miRTarBase - #MIRT086537


—
pre-miRNA Information
pre-miRNA hsa-mir-569   
Genomic Coordinates chr3: 171106664 - 171106759
Synonyms MIRN569, hsa-mir-569, MIR569
Description Homo sapiens miR-569 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-569
Sequence 61| AGUUAAUGAAUCCUGGAAAGU |81
Evidence Experimental
Experiments SAGE
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN23021417 4 COSMIC
COSN1083370 8 COSMIC
COSN30455038 12 COSMIC
COSN24300323 13 COSMIC
COSN32068274 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs752673293 5 dbSNP
rs1218920077 8 dbSNP
rs745722313 12 dbSNP
rs1368837885 14 dbSNP
Putative Targets

Gene Information
Gene Symbol HSPE1-MOB4
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000604458.1 | 3UTR | CUGAUCAUAUAAUUAACAUUAUGUACUGUAUAUAUCAUUUUAGACACAUCAAUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
58 hsa-miR-569 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004827 SPI1 Spi-1 proto-oncogene 2 1
MIRT086537 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086545 MOB4 MOB family member 4, phocein 2 2
MIRT154349 PARD6B par-6 family cell polarity regulator beta 2 4
MIRT182174 POU2F1 POU class 2 homeobox 1 2 2
MIRT190452 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT191410 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT199846 CSNK1G2 casein kinase 1 gamma 2 2 2
MIRT208376 SLC25A36 solute carrier family 25 member 36 2 2
MIRT275677 CARKD NAD(P)HX dehydratase 2 2
MIRT275764 TFDP1 transcription factor Dp-1 2 2
MIRT280470 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT296592 FAM217B family with sequence similarity 217 member B 2 4
MIRT306847 FYTTD1 forty-two-three domain containing 1 2 2
MIRT443764 HLF HLF, PAR bZIP transcription factor 2 2
MIRT448026 GSR glutathione-disulfide reductase 2 2
MIRT448659 NCALD neurocalcin delta 2 2
MIRT449142 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT449225 RAD51B RAD51 paralog B 2 2
MIRT462421 TWISTNB TWIST neighbor 2 2
MIRT468478 SESN3 sestrin 3 2 4
MIRT478170 DENND5B DENN domain containing 5B 2 2
MIRT478577 VSIG2 V-set and immunoglobulin domain containing 2 2 2
MIRT481300 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 16
MIRT485894 ZFP36 ZFP36 ring finger protein 2 2
MIRT497242 FITM2 fat storage inducing transmembrane protein 2 2 2
MIRT500282 ZNF703 zinc finger protein 703 2 8
MIRT509536 RSBN1L round spermatid basic protein 1 like 2 4
MIRT511835 GPATCH8 G-patch domain containing 8 2 4
MIRT522437 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT523538 GLO1 glyoxalase I 2 4
MIRT527631 MYBPC1 myosin binding protein C, slow type 2 4
MIRT528059 OLAH oleoyl-ACP hydrolase 2 2
MIRT532549 TXNL1 thioredoxin like 1 2 2
MIRT545503 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT546724 RNF6 ring finger protein 6 2 2
MIRT546737 RNF141 ring finger protein 141 2 2
MIRT550889 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT554180 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555878 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT558458 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT560375 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT562672 AKT3 AKT serine/threonine kinase 3 2 2
MIRT563810 TUBA1B tubulin alpha 1b 2 2
MIRT564607 ZNF711 zinc finger protein 711 2 2
MIRT564881 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT566724 MSL2 MSL complex subunit 2 2 2
MIRT566900 CSRP3 cysteine and glycine rich protein 3 2 2
MIRT570002 COL1A2 collagen type I alpha 2 chain 2 2
MIRT612300 ZFP14 ZFP14 zinc finger protein 2 2
MIRT618334 ZNF813 zinc finger protein 813 2 2
MIRT627658 RSBN1 round spermatid basic protein 1 2 2
MIRT630660 PLAG1 PLAG1 zinc finger 2 2
MIRT640802 MYCL1 MYCL proto-oncogene, bHLH transcription factor 1 1
MIRT651370 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT709227 GPSM2 G protein signaling modulator 2 2 2
MIRT712058 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT725006 ZPBP zona pellucida binding protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-569 Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-569 Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-569 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-569 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-mir-569 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-569 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-569 Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-569 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-569 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-569 Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-569 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-569 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-569 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission