTCATGGGTGAGTTACTTAAGACATCAGCTTTATAGCCTCTATGAGTCTATC
 321 TTCTGTATAAGTTTTGTAATATTTAACATAAGGCTTAATGGGAGATGTTCTTTTGTCTTGTATTCAGATATTGCCAACTA
 401 AAGCAATAACCATCAAAAAACACAAGAACTTGTCAATGCTAGCAGTAATTTTTGAGTGTTTGTGGCTCTCGGAATGATTG
 481 ACTTCGTTCAGTGACTACTATTAAGATTTTCCAAGGACTGACTCATCCCAAATTTTTGTTGTATTACCAAAAAAACAGAT
 561 TCCTTATCAGAATTTGGAATAGAATGTGATCTCTATTGCAACAAGTAATTTTAAAAGAAAGCTACATTTATTTTAGAGTA
 641 GTGCTCCTAACATGTATTATCAACTTTGTGGATTACATTGGAGGAAAATTTAAAACTGGGGCCTTGAATATTTATTTTTT
 721 GAAACTACCATGTTAAATACTGAAGTATAATTTGGGGGAGTTATAAAGTTATGATAAACATTCATCTGATTATTTTAAAC
 801 AATAGTTGTGGTAGATAAACATACTGGAGGTGAGTCAAATTGAATTCATATAGTAACATGCAGTCTGAAGTCCTAGTTAC
 881 TTAATAGGTACTCAGCCTGGAGTGAAAATCCTGGGTACTGACTTTGAGAGGAGTGAGTGTGCATGTTGTCAAAGTTTCTG
 961 AACACAGTTCACATAGCCTTATTAGCAAAAGTTTTAAGAAATGGCTCTATCAAAGAAGCAATTGCAGCTTTATTCAGAAA
1041 TATAAAAGTGGAATTTATGTACATGTCATAAGTGGTACCCACTTCCCCTTTTTACTGTAGGGTGGATAACTCTTAGGATT
1121 TAACTCTTTGAATATTATCTCTTGAATAAAGCATGTGTTAATGTTAACAAACCTACGTAATTTTTGCCCTTTCAATGACT
1201 TACAGTGGAGAGCCAGTACATCTTAACTACTGTTGTAGTGATGGTATCAACCTCATGGTTACTTAGCTCTGCATTTGTTG
1281 CTTTGTTTTTTTTCCACTTCAAATCACAAAATAAGTAGATTTTGTTTTCTGAAAACTCCATAGCATTTGAATACAAAAAG
1361 TTGTGCCAGATTGTTTGCCCTAATTCACTGTGTTTAACAAATATTTCAGTACACACTATGTATTAGGCACTGTGTGGAAA
1441 GTGTTAAGGGGTAGACAAAATACCGAATAATCTCCACAAGTTTATTTGTGGTCTATAGTACTTTTGTAACTGGGGTTACA
1521 AAAATTATAGAAATTTTTTTCCTTTGTTCATATGCATATTCATGATTATAATTTGGCTTTGTTTGTGATTAATGTTTTCT
1601 TAAGATTTTCACATTATAGAATACCTCAAAAGAAGTTGTCTAAGGACTGGGATAGAGAGTATGTTTCATAAAATTGTAGA
1681 TGTTTAGAATTTTTAAAAACCCTACAAATTAGTATATGATTGTTTTATATAAGTAAGATAGGAGCAACACTTTAAATTAT
1761 TTGTGGGAGAATACAGCATTAAAGGTGATTTTAAAAGAAAAAAATTTGGAATTTTAGAAAATTTAAATGCTGTCAGGTAT
1841 GGAATGCTGGGCTTCCAATCCTGGCCTCATTGTCTCCTCACCTGTGATGTTGGATGAGTTATTACACTTGAAATGTCTTT
1921 AAGCCTTAGGTTCCACAAGTATGAAAACAAGTAAGTAACAGTATCCTTTCTAGACTTGTTTAAGATTTCCATGTAAGTAA
2001 TTATAATGACTTCTGACACATAATAATGTCGTCTTATACCCCAACAGTAGGAAAAAAATGCAGAATTCAGTATGAAAGTA
2081 TTGTTACCCTTTAACACAGTGGTCCCCAACCTTTTTGGCACCAGAGACCAGTCTCCTGGAAGACAGTTTTTCCGTGGGAT
2161 CGGGGGATGGTTTTGGGATGAAACTGTTCCACCTCAGGTCATCAGTCATTAGTTAGATTCTCATAAGGAGCGTGCAACCT
2241 CAATCCCTTGCATACTCATTTCACAATAGGGTTCATGCTCCTATGAGAATCTAATGCCACCACTCATCTGACAGGAGGTG
2321 GAGCTCAGGCAGTAAGTCTCCCTCGCCCGCCACTCACCTGCTGGGCGTTCCTGTTCCTAGCAGGCCAGAATTGATACTGA
2401 TCTAGGGGTTGGGGACCCCTGCTTAACATGTTGAGATTAAATGGAGAAAGACTTAAGCTTTTACTTTTGTGATTGACACT
2481 TGCTTCAATAATGTAACCTTGTTCTGTGTTTTTATCATTTATTAACAAATTTCTTTTTTCTTAAGGGAAGCCTCCAAAAT
2561 CAAAGAAAAGTGAGTTACAATCCATAATGAATATTTGCCTTACCAGCCTACTGGAACACATTCATCAAGAACTTAAGAGG
2641 AAGAAAGTTTTCTGCCTTCCTCCTTCCTAGTGCTCTCAGCTATCAACTTTGAAATAAGTTTAAACAACACCTACTGAAAA
2721 CAAAAACCACTTAGTATAAAAATATCCCCCACCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaGUUCCAGGCGACACUUGUGc 5'
            ||| ||   :| ||||||| 
Target 5' gtCAAAGT---TTCTGAACACa 3'
 948 - 966 153.00 -9.40
2 
miRNA  3' uaGUUCCAGGCGACACUUGUGc 5'
            || |  |: || ||||||| 
Target 5' taCATGCCCTACT-TGAACACt 3'
 34 - 54 151.00 -9.00
3 
miRNA  3' uagUUCCAGG---CG-ACACUUGUGc 5'
             ||  |||   || | ||||:|| 
Target 5' tgaAAACTCCATAGCATTTGAATACa 3'
 1330 - 1355 135.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM368780 1 COSMIC
COSN1230765 3 COSMIC
COSN8608268 42 COSMIC
COSN26985799 60 COSMIC
COSN30156347 94 COSMIC
COSN31500349 104 COSMIC
COSN31538634 104 COSMIC
COSN1082705 177 COSMIC
COSN17037956 263 COSMIC
COSN21192322 272 COSMIC
COSN31778267 542 COSMIC
COSN8276111 773 COSMIC
COSN7153628 898 COSMIC
COSN1814318 1015 COSMIC
COSN6160556 1176 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778305675 2 dbSNP
rs746025656 3 dbSNP
rs1286524289 4 dbSNP
rs772278872 5 dbSNP
rs374137362 7 dbSNP
rs370226702 9 dbSNP
rs771639506 16 dbSNP
rs138938008 17 dbSNP
rs964814245 17 dbSNP
rs1310176300 18 dbSNP
rs1374559861 20 dbSNP
rs1209917559 22 dbSNP
rs777535472 24 dbSNP
rs1483835978 28 dbSNP
rs746874507 36 dbSNP
rs974580901 38 dbSNP
rs770825440 41 dbSNP
rs1482494636 45 dbSNP
rs776601448 46 dbSNP
rs759416351 47 dbSNP
rs769876341 52 dbSNP
rs1274966391 56 dbSNP
rs562459827 58 dbSNP
rs73981875 59 dbSNP
rs930584276 63 dbSNP
rs1309173066 72 dbSNP
rs1380572312 74 dbSNP
rs972199233 80 dbSNP
rs1408134376 85 dbSNP
rs1370155095 89 dbSNP
rs148854234 92 dbSNP
rs919027348 93 dbSNP
rs930100584 101 dbSNP
rs1212084738 121 dbSNP
rs1424282541 123 dbSNP
rs758763961 140 dbSNP
rs1179355497 144 dbSNP
rs908564307 149 dbSNP
rs1252078704 155 dbSNP
rs143739448 161 dbSNP
rs557867060 166 dbSNP
rs888695827 173 dbSNP
rs768363623 180 dbSNP
rs527410275 181 dbSNP
rs1264010779 182 dbSNP
rs942964829 191 dbSNP
rs1322828859 193 dbSNP
rs1162443459 210 dbSNP
rs1226644647 211 dbSNP
rs1350014016 214 dbSNP
rs547537993 236 dbSNP
rs1002693482 242 dbSNP
rs1393293006 245 dbSNP
rs576561834 247 dbSNP
rs567374544 266 dbSNP
rs893961984 268 dbSNP
rs1011174421 277 dbSNP
rs1260012185 286 dbSNP
rs1430809834 295 dbSNP
rs998217259 298 dbSNP
rs1021181926 307 dbSNP
rs1416555402 312 dbSNP
rs1431048961 321 dbSNP
rs1266296493 335 dbSNP
rs1190947077 338 dbSNP
rs1489051132 343 dbSNP
rs1459393097 349 dbSNP
rs1166693513 354 dbSNP
rs1207321829 359 dbSNP
rs765515106 381 dbSNP
rs892561582 387 dbSNP
rs1268809181 389 dbSNP
rs1010656321 392 dbSNP
rs1241301255 408 dbSNP
rs1022124429 411 dbSNP
rs1300891151 412 dbSNP
rs1429840634 413 dbSNP
rs1286916230 414 dbSNP
rs536528722 415 dbSNP
rs1363731755 424 dbSNP
rs1387127977 436 dbSNP
rs969270385 447 dbSNP
rs1318306865 453 dbSNP
rs1008600250 457 dbSNP
rs1034918053 457 dbSNP
rs1159776195 458 dbSNP
rs753109129 461 dbSNP
rs960621932 466 dbSNP
rs1376712358 467 dbSNP
rs1231500266 471 dbSNP
rs73063329 472 dbSNP
rs918962758 475 dbSNP
rs1255210398 479 dbSNP
rs555941101 482 dbSNP
rs1259364035 486 dbSNP
rs111417143 487 dbSNP
rs1249241044 493 dbSNP
rs1206936171 497 dbSNP
rs1482353709 498 dbSNP
rs1187666450 502 dbSNP
rs113519139 503 dbSNP
rs1234161277 508 dbSNP
rs1350367252 513 dbSNP
rs868675063 520 dbSNP
rs951854927 522 dbSNP
rs1189428929 526 dbSNP
rs558546525 545 dbSNP
rs1320286224 549 dbSNP
rs375218060 549 dbSNP
rs1393778986 550 dbSNP
rs1400804441 551 dbSNP
rs1399760988 554 dbSNP
rs1302923864 565 dbSNP
rs1436151430 574 dbSNP
rs1387959911 583 dbSNP
rs1167074924 584 dbSNP
rs572181653 587 dbSNP
rs1156444055 596 dbSNP
rs373485476 606 dbSNP
rs1052451829 607 dbSNP
rs762892540 613 dbSNP
rs546928394 616 dbSNP
rs1416075360 618 dbSNP
rs1422593637 624 dbSNP
rs1454104990 625 dbSNP
rs892543068 644 dbSNP
rs1211716073 648 dbSNP
rs1486765502 653 dbSNP
rs148142976 672 dbSNP
rs1204175244 673 dbSNP
rs751759688 679 dbSNP
rs1295206158 696 dbSNP
rs1242437124 708 dbSNP
rs1022072278 711 dbSNP
rs1416143434 715 dbSNP
rs555129846 715 dbSNP
rs1223448278 723 dbSNP
rs112377048 730 dbSNP
rs1307093796 731 dbSNP
rs1305104463 735 dbSNP
rs1319146538 736 dbSNP
rs1429494035 745 dbSNP
rs1397583277 748 dbSNP
rs1217800185 756 dbSNP
rs1002004329 761 dbSNP
rs1035314422 766 dbSNP
rs1188713550 773 dbSNP
rs1484985821 780 dbSNP
rs1249875479 787 dbSNP
rs1181658630 791 dbSNP
rs1438616059 800 dbSNP
rs1213565599 802 dbSNP
rs960658219 803 dbSNP
rs1469139852 806 dbSNP
rs1379090523 808 dbSNP
rs1175174248 810 dbSNP
rs1355526082 812 dbSNP
rs1266003329 815 dbSNP
rs1409669947 822 dbSNP
rs1055184671 825 dbSNP
rs1419527098 829 dbSNP
rs972135342 831 dbSNP
rs1287169252 844 dbSNP
rs144037067 849 dbSNP
rs1337191927 851 dbSNP
rs1373317578 854 dbSNP
rs1436535494 856 dbSNP
rs946825419 858 dbSNP
rs1042573881 865 dbSNP
rs544094292 867 dbSNP
rs1009549628 869 dbSNP
rs1166368519 877 dbSNP
rs1390645457 877 dbSNP
rs1359864266 890 dbSNP
rs563923388 891 dbSNP
rs560360932 897 dbSNP
rs1234861162 899 dbSNP
rs1375782164 911 dbSNP
rs752929397 918 dbSNP
rs1027326850 919 dbSNP
rs1450887274 923 dbSNP
rs975589681 931 dbSNP
rs1215419024 933 dbSNP
rs1326998034 934 dbSNP
rs1266890857 940 dbSNP
rs1223904626 951 dbSNP
rs376535365 953 dbSNP
rs1272789706 960 dbSNP
rs1434751162 961 dbSNP
rs778148634 967 dbSNP
rs1327001090 968 dbSNP
rs1015165592 973 dbSNP
rs1387119400 974 dbSNP
rs1319945836 975 dbSNP
rs1052857944 978 dbSNP
rs527611942 984 dbSNP
rs754311857 986 dbSNP
rs913933857 987 dbSNP
rs1477828077 988 dbSNP
rs1395380819 989 dbSNP
rs1195297868 991 dbSNP
rs946784841 992 dbSNP
rs190262813 1002 dbSNP
rs757714406 1005 dbSNP
rs1215881582 1006 dbSNP
rs1436765789 1012 dbSNP
rs1275915154 1022 dbSNP
rs1201821959 1025 dbSNP
rs1234314510 1042 dbSNP
rs905293011 1045 dbSNP
rs1304567614 1048 dbSNP
rs1001953587 1064 dbSNP
rs1363603038 1079 dbSNP
rs1320549818 1082 dbSNP
rs1431554761 1087 dbSNP
rs530230274 1088 dbSNP
rs1056337612 1095 dbSNP
rs779387034 1096 dbSNP
rs1414079498 1098 dbSNP
rs937959061 1103 dbSNP
rs1175252642 1106 dbSNP
rs1447506533 1107 dbSNP
rs146903596 1114 dbSNP
rs993454666 1123 dbSNP
rs915365786 1146 dbSNP
rs1235202567 1154 dbSNP
rs1208846274 1161 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 64859.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 64859.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission