miRTarBase - #MIRT086450


—
pre-miRNA Information
pre-miRNA hsa-mir-5697   
Genomic Coordinates chr1: 9967381 - 9967458
Description Homo sapiens miR-5697 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5697
Sequence 10| UCAAGUAGUUUCAUGAUAAAGG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1331648425 1 dbSNP
rs1473721376 8 dbSNP
rs1182430201 14 dbSNP
rs1412783585 21 dbSNP
Putative Targets

Gene Information
Gene Symbol NABP1   
Synonyms OBFC2A, SOSS-B2, SSB2
Description nucleic acid binding protein 1
Transcript NM_001031716   
Expression
Putative miRNA Targets on NABP1
3'UTR of NABP1
(miRNA target sites are highlighted)		 
>NABP1|NM_001031716|3'UTR
   1 CCTATGCTAAATACTCATGTGTAGTTTTTATACTACATGCCCTACTTGAACACTTATTGCACTTTTATTTATTGTTAACT
  81 GTGAAAAGTACGTCCTTTATTGGGTTTCCTTTTATATTCTTGGTTTGTTAAGAAGAATGGTTTGTTTTTATAGCAAAACT
 161 GTTAAGCTGCTCGAGTCTCCTGTTGAAGAATGGGAACACTGAAAAGTAGGGGCATTTATTTTTAGAGTAAAAAGATTATT
 241 GGATAGCCTTTAAAAAACCTGCACCCATTTCATGGGTGAGTTACTTAAGACATCAGCTTTATAGCCTCTATGAGTCTATC
 321 TTCTGTATAAGTTTTGTAATATTTAACATAAGGCTTAATGGGAGATGTTCTTTTGTCTTGTATTCAGATATTGCCAACTA
 401 AAGCAATAACCATCAAAAAACACAAGAACTTGTCAATGCTAGCAGTAATTTTTGAGTGTTTGTGGCTCTCGGAATGATTG
 481 ACTTCGTTCAGTGACTACTATTAAGATTTTCCAAGGACTGACTCATCCCAAATTTTTGTTGTATTACCAAAAAAACAGAT
 561 TCCTTATCAGAATTTGGAATAGAATGTGATCTCTATTGCAACAAGTAATTTTAAAAGAAAGCTACATTTATTTTAGAGTA
 641 GTGCTCCTAACATGTATTATCAACTTTGTGGATTACATTGGAGGAAAATTTAAAACTGGGGCCTTGAATATTTATTTTTT
 721 GAAACTACCATGTTAAATACTGAAGTATAATTTGGGGGAGTTATAAAGTTATGATAAACATTCATCTGATTATTTTAAAC
 801 AATAGTTGTGGTAGATAAACATACTGGAGGTGAGTCAAATTGAATTCATATAGTAACATGCAGTCTGAAGTCCTAGTTAC
 881 TTAATAGGTACTCAGCCTGGAGTGAAAATCCTGGGTACTGACTTTGAGAGGAGTGAGTGTGCATGTTGTCAAAGTTTCTG
 961 AACACAGTTCACATAGCCTTATTAGCAAAAGTTTTAAGAAATGGCTCTATCAAAGAAGCAATTGCAGCTTTATTCAGAAA
1041 TATAAAAGTGGAATTTATGTACATGTCATAAGTGGTACCCACTTCCCCTTTTTACTGTAGGGTGGATAACTCTTAGGATT
1121 TAACTCTTTGAATATTATCTCTTGAATAAAGCATGTGTTAATGTTAACAAACCTACGTAATTTTTGCCCTTTCAATGACT
1201 TACAGTGGAGAGCCAGTACATCTTAACTACTGTTGTAGTGATGGTATCAACCTCATGGTTACTTAGCTCTGCATTTGTTG
1281 CTTTGTTTTTTTTCCACTTCAAATCACAAAATAAGTAGATTTTGTTTTCTGAAAACTCCATAGCATTTGAATACAAAAAG
1361 TTGTGCCAGATTGTTTGCCCTAATTCACTGTGTTTAACAAATATTTCAGTACACACTATGTATTAGGCACTGTGTGGAAA
1441 GTGTTAAGGGGTAGACAAAATACCGAATAATCTCCACAAGTTTATTTGTGGTCTATAGTACTTTTGTAACTGGGGTTACA
1521 AAAATTATAGAAATTTTTTTCCTTTGTTCATATGCATATTCATGATTATAATTTGGCTTTGTTTGTGATTAATGTTTTCT
1601 TAAGATTTTCACATTATAGAATACCTCAAAAGAAGTTGTCTAAGGACTGGGATAGAGAGTATGTTTCATAAAATTGTAGA
1681 TGTTTAGAATTTTTAAAAACCCTACAAATTAGTATATGATTGTTTTATATAAGTAAGATAGGAGCAACACTTTAAATTAT
1761 TTGTGGGAGAATACAGCATTAAAGGTGATTTTAAAAGAAAAAAATTTGGAATTTTAGAAAATTTAAATGCTGTCAGGTAT
1841 GGAATGCTGGGCTTCCAATCCTGGCCTCATTGTCTCCTCACCTGTGATGTTGGATGAGTTATTACACTTGAAATGTCTTT
1921 AAGCCTTAGGTTCCACAAGTATGAAAACAAGTAAGTAACAGTATCCTTTCTAGACTTGTTTAAGATTTCCATGTAAGTAA
2001 TTATAATGACTTCTGACACATAATAATGTCGTCTTATACCCCAACAGTAGGAAAAAAATGCAGAATTCAGTATGAAAGTA
2081 TTGTTACCCTTTAACACAGTGGTCCCCAACCTTTTTGGCACCAGAGACCAGTCTCCTGGAAGACAGTTTTTCCGTGGGAT
2161 CGGGGGATGGTTTTGGGATGAAACTGTTCCACCTCAGGTCATCAGTCATTAGTTAGATTCTCATAAGGAGCGTGCAACCT
2241 CAATCCCTTGCATACTCATTTCACAATAGGGTTCATGCTCCTATGAGAATCTAATGCCACCACTCATCTGACAGGAGGTG
2321 GAGCTCAGGCAGTAAGTCTCCCTCGCCCGCCACTCACCTGCTGGGCGTTCCTGTTCCTAGCAGGCCAGAATTGATACTGA
2401 TCTAGGGGTTGGGGACCCCTGCTTAACATGTTGAGATTAAATGGAGAAAGACTTAAGCTTTTACTTTTGTGATTGACACT
2481 TGCTTCAATAATGTAACCTTGTTCTGTGTTTTTATCATTTATTAACAAATTTCTTTTTTCTTAAGGGAAGCCTCCAAAAT
2561 CAAAGAAAAGTGAGTTACAATCCATAATGAATATTTGCCTTACCAGCCTACTGGAACACATTCATCAAGAACTTAAGAGG
2641 AAGAAAGTTTTCTGCCTTCCTCCTTCCTAGTGCTCTCAGCTATCAACTTTGAAATAAGTTTAAACAACACCTACTGAAAA
2721 CAAAAACCACTTAGTATAAAAATATCCCCCACCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggAAAUA----GUACUUUGAUGAACu 5'
            |||||    ||||   ||||||| 
Target 5' ttTTTATACTACATG-CCCTACTTGa 3'
 25 - 49 157.00 -13.30
2 
miRNA  3' ggaaauaGUACUUUGAUGAACu 5'
                 | | |||:||:||| 
Target 5' agcaacaCTTTAAATTATTTGt 3'
 1743 - 1764 127.00 -6.90
3 
miRNA  3' ggaaAUAGUAC---UUUGAUGAAcu 5'
              | |||||   :|::|||||  
Target 5' cccaTTTCATGGGTGAGTTACTTaa 3'
 264 - 288 126.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM368780 1 COSMIC
COSN1230765 3 COSMIC
COSN8608268 42 COSMIC
COSN26985799 60 COSMIC
COSN30156347 94 COSMIC
COSN31500349 104 COSMIC
COSN31538634 104 COSMIC
COSN1082705 177 COSMIC
COSN17037956 263 COSMIC
COSN21192322 272 COSMIC
COSN31778267 542 COSMIC
COSN8276111 773 COSMIC
COSN7153628 898 COSMIC
COSN1814318 1015 COSMIC
COSN6160556 1176 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778305675 2 dbSNP
rs746025656 3 dbSNP
rs1286524289 4 dbSNP
rs772278872 5 dbSNP
rs374137362 7 dbSNP
rs370226702 9 dbSNP
rs771639506 16 dbSNP
rs138938008 17 dbSNP
rs964814245 17 dbSNP
rs1310176300 18 dbSNP
rs1374559861 20 dbSNP
rs1209917559 22 dbSNP
rs777535472 24 dbSNP
rs1483835978 28 dbSNP
rs746874507 36 dbSNP
rs974580901 38 dbSNP
rs770825440 41 dbSNP
rs1482494636 45 dbSNP
rs776601448 46 dbSNP
rs759416351 47 dbSNP
rs769876341 52 dbSNP
rs1274966391 56 dbSNP
rs562459827 58 dbSNP
rs73981875 59 dbSNP
rs930584276 63 dbSNP
rs1309173066 72 dbSNP
rs1380572312 74 dbSNP
rs972199233 80 dbSNP
rs1408134376 85 dbSNP
rs1370155095 89 dbSNP
rs148854234 92 dbSNP
rs919027348 93 dbSNP
rs930100584 101 dbSNP
rs1212084738 121 dbSNP
rs1424282541 123 dbSNP
rs758763961 140 dbSNP
rs1179355497 144 dbSNP
rs908564307 149 dbSNP
rs1252078704 155 dbSNP
rs143739448 161 dbSNP
rs557867060 166 dbSNP
rs888695827 173 dbSNP
rs768363623 180 dbSNP
rs527410275 181 dbSNP
rs1264010779 182 dbSNP
rs942964829 191 dbSNP
rs1322828859 193 dbSNP
rs1162443459 210 dbSNP
rs1226644647 211 dbSNP
rs1350014016 214 dbSNP
rs547537993 236 dbSNP
rs1002693482 242 dbSNP
rs1393293006 245 dbSNP
rs576561834 247 dbSNP
rs567374544 266 dbSNP
rs893961984 268 dbSNP
rs1011174421 277 dbSNP
rs1260012185 286 dbSNP
rs1430809834 295 dbSNP
rs998217259 298 dbSNP
rs1021181926 307 dbSNP
rs1416555402 312 dbSNP
rs1431048961 321 dbSNP
rs1266296493 335 dbSNP
rs1190947077 338 dbSNP
rs1489051132 343 dbSNP
rs1459393097 349 dbSNP
rs1166693513 354 dbSNP
rs1207321829 359 dbSNP
rs765515106 381 dbSNP
rs892561582 387 dbSNP
rs1268809181 389 dbSNP
rs1010656321 392 dbSNP
rs1241301255 408 dbSNP
rs1022124429 411 dbSNP
rs1300891151 412 dbSNP
rs1429840634 413 dbSNP
rs1286916230 414 dbSNP
rs536528722 415 dbSNP
rs1363731755 424 dbSNP
rs1387127977 436 dbSNP
rs969270385 447 dbSNP
rs1318306865 453 dbSNP
rs1008600250 457 dbSNP
rs1034918053 457 dbSNP
rs1159776195 458 dbSNP
rs753109129 461 dbSNP
rs960621932 466 dbSNP
rs1376712358 467 dbSNP
rs1231500266 471 dbSNP
rs73063329 472 dbSNP
rs918962758 475 dbSNP
rs1255210398 479 dbSNP
rs555941101 482 dbSNP
rs1259364035 486 dbSNP
rs111417143 487 dbSNP
rs1249241044 493 dbSNP
rs1206936171 497 dbSNP
rs1482353709 498 dbSNP
rs1187666450 502 dbSNP
rs113519139 503 dbSNP
rs1234161277 508 dbSNP
rs1350367252 513 dbSNP
rs868675063 520 dbSNP
rs951854927 522 dbSNP
rs1189428929 526 dbSNP
rs558546525 545 dbSNP
rs1320286224 549 dbSNP
rs375218060 549 dbSNP
rs1393778986 550 dbSNP
rs1400804441 551 dbSNP
rs1399760988 554 dbSNP
rs1302923864 565 dbSNP
rs1436151430 574 dbSNP
rs1387959911 583 dbSNP
rs1167074924 584 dbSNP
rs572181653 587 dbSNP
rs1156444055 596 dbSNP
rs373485476 606 dbSNP
rs1052451829 607 dbSNP
rs762892540 613 dbSNP
rs546928394 616 dbSNP
rs1416075360 618 dbSNP
rs1422593637 624 dbSNP
rs1454104990 625 dbSNP
rs892543068 644 dbSNP
rs1211716073 648 dbSNP
rs1486765502 653 dbSNP
rs148142976 672 dbSNP
rs1204175244 673 dbSNP
rs751759688 679 dbSNP
rs1295206158 696 dbSNP
rs1242437124 708 dbSNP
rs1022072278 711 dbSNP
rs1416143434 715 dbSNP
rs555129846 715 dbSNP
rs1223448278 723 dbSNP
rs112377048 730 dbSNP
rs1307093796 731 dbSNP
rs1305104463 735 dbSNP
rs1319146538 736 dbSNP
rs1429494035 745 dbSNP
rs1397583277 748 dbSNP
rs1217800185 756 dbSNP
rs1002004329 761 dbSNP
rs1035314422 766 dbSNP
rs1188713550 773 dbSNP
rs1484985821 780 dbSNP
rs1249875479 787 dbSNP
rs1181658630 791 dbSNP
rs1438616059 800 dbSNP
rs1213565599 802 dbSNP
rs960658219 803 dbSNP
rs1469139852 806 dbSNP
rs1379090523 808 dbSNP
rs1175174248 810 dbSNP
rs1355526082 812 dbSNP
rs1266003329 815 dbSNP
rs1409669947 822 dbSNP
rs1055184671 825 dbSNP
rs1419527098 829 dbSNP
rs972135342 831 dbSNP
rs1287169252 844 dbSNP
rs144037067 849 dbSNP
rs1337191927 851 dbSNP
rs1373317578 854 dbSNP
rs1436535494 856 dbSNP
rs946825419 858 dbSNP
rs1042573881 865 dbSNP
rs544094292 867 dbSNP
rs1009549628 869 dbSNP
rs1166368519 877 dbSNP
rs1390645457 877 dbSNP
rs1359864266 890 dbSNP
rs563923388 891 dbSNP
rs560360932 897 dbSNP
rs1234861162 899 dbSNP
rs1375782164 911 dbSNP
rs752929397 918 dbSNP
rs1027326850 919 dbSNP
rs1450887274 923 dbSNP
rs975589681 931 dbSNP
rs1215419024 933 dbSNP
rs1326998034 934 dbSNP
rs1266890857 940 dbSNP
rs1223904626 951 dbSNP
rs376535365 953 dbSNP
rs1272789706 960 dbSNP
rs1434751162 961 dbSNP
rs778148634 967 dbSNP
rs1327001090 968 dbSNP
rs1015165592 973 dbSNP
rs1387119400 974 dbSNP
rs1319945836 975 dbSNP
rs1052857944 978 dbSNP
rs527611942 984 dbSNP
rs754311857 986 dbSNP
rs913933857 987 dbSNP
rs1477828077 988 dbSNP
rs1395380819 989 dbSNP
rs1195297868 991 dbSNP
rs946784841 992 dbSNP
rs190262813 1002 dbSNP
rs757714406 1005 dbSNP
rs1215881582 1006 dbSNP
rs1436765789 1012 dbSNP
rs1275915154 1022 dbSNP
rs1201821959 1025 dbSNP
rs1234314510 1042 dbSNP
rs905293011 1045 dbSNP
rs1304567614 1048 dbSNP
rs1001953587 1064 dbSNP
rs1363603038 1079 dbSNP
rs1320549818 1082 dbSNP
rs1431554761 1087 dbSNP
rs530230274 1088 dbSNP
rs1056337612 1095 dbSNP
rs779387034 1096 dbSNP
rs1414079498 1098 dbSNP
rs937959061 1103 dbSNP
rs1175252642 1106 dbSNP
rs1447506533 1107 dbSNP
rs146903596 1114 dbSNP
rs993454666 1123 dbSNP
rs915365786 1146 dbSNP
rs1235202567 1154 dbSNP
rs1208846274 1161 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 64859.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 64859.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000410026.2 | 3UTR | CCCUACUUGAACACUUAUUGCACUUUUAUUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
139 hsa-miR-5697 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055801 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT066822 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT067331 SESN2 sestrin 2 2 4
MIRT072105 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 4
MIRT080621 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT085213 SLC5A3 solute carrier family 5 member 3 2 4
MIRT086450 NABP1 nucleic acid binding protein 1 2 6
MIRT087916 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT089461 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT089610 MAT2A methionine adenosyltransferase 2A 2 10
MIRT107597 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT116036 DEPDC1 DEP domain containing 1 2 6
MIRT147331 KPNA2 karyopherin subunit alpha 2 2 10
MIRT206552 RHOQ ras homolog family member Q 2 2
MIRT211198 FGF2 fibroblast growth factor 2 2 6
MIRT215297 CREBRF CREB3 regulatory factor 2 2
MIRT227712 TBC1D13 TBC1 domain family member 13 2 2
MIRT243969 MAP1B microtubule associated protein 1B 2 2
MIRT250417 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT294604 ZNF460 zinc finger protein 460 2 2
MIRT300122 STRADB STE20-related kinase adaptor beta 2 2
MIRT354709 SLC25A36 solute carrier family 25 member 36 2 2
MIRT442368 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT443617 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT444711 ZNF772 zinc finger protein 772 2 2
MIRT447556 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT448685 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT450817 LIFR LIF receptor alpha 2 2
MIRT451368 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT457302 ZBTB45 zinc finger and BTB domain containing 45 2 2
MIRT458779 CES2 carboxylesterase 2 2 2
MIRT458864 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT460276 SLC26A2 solute carrier family 26 member 2 2 2
MIRT461711 ZNF426 zinc finger protein 426 2 2
MIRT466690 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT468811 SACS sacsin molecular chaperone 2 10
MIRT476013 GTF2A1 general transcription factor IIA subunit 1 2 8
MIRT477764 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT478541 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT479230 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT479980 CARD10 caspase recruitment domain family member 10 2 2
MIRT480800 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT482442 ADM adrenomedullin 2 10
MIRT487566 LOXL2 lysyl oxidase like 2 2 2
MIRT499512 RNF6 ring finger protein 6 2 6
MIRT501861 MTDH metadherin 2 2
MIRT502460 FRAT2 FRAT2, WNT signaling pathway regulator 2 6
MIRT502704 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT502856 CHEK2 checkpoint kinase 2 2 6
MIRT503188 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT503528 ATG12 autophagy related 12 2 2
MIRT505087 ZBTB18 zinc finger and BTB domain containing 18 2 6
MIRT507490 E2F7 E2F transcription factor 7 2 6
MIRT518010 RPL4 ribosomal protein L4 2 4
MIRT520767 TCF23 transcription factor 23 2 2
MIRT524551 CCND2 cyclin D2 2 8
MIRT527916 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT530025 KIAA1875 WD repeat domain 97 2 2
MIRT532306 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT532898 ZNF451 zinc finger protein 451 2 2
MIRT533591 TOB1 transducer of ERBB2, 1 2 6
MIRT534161 SLC9A7 solute carrier family 9 member A7 2 2
MIRT539776 KIAA0408 KIAA0408 2 6
MIRT541045 SOGA3 SOGA family member 3 2 6
MIRT544310 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT545812 ZNF608 zinc finger protein 608 2 2
MIRT546436 SNX5 sorting nexin 5 2 2
MIRT547715 KLHL15 kelch like family member 15 2 4
MIRT549105 C16orf70 chromosome 16 open reading frame 70 2 4
MIRT551192 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT551671 RPL9 ribosomal protein L9 2 4
MIRT552050 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT553113 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT553329 TSC22D2 TSC22 domain family member 2 2 2
MIRT554371 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555745 PDCD10 programmed cell death 10 2 2
MIRT556351 MAN2A1 mannosidase alpha class 2A member 1 2 2
MIRT557461 GSK3B glycogen synthase kinase 3 beta 2 4
MIRT558082 EPC2 enhancer of polycomb homolog 2 2 2
MIRT558501 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT560288 HRH2 histamine receptor H2 2 2
MIRT561124 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT562629 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT564087 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564209 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT564327 CCNT1 cyclin T1 2 2
MIRT564996 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565212 TROVE2 TROVE domain family member 2 2 2
MIRT568261 BMP2K BMP2 inducible kinase 2 2
MIRT571352 RPL37 ribosomal protein L37 2 4
MIRT574715 HAUS8 HAUS augmin like complex subunit 8 2 2
MIRT610600 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT615444 FAXC failed axon connections homolog 2 2
MIRT618242 PGBD4 piggyBac transposable element derived 4 2 2
MIRT618694 CAMK1D calcium/calmodulin dependent protein kinase ID 2 2
MIRT620289 GLTP glycolipid transfer protein 2 2
MIRT621242 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT626894 ANGEL1 angel homolog 1 2 2
MIRT631347 LATS1 large tumor suppressor kinase 1 2 2
MIRT631742 NKX2-1 NK2 homeobox 1 2 2
MIRT633819 WDR92 WD repeat domain 92 2 2
MIRT648370 CYB5A cytochrome b5 type A 2 2
MIRT648892 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT653570 SLC35B3 solute carrier family 35 member B3 2 2
MIRT654652 PTAFR platelet activating factor receptor 2 2
MIRT657173 INTU inturned planar cell polarity protein 2 2
MIRT658874 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT666654 RBM48 RNA binding motif protein 48 2 2
MIRT669273 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT671790 RGS17 regulator of G protein signaling 17 2 2
MIRT673619 HPSE heparanase 2 4
MIRT676182 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT676317 GTF2H2C GTF2H2 family member C 2 2
MIRT676661 LRRC27 leucine rich repeat containing 27 2 2
MIRT676678 ICA1L islet cell autoantigen 1 like 2 2
MIRT677497 GTF2H2 general transcription factor IIH subunit 2 2 2
MIRT678021 SPIC Spi-C transcription factor 2 2
MIRT678030 SLC1A5 solute carrier family 1 member 5 2 2
MIRT678363 PPAP2B phospholipid phosphatase 3 2 2
MIRT678438 PDE4C phosphodiesterase 4C 2 2
MIRT678497 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678648 PDCD4 programmed cell death 4 2 2
MIRT679089 PURB purine rich element binding protein B 2 2
MIRT679121 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT680087 THAP1 THAP domain containing 1 2 2
MIRT684600 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT686267 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT687836 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT688028 GPN2 GPN-loop GTPase 2 2 2
MIRT697864 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT698304 TMEM2 transmembrane protein 2 2 2
MIRT701714 MTMR12 myotubularin related protein 12 2 2
MIRT703736 FAM126B family with sequence similarity 126 member B 2 2
MIRT705971 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT714346 DIP2A disco interacting protein 2 homolog A 2 2
MIRT714614 EXO5 exonuclease 5 2 2
MIRT722607 CCDC152 coiled-coil domain containing 152 2 2
MIRT722876 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT724406 WWC1 WW and C2 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5697 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-5697 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-5697 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-5697 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-5697 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-5697 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-5697 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission