miRTarBase - #MIRT088874


—
pre-miRNA Information
pre-miRNA hsa-mir-548x   
Genomic Coordinates chr21: 18686090 - 18686164
Description Homo sapiens miR-548x stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-548x-2   
Genomic Coordinates chr13: 65966330 - 65966429
Description Homo sapiens miR-548x-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548x-3p
Sequence 59| UAAAAACUGCAAUUACUUUC |78
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 21 - 18686115 29233923 MiREDiBase
A-to-I 12 21 - 18686108 29233923 MiREDiBase
A-to-I 4 13 - 65966368 29233923 MiREDiBase
A-to-I 5 13 - 65966367 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs974665092 1 dbSNP
rs930524538 5 dbSNP
rs985544652 6 dbSNP
rs1311293294 6 dbSNP
rs1378684240 8 dbSNP
rs933687993 12 dbSNP
rs1178183820 12 dbSNP
rs550303573 15 dbSNP
rs561223787 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOXN2   
Synonyms HTLF
Description forkhead box N2
Transcript NM_002158   
Expression
Putative miRNA Targets on FOXN2
3'UTR of FOXN2
(miRNA target sites are highlighted)		 
>FOXN2|NM_002158|3'UTR
   1 AAATACTTAAAGTGTGGCAATACTCTTTCACTTAATTCTTTACAAGGGATATCAAAGCCATAATGGACTTCATTAGTTTT
  81 AGGGTAGGGAAGGGATACTAATTACTTATTTCTTTCAAAACATTTTTGGTTTTTGGTTTTTAAAATTTTTATTAAACAAT
 161 TGCTGTTAGGATCATGCCTGATCAGAAATACATGATGTGAAGTCCTAAAAGCATAATTTTTGTGATAAATGTGTCCAAGA
 241 TTTGAAAATTTTTATATAAGAAAATCCCCAGCCTCTGTCTTAAACTTGTGGGACAAAAATCCTTTCTTCTGTTAATATGT
 321 CAGAATGTAAGATTTGGCAACTCGATAAATTTTTTTCATTTTCTTTTCCAATCTGTAACTATAGTTACTGAACCAGCTAA
 401 AAATTTTGCTGATGTATTTTTCATATACTTCTCTCCTGACACGCAATCCGGTAACATAAGATTGAAATTTTTTTACTTTG
 481 TCTTAATTTGTTTCTAATTTTTTTTTTGTTGTCGTGTGAGCAAAGACAAACATAAATTGAAAAACATCCTGATGTTTAGA
 561 AAGTTTCTTTTGGTTACGTAGGTAGAGAATACAACAAAGAGTTCTAAGACTTAGAAAAGACAATTTTGTGGTGTCATTTC
 641 ATCCAAGAACACTCCCAATTCCTATTAGAATGGTAGCTTTGAAGTGTTTTTACTTCAGAGATCCTGCATAGCATTTATTG
 721 GGGCCTTTTATTCTTTCCCAAAGTGCTTTGCAAACATTAAGTTTTAGCCACTAGCTGCCTTTGTTGAGTATAAGTTATCC
 801 AGTGAGAGGATATAGCCAATTAAGTGTGTTATGGAGTACACCCATTTTGACACACTTGTAATAAGAGAATCTTTCATTTG
 881 CCTGCCATGTGTACTGTATTATGAGAATCTTATAATCGGAATGGAGTGAAATGAAACATTTTGAGTACTGATGGCATGTT
 961 ATCATACATAAAGTAGGTCATTTAGGAAAAAACTTCTGTCCAAGCTTTGTATGAATTAAATTCATAAGTATACCAAATTA
1041 AATCTTAATAGATTTAATGCAATTTTACAGACACAATACCTTCATGAATTTCAAAATTCATATAAAATTTGATCTTATGC
1121 AATACACCTTTTTGAGGAGGCAGTGTAACAACCTATAGTGCCATTGATCCATGAGAAAAAGATTTTCTGGTACTACTCCA
1201 AAAGTGCTTTGACTAAGTATCTTAACTATTTGAACAGTCTGCTTATATGAGACAGTTTTTCATAGTATCATTTGTATAAT
1281 TTGATTAGATTATTCAGAAACAATAGGATGCTAAACTAATTCATTGTATCTTTTTTTTACAATGGTGGAAGCAACTTTCT
1361 GAAAGTTCAGTCTTATGCTACATCCTAAGTCATAGACAATGACCTTGTTTTCATTATTCTGATAGATTGTATACATATGT
1441 ACACATACATATACACATATGCACAGTCAAGGTCATGATGTTGATTTGCTTTCAGCTGTTTCTGTGATTATAAAGCATTT
1521 TTTAAGAGACAAATTTTAACTTTTAATTTTTATTTTGGCAAAACTGTCAAATGAGAAAAATGATTTTAAAAACTTTTTTT
1601 TCAATTGACAAGACTTTAAGTCAGGGATAACAGTATTAATGTTCTCTGTTCTGTTTCCATGTTAAATTTAATTTAACCTG
1681 GATAGCCACATTAATGAATTGGTGCTGTCAAAATATAGTAATTTTTAAATTTGTTAATAATGAAAACCCTTAAGCATGCA
1761 GGATGAGGTATTTGGGTTTTTTTTTTAGATCGATCACATCTACAGAAAATGGCTAAACCAAGTTAACTTTTATTATAGAC
1841 AGTGAATAAAACACCAAAAACCCAAAAATGCTTTAACCACAGTATAAATAATAGATTATACACATCATCTTAATAACTAT
1921 TTTTAAGTTATTTACCATAGCCTCTGTATAGACCTTAGGAACAGTGTTTCAGTGATCTGGCACCAGTTTATTTTGTTCTG
2001 CTGAAATTCTGTATCACAAATGTGCTACCTGGTTTTTGTCCATTAGATAATTACTCTTTATAAGGAAAGGAAAGAGAAGC
2081 AGAGTTAGTTCCAGCTCTAATAGGGATCTTCAAAGTTATTTTGTCTTGATGTATGTAACAGTAATTCTTTACATCTTTTG
2161 ATTTTTCTCTTCCTTTTTATTCACTCTTCCCACGAATTTAAATGTTTAAGTTATATTCATCACTAGCAAGGATGATAAAC
2241 ACTTGTGCACTGAAAGCTAACAGGGAGAGGTTACACAATATTTTACAGTTTCTTAAACATAATTTAATGCATCACCTTCC
2321 ACTTGCTAACATACCAAGTCAGTTATTTTCAAGGGAAGAACCTTTTAAATTATGGTCCTCCATTTACTACTTCCACTGAG
2401 AGTATGCTCTCATTCCTCAGGTGTTTTGAGAAACATGACTAATAACCACACAATTAAGTAGAGTCATTCCAAGTCCTATG
2481 GCCTGGAAATTGTATTCCCTATAATATACAAATTTTCCTGTAATAAAGTCAACTTAGAAACTCCAAGGAGGTTACATGTT
2561 TTCCAACATATCCTAAAAACTGTGATATAAGCTAACATATAATTTGCCTTACGTCAAAAGAATATGTTTTGTTGCAGCTG
2641 ATTCCAGTTTATAATAGATCCCTAGTAAAAAGCTTTGATTCAACACAATTGTTCATCTTCACATCCCAAACAGAATCACT
2721 GTTTCTTGAATATATATTTTTGAAGTTTTTTTGTGCAATATATTACTAAATCAGTTATTATTTTACTTTTCCAAATTCAG
2801 AGAAAGAAAACAGATTACCTGAATTCATGGAAAAGGTGGATCACCTCCCTTTTTCCACCTTCAAGCCTTTCCTGTCCTCA
2881 TAGCCAGCATGACTTCTTTTAACTTGGATTCCTTTGTATATAGTAAAGTTTAGTATATATATATTTTTTTCTTTTTGCTA
2961 CTTTCTGAGGCATTATGTAAAGGGCTCATACTAGATGTTCAGTTAAATATACTTTAGCACAAAGTCAAACTAGAGAATGT
3041 GTTAAGGAGGGAATGTATATGTCTTGGTAGACCAGGAGGCCTTTGCCAGCAATTTAAGCAACAGATGTGAATACTTCACA
3121 AAGCTGTAAAGACCATTGTCTTAAATACTACAACAACTTAACACCCTTTTGTGAAGATCACAGCATTTATCTAAGAAACT
3201 GTGAGGCTTTCTGGTTTACATATATCTTACAGGTGTTTTTTTGTATTTTTTTTTTTTTTTAGTTTGAAATGTGTAAGCTT
3281 TGATTTAAACCAAGTTTACTTCAGTATGTTAATGATGTAGTAAAAATATTTATTGAAAGGTGAATTCGAGTATTTTAATG
3361 TTATACCTGCCATTTTTTTTCTTAAAGCATATTCTTTGCATCTAACTGCCAGTGCCATTGTCAAAACTTATTTTTTAAAT
3441 CGTTGTACATTTCTTATTAAACTAAGTGCTTAATTTTAAAGTATTATGTTGCCATCATATAGTGTATAAAAATGTATAAT
3521 TGCCAATTGATTGTAACTATTATTTATTTTTAAATGAAAGTGTAAGAATGCTTTCTGATTCAACAAATTTGTTATCAAAC
3601 TGTTTCCTTATCCTCTTTTCTGATGTAGCATAAAAATTGTCCCGGTTTGAGTTATAACTGCCAGTAGATGACCAGTCACA
3681 AGTGAACCACTTCTCAGTTGCCAATCTTTGCTCATATTAAAAACAACTTACAAATACTTAGTTTTTGTATCTAATCTCTG
3761 ATTATTAAAATGTTTATAAAGTTTATTTTTACCAAAGAGATGCAATTCATTATGAGAAAGTATTGCATAATAAATTTTGT
3841 TTTATAACTTTTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUUCAUUAACGUCAAAAAu 5'
            || || ||  ||||||| 
Target 5' acAAATACTT--AGTTTTTg 3'
 3730 - 3747 154.00 -5.20
2 
miRNA  3' cuUUCAUUAACGUCAAAAAu 5'
            |:||| ||| :|||||| 
Target 5' tgAGGTATTTG-GGTTTTTt 3'
 1764 - 1782 149.00 -8.30
3 
miRNA  3' cuuucAUUAAC---GUCAAAAAu 5'
               ||  ||   |||||||| 
Target 5' ctgctTATATGAGACAGTTTTTc 3'
 1239 - 1261 147.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30184812 23 COSMIC
COSN31552828 39 COSMIC
COSN31603552 48 COSMIC
COSN31527471 150 COSMIC
COSN9376232 169 COSMIC
COSN23327033 242 COSMIC
COSN31579033 248 COSMIC
COSN31516414 251 COSMIC
COSN31538986 277 COSMIC
COSN31490287 312 COSMIC
COSN30176894 324 COSMIC
COSN31515039 349 COSMIC
COSN30544136 397 COSMIC
COSN31580087 459 COSMIC
COSN25752350 509 COSMIC
COSN5792876 1043 COSMIC
COSN31608539 1087 COSMIC
COSN31546561 1100 COSMIC
COSN31528087 1110 COSMIC
COSN31569619 1172 COSMIC
COSN31524319 1181 COSMIC
COSN16812913 1215 COSMIC
COSN31521180 1340 COSMIC
COSN27124762 1701 COSMIC
COSN1842524 1787 COSMIC
COSN23250751 1787 COSMIC
COSN28481553 1839 COSMIC
COSN216714 2195 COSMIC
COSN20725807 2253 COSMIC
COSN31606675 2606 COSMIC
COSN16737209 2734 COSMIC
COSN25376771 2734 COSMIC
COSN28750195 2758 COSMIC
COSN1842525 2779 COSMIC
COSN17182833 2819 COSMIC
COSN31579041 2985 COSMIC
COSN31594741 3136 COSMIC
COSN6183796 3222 COSMIC
COSN7131329 3244 COSMIC
COSN20096637 3261 COSMIC
COSN28771860 3263 COSMIC
COSN31517847 3348 COSMIC
COSN26574314 3349 COSMIC
COSN16138211 3377 COSMIC
COSN31514808 3381 COSMIC
COSN31528765 3442 COSMIC
COSN31606498 3454 COSMIC
COSN10001556 3465 COSMIC
COSN28776116 3578 COSMIC
COSN31546935 3636 COSMIC
COSN30175947 3644 COSMIC
COSN31537707 3747 COSMIC
COSN20854269 3796 COSMIC
COSN27009540 3814 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750007998 2 dbSNP
rs1239045052 4 dbSNP
rs1317715373 7 dbSNP
rs1360766502 9 dbSNP
rs755914589 13 dbSNP
rs561146723 14 dbSNP
rs753800674 19 dbSNP
rs1205411400 20 dbSNP
rs936356873 23 dbSNP
rs767080724 25 dbSNP
rs200646671 26 dbSNP
rs903376761 29 dbSNP
rs1255284697 30 dbSNP
rs758613362 32 dbSNP
rs778147215 33 dbSNP
rs1000771018 35 dbSNP
rs552834089 36 dbSNP
rs1421317627 38 dbSNP
rs1410329375 39 dbSNP
rs749256325 42 dbSNP
rs1403466928 43 dbSNP
rs781656701 44 dbSNP
rs746405176 45 dbSNP
rs865898648 49 dbSNP
rs1434990921 50 dbSNP
rs775240390 58 dbSNP
rs1362836212 64 dbSNP
rs1305327784 67 dbSNP
rs1330410540 73 dbSNP
rs1437155339 73 dbSNP
rs537597522 76 dbSNP
rs1007180659 77 dbSNP
rs1018539329 83 dbSNP
rs1046246666 85 dbSNP
rs755767698 87 dbSNP
rs1428054240 89 dbSNP
rs1399134745 95 dbSNP
rs907959492 96 dbSNP
rs940820214 99 dbSNP
rs1194609511 101 dbSNP
rs1328117007 102 dbSNP
rs1026630647 110 dbSNP
rs1245426068 116 dbSNP
rs1196133124 117 dbSNP
rs1439115369 122 dbSNP
rs1251890978 123 dbSNP
rs1274344990 123 dbSNP
rs1037794938 130 dbSNP
rs1236793569 131 dbSNP
rs878965055 135 dbSNP
rs531683065 137 dbSNP
rs550013729 141 dbSNP
rs1219540243 146 dbSNP
rs367931724 152 dbSNP
rs1272933629 159 dbSNP
rs1051097357 160 dbSNP
rs1307478328 170 dbSNP
rs1408279031 171 dbSNP
rs890740562 177 dbSNP
rs1377448443 186 dbSNP
rs1174668615 191 dbSNP
rs1214895978 192 dbSNP
rs1009061383 213 dbSNP
rs1020502941 214 dbSNP
rs1266043800 217 dbSNP
rs1423494235 217 dbSNP
rs967539592 223 dbSNP
rs999239900 230 dbSNP
rs1448094494 231 dbSNP
rs1470785709 236 dbSNP
rs112260219 238 dbSNP
rs958755735 239 dbSNP
rs1032102611 240 dbSNP
rs1180773622 243 dbSNP
rs78548295 249 dbSNP
rs1277821837 253 dbSNP
rs1259110744 255 dbSNP
rs181956378 257 dbSNP
rs991501087 269 dbSNP
rs148399688 270 dbSNP
rs950013581 271 dbSNP
rs1042013130 273 dbSNP
rs1226587454 274 dbSNP
rs916474135 276 dbSNP
rs768255393 280 dbSNP
rs1447556143 287 dbSNP
rs936193297 288 dbSNP
rs1320652053 289 dbSNP
rs543433069 292 dbSNP
rs13029569 306 dbSNP
rs1411812909 307 dbSNP
rs1157792476 312 dbSNP
rs888887806 315 dbSNP
rs1418934013 320 dbSNP
rs1296130061 327 dbSNP
rs566298747 330 dbSNP
rs981909298 344 dbSNP
rs1235566337 345 dbSNP
rs907675580 349 dbSNP
rs940537570 350 dbSNP
rs1465299155 364 dbSNP
rs1329463892 380 dbSNP
rs867859818 382 dbSNP
rs1236543585 384 dbSNP
rs1304526566 393 dbSNP
rs1353238246 394 dbSNP
rs1337114041 395 dbSNP
rs993121098 398 dbSNP
rs549860760 399 dbSNP
rs1262868872 400 dbSNP
rs1272310357 402 dbSNP
rs920709973 408 dbSNP
rs564722506 417 dbSNP
rs1209793085 419 dbSNP
rs1418508101 434 dbSNP
rs1463463555 438 dbSNP
rs1033901884 440 dbSNP
rs1164830901 443 dbSNP
rs142534171 444 dbSNP
rs1449442558 445 dbSNP
rs890707941 450 dbSNP
rs1009113870 451 dbSNP
rs1469739249 452 dbSNP
rs537888645 457 dbSNP
rs1220863735 458 dbSNP
rs1320159448 463 dbSNP
rs1275301228 464 dbSNP
rs971422657 468 dbSNP
rs1364997604 470 dbSNP
rs903322187 471 dbSNP
rs1000385343 477 dbSNP
rs1443812665 497 dbSNP
rs1293632857 498 dbSNP
rs1368872780 498 dbSNP
rs1456905672 498 dbSNP
rs868687720 506 dbSNP
rs1170151954 508 dbSNP
rs1156412847 509 dbSNP
rs1389368506 511 dbSNP
rs1032486294 512 dbSNP
rs957842613 514 dbSNP
rs1162635321 515 dbSNP
rs1388487084 517 dbSNP
rs1267901206 518 dbSNP
rs556192292 522 dbSNP
rs1190690107 524 dbSNP
rs1023298796 531 dbSNP
rs1234661264 532 dbSNP
rs1487585647 532 dbSNP
rs936225166 534 dbSNP
rs1341691535 537 dbSNP
rs1443276476 544 dbSNP
rs970372067 547 dbSNP
rs1326681409 555 dbSNP
rs1376168415 558 dbSNP
rs1444882406 567 dbSNP
rs1309361709 568 dbSNP
rs1301261787 572 dbSNP
rs1159211126 577 dbSNP
rs981961577 578 dbSNP
rs1364933601 581 dbSNP
rs1244511192 587 dbSNP
rs910748088 590 dbSNP
rs943519854 592 dbSNP
rs1214788635 596 dbSNP
rs1467330120 600 dbSNP
rs1273299691 611 dbSNP
rs1040137693 612 dbSNP
rs901591569 620 dbSNP
rs774012478 621 dbSNP
rs961831247 629 dbSNP
rs1482866395 634 dbSNP
rs1249823664 644 dbSNP
rs1202388616 645 dbSNP
rs1175164564 646 dbSNP
rs973289422 647 dbSNP
rs1255744428 648 dbSNP
rs1047807071 652 dbSNP
rs753683336 653 dbSNP
rs932124661 654 dbSNP
rs1006580134 659 dbSNP
rs1033584019 668 dbSNP
rs767058078 673 dbSNP
rs1186564847 675 dbSNP
rs1366443202 677 dbSNP
rs986622565 685 dbSNP
rs911860169 687 dbSNP
rs1462953903 690 dbSNP
rs1397405088 699 dbSNP
rs772664775 701 dbSNP
rs1402709527 702 dbSNP
rs944700448 705 dbSNP
rs1302013093 709 dbSNP
rs1464512902 719 dbSNP
rs1041966603 721 dbSNP
rs542810791 723 dbSNP
rs577841128 724 dbSNP
rs1472341702 725 dbSNP
rs1372777837 731 dbSNP
rs1054665263 734 dbSNP
rs1409828152 741 dbSNP
rs893546227 756 dbSNP
rs1011961790 759 dbSNP
rs1013419741 763 dbSNP
rs1024405530 770 dbSNP
rs1255938320 780 dbSNP
rs1023349562 782 dbSNP
rs1269245863 788 dbSNP
rs1208645653 791 dbSNP
rs906179795 792 dbSNP
rs545108302 798 dbSNP
rs561049500 809 dbSNP
rs1003182115 813 dbSNP
rs1340664967 815 dbSNP
rs1311773263 818 dbSNP
rs1394014244 820 dbSNP
rs971435380 825 dbSNP
rs560682471 829 dbSNP
rs1014776859 836 dbSNP
rs1234460675 850 dbSNP
rs1386593576 850 dbSNP
rs962020117 857 dbSNP
rs150951303 858 dbSNP
rs1027450926 860 dbSNP
rs779632140 863 dbSNP
rs990829579 864 dbSNP
rs953341517 868 dbSNP
rs943573666 872 dbSNP
rs1480764079 877 dbSNP
rs1463912499 882 dbSNP
rs1281564986 890 dbSNP
rs1211062197 891 dbSNP
rs1199463837 901 dbSNP
rs6705802 902 dbSNP
rs1243319190 903 dbSNP
rs1344099591 904 dbSNP
rs1298020957 909 dbSNP
rs911995374 910 dbSNP
rs1362882639 912 dbSNP
rs538651744 913 dbSNP
rs767043267 914 dbSNP
rs924851207 918 dbSNP
rs561585738 919 dbSNP
rs1426874105 922 dbSNP
rs1391213026 925 dbSNP
rs936307727 927 dbSNP
rs1168311545 951 dbSNP
rs1448231186 954 dbSNP
rs1172639238 963 dbSNP
rs1055121194 968 dbSNP
rs941704424 972 dbSNP
rs1055081810 975 dbSNP
rs894611786 981 dbSNP
rs1219844244 984 dbSNP
rs1343804089 1001 dbSNP
rs1275112797 1003 dbSNP
rs948913328 1009 dbSNP
rs1013429754 1025 dbSNP
rs1233863722 1028 dbSNP
rs1377697917 1031 dbSNP
rs1044769387 1034 dbSNP
rs1298197827 1035 dbSNP
rs1411937246 1036 dbSNP
rs778938125 1040 dbSNP
rs1339075250 1050 dbSNP
rs906316943 1051 dbSNP
rs1216779576 1055 dbSNP
rs113546529 1063 dbSNP
rs1281364602 1067 dbSNP
rs553382606 1069 dbSNP
rs1376602845 1070 dbSNP
rs374917031 1073 dbSNP
rs1252000350 1075 dbSNP
rs571689900 1076 dbSNP
rs115448144 1077 dbSNP
rs879366920 1080 dbSNP
rs140433382 1081 dbSNP
rs1280447958 1089 dbSNP
rs1201006080 1093 dbSNP
rs1344169689 1103 dbSNP
rs1281482077 1104 dbSNP
rs1230244651 1106 dbSNP
rs757248461 1112 dbSNP
rs1277725265 1115 dbSNP
rs549033105 1117 dbSNP
rs1440278863 1119 dbSNP
rs879214560 1120 dbSNP
rs1361299028 1121 dbSNP
rs994729738 1126 dbSNP
rs1335221674 1129 dbSNP
rs35454093 1129 dbSNP
rs1414420805 1132 dbSNP
rs560314200 1138 dbSNP
rs1027996856 1141 dbSNP
rs1400617488 1142 dbSNP
rs976240034 1143 dbSNP
rs1486553099 1147 dbSNP
rs953212364 1148 dbSNP
rs1181073999 1154 dbSNP
rs547460152 1156 dbSNP
rs985984153 1164 dbSNP
rs1484854527 1165 dbSNP
rs908955513 1171 dbSNP
rs1188156255 1172 dbSNP
rs941700944 1173 dbSNP
rs1329995953 1174 dbSNP
rs1267564562 1179 dbSNP
rs1222308922 1180 dbSNP
rs765511651 1188 dbSNP
rs144376062 1191 dbSNP
rs916521572 1191 dbSNP
rs752985661 1196 dbSNP
rs977419161 1201 dbSNP
rs1172047091 1208 dbSNP
rs767233272 1209 dbSNP
rs1397118859 1212 dbSNP
rs1323207536 1222 dbSNP
rs949257548 1225 dbSNP
rs1388784377 1227 dbSNP
rs1046330914 1231 dbSNP
rs1398618840 1233 dbSNP
rs185959136 1234 dbSNP
rs1415439372 1246 dbSNP
rs1182240270 1254 dbSNP
rs924598531 1263 dbSNP
rs1241028376 1264 dbSNP
rs902366482 1267 dbSNP
rs1465257087 1270 dbSNP
rs555635102 1275 dbSNP
rs1297991164 1277 dbSNP
rs190729513 1279 dbSNP
rs180999996 1281 dbSNP
rs1053645685 1282 dbSNP
rs893185386 1283 dbSNP
rs990388790 1290 dbSNP
rs916167141 1293 dbSNP
rs1300230908 1296 dbSNP
rs1436504064 1300 dbSNP
rs1017534766 1304 dbSNP
rs1287797572 1306 dbSNP
rs1289915043 1307 dbSNP
rs948898687 1310 dbSNP
rs964944627 1317 dbSNP
rs186326613 1324 dbSNP
rs1423583740 1329 dbSNP
rs375924866 1331 dbSNP
rs565619450 1331 dbSNP
rs1170189560 1339 dbSNP
rs1349616300 1343 dbSNP
rs1450015019 1345 dbSNP
rs927714680 1357 dbSNP
rs1184701034 1366 dbSNP
rs950983644 1376 dbSNP
rs1234479286 1377 dbSNP
rs537728072 1379 dbSNP
rs1489909568 1380 dbSNP
rs1277240734 1382 dbSNP
rs983605750 1383 dbSNP
rs1285079149 1395 dbSNP
rs1342083346 1396 dbSNP
rs908959922 1400 dbSNP
rs1221426523 1402 dbSNP
rs1369171223 1404 dbSNP
rs963139069 1414 dbSNP
rs758611196 1417 dbSNP
rs1403972217 1430 dbSNP
rs946763943 1431 dbSNP
rs1217922692 1432 dbSNP
rs1309623685 1435 dbSNP
rs939063690 1438 dbSNP
rs1430240315 1439 dbSNP
rs556228989 1444 dbSNP
rs897460530 1452 dbSNP
rs1168295765 1453 dbSNP
rs1434804804 1456 dbSNP
rs994927415 1459 dbSNP
rs1198724818 1461 dbSNP
rs531566790 1463 dbSNP
rs1321769584 1466 dbSNP
rs1206134897 1482 dbSNP
rs923871449 1489 dbSNP
rs1249956504 1499 dbSNP
rs1212913757 1508 dbSNP
rs935168198 1509 dbSNP
rs1231339178 1510 dbSNP
rs1053585331 1514 dbSNP
rs1488233612 1518 dbSNP
rs190398995 1523 dbSNP
rs1410030312 1524 dbSNP
rs1395557394 1529 dbSNP
rs746670787 1529 dbSNP
rs1254908806 1533 dbSNP
rs553854480 1535 dbSNP
rs889058622 1536 dbSNP
rs1359613982 1537 dbSNP
rs1479537070 1541 dbSNP
rs893228599 1541 dbSNP
rs1414263281 1546 dbSNP
rs1183231233 1548 dbSNP
rs1418694157 1557 dbSNP
rs1007389629 1559 dbSNP
rs1018830960 1565 dbSNP
rs947446076 1565 dbSNP
rs1263131738 1567 dbSNP
rs1406271686 1572 dbSNP
rs1402784326 1587 dbSNP
rs1202314404 1592 dbSNP
rs1320860622 1593 dbSNP
rs1269457971 1594 dbSNP
rs572559252 1595 dbSNP
rs1039077156 1597 dbSNP
rs543244091 1605 dbSNP
rs1460284959 1608 dbSNP
rs1379606094 1615 dbSNP
rs1397499748 1615 dbSNP
rs1336075349 1623 dbSNP
rs1390981665 1624 dbSNP
rs1159936055 1638 dbSNP
rs554857791 1644 dbSNP
rs147830284 1648 dbSNP
rs1167164622 1649 dbSNP
rs543676863 1650 dbSNP
rs886655374 1652 dbSNP
rs1242888878 1657 dbSNP
rs544439058 1671 dbSNP
rs1032188823 1672 dbSNP
rs1466601309 1679 dbSNP
rs747104194 1688 dbSNP
rs1249381920 1691 dbSNP
rs1441205324 1696 dbSNP
rs1308045226 1698 dbSNP
rs1370955963 1706 dbSNP
rs1005482330 1720 dbSNP
rs1016406350 1722 dbSNP
rs990579395 1722 dbSNP
rs182878725 1727 dbSNP
rs916153410 1728 dbSNP
rs527849441 1729 dbSNP
rs990590150 1730 dbSNP
rs1450380239 1732 dbSNP
rs1023385057 1735 dbSNP
rs1321066338 1735 dbSNP
rs970321623 1737 dbSNP
rs1381784321 1738 dbSNP
rs981660718 1744 dbSNP
rs1165263497 1746 dbSNP
rs1458586032 1754 dbSNP
rs532328056 1756 dbSNP
rs187522319 1757 dbSNP
rs867211323 1763 dbSNP
rs1024871482 1769 dbSNP
rs1162014974 1777 dbSNP
rs142827558 1777 dbSNP
rs923856890 1777 dbSNP
rs1036087256 1778 dbSNP
rs1468932427 1787 dbSNP
rs781305571 1792 dbSNP
rs1259016641 1796 dbSNP
rs919023281 1799 dbSNP
rs1310687877 1801 dbSNP
rs756045839 1814 dbSNP
rs930311797 1815 dbSNP
rs1290796763 1823 dbSNP
rs1231365615 1826 dbSNP
rs1243408877 1827 dbSNP
rs1471399775 1828 dbSNP
rs989731505 1829 dbSNP
rs1270772488 1834 dbSNP
rs1226567124 1836 dbSNP
rs1324814519 1840 dbSNP
rs915108100 1843 dbSNP
rs1365120254 1846 dbSNP
rs942534801 1848 dbSNP
rs1432077041 1857 dbSNP
rs6717340 1862 dbSNP
rs889038290 1864 dbSNP
rs117060166 1867 dbSNP
rs1474699156 1868 dbSNP
rs1413439940 1869 dbSNP
rs1370863561 1878 dbSNP
rs1040325708 1881 dbSNP
rs1480559713 1883 dbSNP
rs900562628 1887 dbSNP
rs901650705 1889 dbSNP
rs1483938353 1893 dbSNP
rs1167669001 1895 dbSNP
rs1273421788 1900 dbSNP
rs1051747088 1902 dbSNP
rs998706958 1903 dbSNP
rs1461477403 1904 dbSNP
rs1327844407 1906 dbSNP
rs1031738359 1919 dbSNP
rs1352384832 1920 dbSNP
rs886705263 1929 dbSNP
rs957716169 1959 dbSNP
rs779996077 1962 dbSNP
rs1279932695 1967 dbSNP
rs190915705 1976 dbSNP
rs970038123 1981 dbSNP
rs183943414 1986 dbSNP
rs1016907506 1987 dbSNP
rs899368851 1990 dbSNP
rs1427956401 1993 dbSNP
rs1035921376 1996 dbSNP
rs531649445 1999 dbSNP
rs1196906014 2001 dbSNP
rs961504443 2002 dbSNP
rs1473342013 2003 dbSNP
rs567451753 2004 dbSNP
rs973337158 2010 dbSNP
rs550071448 2013 dbSNP
rs1233276544 2016 dbSNP
rs768451785 2018 dbSNP
rs571264437 2020 dbSNP
rs1436022958 2021 dbSNP
rs1295031971 2025 dbSNP
rs1012411924 2028 dbSNP
rs1023396438 2030 dbSNP
rs1322967302 2039 dbSNP
rs970425290 2048 dbSNP
rs930426045 2052 dbSNP
rs1279338338 2054 dbSNP
rs1271217726 2055 dbSNP
rs538596135 2074 dbSNP
rs1205437578 2075 dbSNP
rs982203527 2075 dbSNP
rs1404753557 2081 dbSNP
rs1030637767 2085 dbSNP
rs1458494670 2089 dbSNP
rs1408190071 2092 dbSNP
rs1237286541 2093 dbSNP
rs910187393 2098 dbSNP
rs553791215 2106 dbSNP
rs1190746771 2116 dbSNP
rs1238956849 2119 dbSNP
rs1419200251 2121 dbSNP
rs149960501 2122 dbSNP
rs1460777117 2124 dbSNP
rs1040293266 2132 dbSNP
rs1317753449 2133 dbSNP
rs989451741 2134 dbSNP
rs75250613 2136 dbSNP
rs963854406 2141 dbSNP
rs1316111945 2142 dbSNP
rs1245932213 2143 dbSNP
rs934468511 2145 dbSNP
rs555162692 2154 dbSNP
rs771680660 2166 dbSNP
rs893218196 2170 dbSNP
rs975178385 2186 dbSNP
rs576534975 2194 dbSNP
rs543710805 2195 dbSNP
rs933379882 2197 dbSNP
rs1190414992 2198 dbSNP
rs1412668430 2204 dbSNP
rs1023062338 2206 dbSNP
rs1355997813 2210 dbSNP
rs1292969044 2217 dbSNP
rs558787010 2217 dbSNP
rs1245629700 2220 dbSNP
rs577112670 2233 dbSNP
rs1002850457 2234 dbSNP
rs541073552 2239 dbSNP
rs1268523259 2241 dbSNP
rs1357725230 2242 dbSNP
rs1035888972 2244 dbSNP
rs907896213 2251 dbSNP
rs559466284 2255 dbSNP
rs1341497542 2263 dbSNP
rs749593688 2268 dbSNP
rs961637765 2271 dbSNP
rs1278141992 2276 dbSNP
rs899378916 2279 dbSNP
rs1303545511 2285 dbSNP
rs1423829870 2288 dbSNP
rs1363477105 2293 dbSNP
rs760146027 2294 dbSNP
rs1429004847 2298 dbSNP
rs1258584321 2299 dbSNP
rs1184792425 2310 dbSNP
rs1481550307 2313 dbSNP
rs1269944952 2314 dbSNP
rs189172137 2317 dbSNP
rs1045231995 2321 dbSNP
rs1277184167 2330 dbSNP
rs766955305 2331 dbSNP
rs145134929 2333 dbSNP
rs1003322177 2334 dbSNP
rs1271682311 2337 dbSNP
rs561158044 2346 dbSNP
rs1031150255 2361 dbSNP
rs956433074 2363 dbSNP
rs1283597678 2366 dbSNP
rs1010955956 2373 dbSNP
rs984920752 2376 dbSNP
rs910324742 2390 dbSNP
rs6718068 2397 dbSNP
rs1168180371 2404 dbSNP
rs975774848 2410 dbSNP
rs922469855 2417 dbSNP
rs192303406 2419 dbSNP
rs923176871 2420 dbSNP
rs934613469 2434 dbSNP
rs1432692634 2435 dbSNP
rs1175298161 2436 dbSNP
rs1253138860 2450 dbSNP
rs1178069710 2451 dbSNP
rs1480598361 2452 dbSNP
rs765705020 2462 dbSNP
rs1325117563 2463 dbSNP
rs1381602081 2463 dbSNP
rs762350268 2464 dbSNP
rs1316104871 2465 dbSNP
rs1328317035 2467 dbSNP
rs879316764 2477 dbSNP
rs892930191 2479 dbSNP
rs1222561100 2490 dbSNP
rs947259413 2493 dbSNP
rs1044440197 2498 dbSNP
rs1308900879 2500 dbSNP
rs1372342315 2502 dbSNP
rs149137602 2503 dbSNP
rs1454492535 2506 dbSNP
rs905982960 2510 dbSNP
rs1468433712 2517 dbSNP
rs1303019455 2520 dbSNP
rs753057434 2522 dbSNP
rs1160084447 2524 dbSNP
rs1418923700 2525 dbSNP
rs1248817956 2526 dbSNP
rs1185994627 2528 dbSNP
rs1346006086 2534 dbSNP
rs1243228861 2543 dbSNP
rs1002819290 2551 dbSNP
rs1202426422 2557 dbSNP
rs1481982237 2564 dbSNP
rs1236693894 2565 dbSNP
rs538928320 2567 dbSNP
rs1035691386 2569 dbSNP
rs547441485 2571 dbSNP
rs994795050 2572 dbSNP
rs767958271 2576 dbSNP
rs1450610182 2581 dbSNP
rs565507529 2582 dbSNP
rs1289708405 2583 dbSNP
rs952970752 2589 dbSNP
rs1165790670 2598 dbSNP
rs1445786941 2609 dbSNP
rs1251772909 2610 dbSNP
rs1182283711 2613 dbSNP
rs1452218530 2613 dbSNP
rs183016804 2614 dbSNP
rs1395508493 2617 dbSNP
rs1017352770 2621 dbSNP
rs892169780 2630 dbSNP
rs560512460 2639 dbSNP
rs75276964 2646 dbSNP
rs1387027081 2656 dbSNP
rs1223345123 2660 dbSNP
rs113850457 2665 dbSNP
rs1314373123 2673 dbSNP
rs373155249 2678 dbSNP
rs1021886148 2682 dbSNP
rs963667006 2684 dbSNP
rs996740462 2685 dbSNP
rs1305177185 2687 dbSNP
rs570242366 2689 dbSNP
rs1325302558 2692 dbSNP
rs1029529806 2695 dbSNP
rs955271089 2696 dbSNP
rs117004794 2701 dbSNP
rs1476647605 2703 dbSNP
rs1374325940 2708 dbSNP
rs1193187718 2709 dbSNP
rs914519004 2712 dbSNP
rs1015014392 2719 dbSNP
rs1201125168 2723 dbSNP
rs962415644 2729 dbSNP
rs1290727424 2737 dbSNP
rs973416268 2745 dbSNP
rs1341307809 2746 dbSNP
rs920624228 2747 dbSNP
rs948018226 2754 dbSNP
rs1335590354 2759 dbSNP
rs1237333144 2761 dbSNP
rs1226868491 2762 dbSNP
rs1263079249 2763 dbSNP
rs981059809 2763 dbSNP
rs928167563 2771 dbSNP
rs947193023 2774 dbSNP
rs1213542613 2779 dbSNP
rs1405757709 2787 dbSNP
rs1345302845 2790 dbSNP
rs1301635872 2793 dbSNP
rs1412134336 2808 dbSNP
rs939537312 2813 dbSNP
rs758620862 2816 dbSNP
rs927376606 2821 dbSNP
rs1420789720 2827 dbSNP
rs938727102 2831 dbSNP
rs764259458 2832 dbSNP
rs187824755 2840 dbSNP
rs1253233513 2848 dbSNP
rs897121369 2855 dbSNP
rs1267927023 2857 dbSNP
rs191701719 2865 dbSNP
rs1418340181 2868 dbSNP
rs1196413468 2877 dbSNP
rs527684681 2880 dbSNP
rs1251245335 2886 dbSNP
rs1049106252 2890 dbSNP
rs1195126406 2904 dbSNP
rs1316196022 2913 dbSNP
rs184244307 2915 dbSNP
rs1265032862 2916 dbSNP
rs1179405530 2919 dbSNP
rs888732659 2921 dbSNP
rs1043436561 2925 dbSNP
rs1470491458 2930 dbSNP
rs1444886847 2934 dbSNP
rs899545286 2934 dbSNP
rs1007055918 2937 dbSNP
rs1445179967 2941 dbSNP
rs553347435 2942 dbSNP
rs574713941 2943 dbSNP
rs542310527 2944 dbSNP
rs370258910 2946 dbSNP
rs1428238270 2952 dbSNP
rs1396025229 2961 dbSNP
rs1170445589 2962 dbSNP
rs891000292 2971 dbSNP
rs1004069272 2973 dbSNP
rs1389834363 2977 dbSNP
rs575797271 2984 dbSNP
rs1030103711 2986 dbSNP
rs1233260820 2988 dbSNP
rs1460917263 2995 dbSNP
rs1276854448 2996 dbSNP
rs973508114 3002 dbSNP
rs1351908404 3009 dbSNP
rs1291942650 3025 dbSNP
rs955879646 3028 dbSNP
rs1238645670 3039 dbSNP
rs969385384 3058 dbSNP
rs980728805 3059 dbSNP
rs1452822179 3060 dbSNP
rs928255125 3064 dbSNP
rs988523927 3067 dbSNP
rs1402036091 3076 dbSNP
rs1385443388 3077 dbSNP
rs914464252 3082 dbSNP
rs968701153 3091 dbSNP
rs1437762355 3092 dbSNP
rs1184124176 3093 dbSNP
rs979989667 3094 dbSNP
rs543686686 3096 dbSNP
rs1214998341 3097 dbSNP
rs1235780940 3100 dbSNP
rs1218236589 3102 dbSNP
rs939569106 3118 dbSNP
rs1214982742 3125 dbSNP
rs1362038343 3132 dbSNP
rs1316406445 3145 dbSNP
rs751615563 3148 dbSNP
rs1265451789 3150 dbSNP
rs927094466 3151 dbSNP
rs988396135 3154 dbSNP
rs1281884188 3158 dbSNP
rs938532838 3167 dbSNP
rs1057122551 3174 dbSNP
rs1297184052 3183 dbSNP
rs752572938 3184 dbSNP
rs1367171269 3185 dbSNP
rs946881361 3190 dbSNP
rs1132623 3191 dbSNP
rs4132143 3196 dbSNP
rs1483249279 3200 dbSNP
rs565048076 3202 dbSNP
rs1048425295 3204 dbSNP
rs1476262099 3205 dbSNP
rs888693659 3213 dbSNP
rs1191743786 3225 dbSNP
rs1490958326 3227 dbSNP
rs1292899759 3228 dbSNP
rs1222442126 3235 dbSNP
rs532465780 3237 dbSNP
rs1016422476 3244 dbSNP
rs932324221 3244 dbSNP
rs1215872108 3246 dbSNP
rs1397724337 3246 dbSNP
rs535294267 3246 dbSNP
rs963119369 3246 dbSNP
rs1347181808 3253 dbSNP
rs1372509597 3261 dbSNP
rs1460687691 3262 dbSNP
rs1300092642 3267 dbSNP
rs1397706282 3271 dbSNP
rs1435678096 3277 dbSNP
rs1347987750 3278 dbSNP
rs1039988744 3280 dbSNP
rs1414546716 3283 dbSNP
rs891059662 3292 dbSNP
rs1168832166 3295 dbSNP
rs1481519090 3295 dbSNP
rs565898296 3298 dbSNP
rs1270057090 3305 dbSNP
rs901317039 3307 dbSNP
rs536484772 3312 dbSNP
rs373248366 3314 dbSNP
rs1312845463 3316 dbSNP
rs898362813 3318 dbSNP
rs1205798127 3326 dbSNP
rs1307621850 3333 dbSNP
rs1306367355 3341 dbSNP
rs1216442602 3348 dbSNP
rs1325155955 3357 dbSNP
rs995331517 3359 dbSNP
rs1027743372 3363 dbSNP
rs1365190633 3364 dbSNP
rs972230085 3366 dbSNP
rs998377983 3367 dbSNP
rs1442779243 3368 dbSNP
rs528283746 3373 dbSNP
rs1030480654 3377 dbSNP
rs891574969 3381 dbSNP
rs1175620493 3386 dbSNP
rs1431840232 3390 dbSNP
rs1410589974 3395 dbSNP
rs1035459484 3402 dbSNP
rs1209874523 3404 dbSNP
rs1237033358 3405 dbSNP
rs960719568 3407 dbSNP
rs988837169 3410 dbSNP
rs559305454 3411 dbSNP
rs1182338671 3412 dbSNP
rs1261187777 3417 dbSNP
rs529620313 3418 dbSNP
rs1308834084 3420 dbSNP
rs1224277732 3431 dbSNP
rs1375986744 3432 dbSNP
rs111617162 3436 dbSNP
rs1426778054 3440 dbSNP
rs968795640 3442 dbSNP
rs1406878855 3443 dbSNP
rs1172891255 3446 dbSNP
rs1302536805 3448 dbSNP
rs548160041 3458 dbSNP
rs1464689175 3463 dbSNP
rs772763897 3464 dbSNP
rs1160200125 3468 dbSNP
rs979962264 3469 dbSNP
rs1379060730 3470 dbSNP
rs1034249170 3474 dbSNP
rs1172163718 3482 dbSNP
rs1185957633 3484 dbSNP
rs1445983399 3485 dbSNP
rs1199554432 3497 dbSNP
rs1256184000 3497 dbSNP
rs1377607670 3500 dbSNP
rs959849375 3505 dbSNP
rs992651606 3514 dbSNP
rs1217145611 3517 dbSNP
rs1415958031 3519 dbSNP
rs1352713862 3525 dbSNP
rs918659661 3527 dbSNP
rs569460842 3528 dbSNP
rs189009883 3540 dbSNP
rs552388542 3541 dbSNP
rs912239645 3542 dbSNP
rs570676638 3543 dbSNP
rs1360715395 3552 dbSNP
rs1364277703 3563 dbSNP
rs1380027343 3567 dbSNP
rs1419549639 3572 dbSNP
rs939700523 3573 dbSNP
rs535008036 3579 dbSNP
rs1178700644 3582 dbSNP
rs549301473 3584 dbSNP
rs909851839 3587 dbSNP
rs1342450289 3599 dbSNP
rs898375676 3603 dbSNP
rs1263497207 3606 dbSNP
rs942695077 3607 dbSNP
rs1039959200 3608 dbSNP
rs1382170187 3611 dbSNP
rs1193897166 3613 dbSNP
rs1487866666 3614 dbSNP
rs901452992 3616 dbSNP
rs995357486 3636 dbSNP
rs112256537 3642 dbSNP
rs1356874859 3643 dbSNP
rs192245614 3644 dbSNP
rs1052654368 3645 dbSNP
rs76903512 3646 dbSNP
rs185458896 3647 dbSNP
rs1002311030 3656 dbSNP
rs145981837 3658 dbSNP
rs1349727149 3660 dbSNP
rs892628905 3664 dbSNP
rs1035106321 3665 dbSNP
rs1390723637 3667 dbSNP
rs1210777034 3673 dbSNP
rs1009952697 3691 dbSNP
rs1021805066 3696 dbSNP
rs766065022 3705 dbSNP
rs1021629860 3713 dbSNP
rs753559502 3718 dbSNP
rs1001181713 3726 dbSNP
rs1248645617 3734 dbSNP
rs1454019771 3739 dbSNP
rs1477266619 3741 dbSNP
rs1191927772 3748 dbSNP
rs1397322695 3753 dbSNP
rs1201242902 3754 dbSNP
rs968250574 3757 dbSNP
rs1162527420 3766 dbSNP
rs1415374299 3772 dbSNP
rs1266666289 3777 dbSNP
rs190811460 3779 dbSNP
rs1343939133 3783 dbSNP
rs1258749993 3800 dbSNP
rs959982251 3805 dbSNP
rs993070026 3809 dbSNP
rs1025439043 3810 dbSNP
rs1316233837 3818 dbSNP
rs1285421173 3821 dbSNP
rs1234515129 3824 dbSNP
rs951299998 3826 dbSNP
rs984194434 3827 dbSNP
rs1330857618 3849 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0015081
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3344.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000340553.3 | 3UTR | UUUUUUUGUGCAAUAUAUUACUAAAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000340553.3 | 3UTR | UUUUUUUGUGCAAUAUAUUACUAAAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000340553.3 | 3UTR | UUUUUUUGUGCAAUAUAUUACUAAAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000340553.3 | 3UTR | AAGUUUUUUUGUGCAAUAUAUUACUAAAUCAGUUAUUAUUUUACUUUUCCAAAUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000340553.3 | 3UTR | UUUUUUUGUGCAAUAUAUUACUAAAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000340553.3 | 3UTR | UGAAGUUUUUUUGUGCAAUAUAUUACUAAAUCAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000340553.3 | 3UTR | UGAAGUUUUUUUGUGCAAUAUAUUACUAAAUCAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
272 hsa-miR-548x-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055345 PDCD4 programmed cell death 4 2 2
MIRT078705 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT088874 FOXN2 forkhead box N2 2 10
MIRT099608 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT111796 MPZL1 myelin protein zero like 1 2 2
MIRT166770 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT221305 LMBR1 limb development membrane protein 1 2 2
MIRT269385 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT309057 C4ORF3 chromosome 4 open reading frame 3 2 2
MIRT318546 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT325432 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT331321 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT336799 ARF1 ADP ribosylation factor 1 2 4
MIRT350501 MRGBP MRG domain binding protein 2 6
MIRT374396 M6PR mannose-6-phosphate receptor, cation dependent 2 4
MIRT399353 IER2 immediate early response 2 2 2
MIRT401029 MOB1B MOB kinase activator 1B 2 4
MIRT441724 HAUS6 HAUS augmin like complex subunit 6 2 2
MIRT442376 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT442402 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT443984 GJD3 gap junction protein delta 3 2 4
MIRT444042 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT444240 CHMP1B charged multivesicular body protein 1B 2 2
MIRT444397 FRMD5 FERM domain containing 5 2 2
MIRT444458 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT444639 HSBP1 heat shock factor binding protein 1 2 2
MIRT444850 EXD2 exonuclease 3'-5' domain containing 2 2 2
MIRT444983 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445102 ZNF207 zinc finger protein 207 2 2
MIRT445444 HSPA14 heat shock protein family A (Hsp70) member 14 2 4
MIRT445510 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 4
MIRT445585 RCC2 regulator of chromosome condensation 2 2 2
MIRT445674 TNFSF15 TNF superfamily member 15 2 2
MIRT445728 PGK1 phosphoglycerate kinase 1 2 2
MIRT445822 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT445991 CD1D CD1d molecule 2 2
MIRT446063 RABIF RAB interacting factor 2 2
MIRT446141 ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 2 2
MIRT446297 ACSL3 acyl-CoA synthetase long chain family member 3 2 2
MIRT446421 ABHD2 abhydrolase domain containing 2 2 2
MIRT447258 C3orf30 chromosome 3 open reading frame 30 2 2
MIRT447687 MTPAP mitochondrial poly(A) polymerase 2 2
MIRT447747 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT447878 LMAN1 lectin, mannose binding 1 2 2
MIRT448027 GSR glutathione-disulfide reductase 2 2
MIRT448150 P2RY10 purinergic receptor P2Y10 2 2
MIRT448210 SNAI2 snail family transcriptional repressor 2 2 2
MIRT448409 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT448885 DENND4C DENN domain containing 4C 2 2
MIRT449038 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449264 PALM2 paralemmin 2 2 2
MIRT449566 GPC5 glypican 5 2 4
MIRT450111 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 2 2
MIRT450144 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT450601 EXOC2 exocyst complex component 2 2 2
MIRT459242 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT464459 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465109 TSC22D2 TSC22 domain family member 2 2 4
MIRT466773 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 4
MIRT467985 SKIL SKI like proto-oncogene 2 4
MIRT469258 RHOB ras homolog family member B 2 2
MIRT470712 POGK pogo transposable element derived with KRAB domain 2 2
MIRT472375 NEK7 NIMA related kinase 7 2 2
MIRT475017 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT475243 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 2
MIRT475673 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT479400 CDKN1B cyclin dependent kinase inhibitor 1B 2 10
MIRT482616 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT490483 FEM1C fem-1 homolog C 2 2
MIRT492171 SOX4 SRY-box 4 2 10
MIRT493554 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT494642 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 2
MIRT497505 ZNF652 zinc finger protein 652 2 4
MIRT499145 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT502076 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT502819 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503931 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504224 MYO6 myosin VI 2 2
MIRT506011 PURA purine rich element binding protein A 2 2
MIRT506411 NHLRC3 NHL repeat containing 3 2 6
MIRT508018 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT508288 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT508353 HES7 hes family bHLH transcription factor 7 2 6
MIRT510843 RARB retinoic acid receptor beta 2 6
MIRT511504 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT511975 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT512296 AMER1 APC membrane recruitment protein 1 2 6
MIRT515646 MYBPC1 myosin binding protein C, slow type 2 2
MIRT518418 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT519687 ZNF620 zinc finger protein 620 2 2
MIRT521593 PSMA2 proteasome subunit alpha 2 2 4
MIRT527236 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT527274 FBLN2 fibulin 2 2 2
MIRT527372 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT527443 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT528337 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529094 ZNF100 zinc finger protein 100 2 2
MIRT529656 ZNF81 zinc finger protein 81 2 2
MIRT530052 TRIM72 tripartite motif containing 72 2 2
MIRT530266 MKRN3 makorin ring finger protein 3 2 2
MIRT530868 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531241 FANCC Fanconi anemia complementation group C 2 2
MIRT531403 TMEM18 transmembrane protein 18 2 2
MIRT534416 SEMA4F ssemaphorin 4F 2 2
MIRT534495 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT534760 RASGEF1A RasGEF domain family member 1A 2 2
MIRT534937 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT536967 HAS3 hyaluronan synthase 3 2 2
MIRT537628 ERI1 exoribonuclease 1 2 2
MIRT537715 ELK3 ELK3, ETS transcription factor 2 2
MIRT538767 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539957 SPRY1 sprouty RTK signaling antagonist 1 2 2
MIRT540953 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541269 GPC4 glypican 4 2 4
MIRT543342 ZNF829 zinc finger protein 829 2 2
MIRT543612 MFAP3 microfibril associated protein 3 2 2
MIRT543639 YY2 YY2 transcription factor 2 2
MIRT544222 GTF2B general transcription factor IIB 2 2
MIRT544408 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544934 SNCB synuclein beta 2 2
MIRT545316 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT546083 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT548511 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT548627 DAZAP1 DAZ associated protein 1 2 4
MIRT551023 SPPL3 signal peptide peptidase like 3 2 2
MIRT552053 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 4
MIRT553263 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553292 TSPAN3 tetraspanin 3 2 2
MIRT553608 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT554196 SLC35D1 solute carrier family 35 member D1 2 2
MIRT554790 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT554833 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT555704 PDZD8 PDZ domain containing 8 2 2
MIRT556058 MTF2 metal response element binding transcription factor 2 2 4
MIRT557197 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 4
MIRT557994 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT558669 CNIH cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT558949 CBFB core-binding factor beta subunit 2 2
MIRT559021 C20orf24 chromosome 20 open reading frame 24 2 2
MIRT559097 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT559853 GSKIP GSK3B interacting protein 2 2
MIRT561586 SKI SKI proto-oncogene 2 2
MIRT562257 GRB2 growth factor receptor bound protein 2 2 2
MIRT562408 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 2
MIRT562641 ARID1A AT-rich interaction domain 1A 2 4
MIRT564268 DEPDC1B DEP domain containing 1B 2 2
MIRT565296 TMEM64 transmembrane protein 64 2 2
MIRT565387 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566559 OTUD4 OTU deubiquitinase 4 2 2
MIRT566703 MTMR3 myotubularin related protein 3 2 2
MIRT566779 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT568406 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT571812 PHF19 PHD finger protein 19 2 2
MIRT571984 HOXA9 homeobox A9 2 2
MIRT573745 KHSRP KH-type splicing regulatory protein 2 2
MIRT573988 DDX21 DExD-box helicase 21 2 2
MIRT574483 RPS16 ribosomal protein S16 2 2
MIRT574502 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT574548 NRBF2 nuclear receptor binding factor 2 2 2
MIRT576675 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT608348 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT608629 ATP9A ATPase phospholipid transporting 9A (putative) 2 6
MIRT609174 ZNF581 zinc finger protein 581 2 2
MIRT609787 NHSL1 NHS like 1 2 2
MIRT610670 SYT2 synaptotagmin 2 2 4
MIRT610875 NUDCD3 NudC domain containing 3 2 2
MIRT611019 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT611665 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT612062 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT612481 SLC25A11 solute carrier family 25 member 11 2 2
MIRT612643 PSPC1 paraspeckle component 1 2 2
MIRT612683 PLXNA4 plexin A4 2 2
MIRT613103 ESR1 estrogen receptor 1 2 2
MIRT613544 AMPD3 adenosine monophosphate deaminase 3 2 2
MIRT614527 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT614564 GMPR guanosine monophosphate reductase 2 2
MIRT614656 ZNF608 zinc finger protein 608 2 2
MIRT614670 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT615308 CCDC158 coiled-coil domain containing 158 2 2
MIRT616107 GGCX gamma-glutamyl carboxylase 2 2
MIRT617745 MICA MHC class I polypeptide-related sequence A 2 2
MIRT618792 ZIC2 Zic family member 2 2 2
MIRT619222 FUNDC2 FUN14 domain containing 2 2 2
MIRT620276 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT620486 XKR6 XK related 6 2 2
MIRT622608 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT622962 OXSR1 oxidative stress responsive 1 2 2
MIRT623477 KDM5A lysine demethylase 5A 2 2
MIRT623621 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT623694 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT624810 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT625183 GRIK4 glutamate ionotropic receptor kainate type subunit 4 2 2
MIRT625362 CDKL2 cyclin dependent kinase like 2 2 2
MIRT625914 GBP6 guanylate binding protein family member 6 2 2
MIRT625957 RNF2 ring finger protein 2 2 2
MIRT626259 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT626420 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 2 2
MIRT626846 FDX1 ferredoxin 1 2 2
MIRT628009 MEF2C myocyte enhancer factor 2C 2 2
MIRT628042 LIMD1 LIM domains containing 1 2 2
MIRT628355 CCDC117 coiled-coil domain containing 117 2 2
MIRT628456 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT630924 UNC93A unc-93 homolog A 2 2
MIRT635221 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT635473 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT638144 TTC26 tetratricopeptide repeat domain 26 2 2
MIRT638290 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT638426 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640270 TCF24 transcription factor 24 2 2
MIRT641178 STX4 syntaxin 4 2 2
MIRT642290 ZNF99 zinc finger protein 99 2 2
MIRT643265 ZNF566 zinc finger protein 566 2 2
MIRT643576 CTNNA3 catenin alpha 3 2 2
MIRT644168 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644428 VDR vitamin D receptor 2 2
MIRT644609 C17orf77 chromosome 17 open reading frame 77 2 2
MIRT644850 PGM2 phosphoglucomutase 2 2 2
MIRT645444 ATF6B activating transcription factor 6 beta 2 2
MIRT647198 ZNF583 zinc finger protein 583 2 2
MIRT649416 CDC14B cell division cycle 14B 2 2
MIRT650494 UFM1 ubiquitin fold modifier 1 2 2
MIRT650690 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT651204 ZNF280B zinc finger protein 280B 2 2
MIRT653777 SIX4 SIX homeobox 4 2 2
MIRT655052 PKN2 protein kinase N2 2 2
MIRT655702 NUDT21 nudix hydrolase 21 2 2
MIRT656938 KIAA1456 KIAA1456 2 2
MIRT658270 FAXC failed axon connections homolog 2 2
MIRT658514 ETV3 ETS variant 3 2 2
MIRT658650 ENAH ENAH, actin regulator 2 2
MIRT658683 EMP2 epithelial membrane protein 2 2 2
MIRT659236 CXCR5 C-X-C motif chemokine receptor 5 2 2
MIRT659284 CTDSPL2 CTD small phosphatase like 2 2 2
MIRT660096 BTBD3 BTB domain containing 3 2 2
MIRT660458 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT663643 INTU inturned planar cell polarity protein 2 2
MIRT664060 KIAA1551 KIAA1551 2 2
MIRT666135 SPATS2L spermatogenesis associated serine rich 2 like 2 2
MIRT675544 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT684993 RPL10A ribosomal protein L10a 2 2
MIRT685682 TRIM45 tripartite motif containing 45 2 2
MIRT687480 NHLRC2 NHL repeat containing 2 2 2
MIRT687794 KCNJ15 potassium voltage-gated channel subfamily J member 15 2 2
MIRT687818 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT687906 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT687957 HHIP hedgehog interacting protein 2 2
MIRT689209 ZNF574 zinc finger protein 574 2 2
MIRT689476 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT690490 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT692279 XRN2 5'-3' exoribonuclease 2 2 2
MIRT693049 KIAA1324 KIAA1324 2 2
MIRT697432 ZFHX3 zinc finger homeobox 3 2 2
MIRT698464 TJP1 tight junction protein 1 2 2
MIRT699022 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699774 SEMA4D semaphorin 4D 2 2
MIRT701858 MRO maestro 2 2
MIRT702147 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT702230 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT703739 FAM126B family with sequence similarity 126 member B 2 2
MIRT704266 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT707740 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT709850 SNX12 sorting nexin 12 2 2
MIRT712736 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT712944 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT713137 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT715524 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT718270 ZNF749 zinc finger protein 749 2 2
MIRT720141 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT722708 ZNF460 zinc finger protein 460 2 2
MIRT723248 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT724235 DGKE diacylglycerol kinase epsilon 2 2
MIRT725071 WTIP WT1 interacting protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548x Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-548x-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-548x-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-548x-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-548x-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548x-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548x-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission