pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4280 |
Genomic Coordinates | chr5: 87114879 - 87114954 |
Description | Homo sapiens miR-4280 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4280 | ||||||||||||||||||
Sequence | 11| GAGUGUAGUUCUGAGCAGAGC |31 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | SOLiD | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | UBXN2A | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | UBXD4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | UBX domain protein 2A | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_181713 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on UBXN2A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of UBXN2A (miRNA target sites are highlighted) |
>UBXN2A|NM_181713|3'UTR 1 TTTTTGATAGACTAAGTGGAAAATTTGCAGAGAAATGATGGTTGTAAGTGGACATGCAAACCAAAATTGGGGATTGGAGA 81 AGTCAGACTCACTAGACTTTTGGTTCGAGTACTATTGAACTCTCTCCTGATGAGAAGATGTTTAGATAAGTACAAGTTAA 161 GAAAGTAGCATATGACTGGAAACTATATTCAGTGCACTTTCTCCAAAAGACTACCCAGAAAAATAGACTTATTTTCAAAT 241 ACCAGTTATCAAGATATATTAAATAGCTGTATTGTTTAGAATCTTAATATGGTATAAATTAGCATATGTATTCACAATAT 321 TCATTCAGACATCATTCCCAGACAGCAGGGATTTATTTAAATGTTAGCTGTCTGAGTTTTTAAATAGCTAATACGACCGG 401 GTACAGTGGTTCATGCCTGTAATCCCAGAACTTCGGGAGGCCGAGACAGGCAGATCACGAGGTCAACAGATTGAGACCAT 481 CCTGGCAAACATGGTGAAACCCCATCTCTAGTAAAAATACAAAAATTAGCTGGGCGTGGCGGTGCGCAACTGTAGTCCCA 561 GCTACTCGGGAGGCTGAGGCAGGAGAATCTCTTGAACCTGGCAAGTGTAGGTTGCAGTGAGCTGAGATTGAGCAACTGTA 641 CTCCAGCTTGGCGACAGAGCAAGACCCCCTCTCAAAAATAAATAAAATAAAGTAAAATAAATATAAATAATTGTGGCCGG 721 GTGCAATGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGATGGGAGGATCACTTGAAGCCAGGAGTTTAAAACC 801 AGAATGATCAACAGAGTGAGACCCCTGTCTATATATTTTTTTAATTTAAAAAATAAAAGAATAAAATTGTGTAGCTCAGT 881 ATAGTATCAAGATTAATCTGCCTACTCACATTTCTACACTTTATAAAAATGTAATAAAAGAAAATTATCTTTCTAAAAAA 961 AAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 165324.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000309033.4 | 3UTR | CCUACUCACAUUUCUACACUUUAUAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000309033.4 | 3UTR | AAUCUGCCUACUCACAUUUCUACACUUUAUAAAAAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-4280 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT065612 | DAZAP2 | DAZ associated protein 2 | 2 | 10 | ||||||||
MIRT084985 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT088053 | UBXN2A | UBX domain protein 2A | 2 | 4 | ||||||||
MIRT097327 | SCAMP1 | secretory carrier membrane protein 1 | 2 | 2 | ||||||||
MIRT099148 | MYLIP | myosin regulatory light chain interacting protein | 2 | 12 | ||||||||
MIRT127042 | FAM208B | family with sequence similarity 208 member B | 2 | 4 | ||||||||
MIRT140479 | BNIP2 | BCL2 interacting protein 2 | 2 | 6 | ||||||||
MIRT154889 | GNAS | GNAS complex locus | 2 | 4 | ||||||||
MIRT187983 | MBD6 | methyl-CpG binding domain protein 6 | 2 | 2 | ||||||||
MIRT190440 | EIF5 | eukaryotic translation initiation factor 5 | 2 | 2 | ||||||||
MIRT240673 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | 2 | 2 | ||||||||
MIRT295049 | EVI5L | ecotropic viral integration site 5 like | 2 | 2 | ||||||||
MIRT324749 | ACER2 | alkaline ceramidase 2 | 2 | 2 | ||||||||
MIRT366075 | FAM127A | retrotransposon Gag like 8C | 2 | 4 | ||||||||
MIRT442625 | LOX | lysyl oxidase | 2 | 2 | ||||||||
MIRT445224 | TYRP1 | tyrosinase related protein 1 | 2 | 2 | ||||||||
MIRT448967 | CCNT2 | cyclin T2 | 2 | 4 | ||||||||
MIRT450137 | PFN4 | profilin family member 4 | 2 | 2 | ||||||||
MIRT464350 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT470460 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | 2 | 2 | ||||||||
MIRT473691 | MAPK8 | mitogen-activated protein kinase 8 | 2 | 4 | ||||||||
MIRT480188 | CALM2 | calmodulin 2 | 2 | 6 | ||||||||
MIRT486355 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | 2 | 2 | ||||||||
MIRT486708 | TROVE2 | TROVE domain family member 2 | 2 | 4 | ||||||||
MIRT488337 | SCD | stearoyl-CoA desaturase | 2 | 2 | ||||||||
MIRT489322 | PEX26 | peroxisomal biogenesis factor 26 | 2 | 2 | ||||||||
MIRT491791 | ZNF24 | zinc finger protein 24 | 2 | 2 | ||||||||
MIRT491970 | USP37 | ubiquitin specific peptidase 37 | 2 | 2 | ||||||||
MIRT492029 | TWF1 | twinfilin actin binding protein 1 | 2 | 4 | ||||||||
MIRT492063 | TMEM245 | transmembrane protein 245 | 2 | 2 | ||||||||
MIRT492247 | SLC39A9 | solute carrier family 39 member 9 | 2 | 2 | ||||||||
MIRT492254 | SLC35F5 | solute carrier family 35 member F5 | 2 | 2 | ||||||||
MIRT492592 | PPIL4 | peptidylprolyl isomerase like 4 | 2 | 2 | ||||||||
MIRT493436 | KAT7 | lysine acetyltransferase 7 | 2 | 2 | ||||||||
MIRT493470 | IPMK | inositol polyphosphate multikinase | 2 | 2 | ||||||||
MIRT493639 | HECTD1 | HECT domain E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT493919 | FAM127B | retrotransposon Gag like 8A | 2 | 4 | ||||||||
MIRT494639 | ARNTL | aryl hydrocarbon receptor nuclear translocator like | 2 | 2 | ||||||||
MIRT500032 | ABCF2 | ATP binding cassette subfamily F member 2 | 2 | 8 | ||||||||
MIRT504589 | ADH1B | alcohol dehydrogenase 1B (class I), beta polypeptide | 2 | 4 | ||||||||
MIRT505535 | SP4 | Sp4 transcription factor | 2 | 6 | ||||||||
MIRT507539 | DNAJB6 | DnaJ heat shock protein family (Hsp40) member B6 | 2 | 6 | ||||||||
MIRT508846 | TMCO1 | transmembrane and coiled-coil domains 1 | 2 | 4 | ||||||||
MIRT510488 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | 2 | 2 | ||||||||
MIRT511402 | IFNAR2 | interferon alpha and beta receptor subunit 2 | 2 | 6 | ||||||||
MIRT523252 | HIST1H2AH | histone cluster 1 H2A family member h | 2 | 2 | ||||||||
MIRT525939 | C11orf74 | chromosome 11 open reading frame 74 | 2 | 2 | ||||||||
MIRT531453 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | 2 | 2 | ||||||||
MIRT533317 | UNKL | unkempt family like zinc finger | 2 | 2 | ||||||||
MIRT541034 | STRBP | spermatid perinuclear RNA binding protein | 2 | 8 | ||||||||
MIRT546734 | RNF217 | ring finger protein 217 | 2 | 2 | ||||||||
MIRT555125 | PTPRJ | protein tyrosine phosphatase, receptor type J | 2 | 2 | ||||||||
MIRT556105 | MOAP1 | modulator of apoptosis 1 | 2 | 2 | ||||||||
MIRT560205 | AK4 | adenylate kinase 4 | 2 | 2 | ||||||||
MIRT561087 | LLPH | LLP homolog, long-term synaptic facilitation | 2 | 2 | ||||||||
MIRT566967 | LBR | lamin B receptor | 2 | 2 | ||||||||
MIRT567344 | H3F3B | H3 histone family member 3B | 2 | 2 | ||||||||
MIRT567863 | DCAF12 | DDB1 and CUL4 associated factor 12 | 2 | 2 | ||||||||
MIRT574449 | SCML2 | Scm polycomb group protein like 2 | 2 | 2 | ||||||||
MIRT575700 | Map1b | microtubule-associated protein 1B | 2 | 2 | ||||||||
MIRT651432 | YIPF6 | Yip1 domain family member 6 | 2 | 2 | ||||||||
MIRT659728 | CCDC93 | coiled-coil domain containing 93 | 2 | 2 | ||||||||
MIRT686937 | SFT2D3 | SFT2 domain containing 3 | 2 | 2 | ||||||||
MIRT699385 | SLC30A6 | solute carrier family 30 member 6 | 2 | 2 | ||||||||
MIRT710287 | CSNK1G3 | casein kinase 1 gamma 3 | 2 | 2 | ||||||||
MIRT715123 | PANK3 | pantothenate kinase 3 | 2 | 2 | ||||||||
MIRT721847 | VLDLR | very low density lipoprotein receptor | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|