>PCBP1|NM_006196|3'UTR
   1 AACAGTGTAGGTTCCCTCAATAACCCCTTTCTGCTGTTCTCCCATGATCCAACTGTGTAATTTCTGGTCAGTGATTCCAG
  81 GTTTTAAATAATTTGTAAGTGTTCAGTTTCTACACAACTTTATCATCCGCTAAGAATTTAAAAATCACATTCTCTGTTCA
 161 GCTGTTAATGCTGGGATCCATATTTAGTTTTATAAGCTTTTCCCTGTTTTTAGTTTTGTTTTGGGTTTTTTGGCTCATGA
 241 ATTTTATTTCTGTTTGTCGATAAGAAATGTAAGAGTGGAATGTTAATAAATTTCAGTTTAGTTCTGTAATGTCAAGAATT
 321 TAAGAATTAAAAAACGGATTGGTTAAAAAATGCTTCATATTTGAAAAAGCTGGGAATTGCTGTCTTAAAAAAAAAAAAAA
 401 AAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gcUUAGGUGGUGCUUGUUGAAg 5' |:|:: |:|| ||||||| Target 5' tcAGTTT-CTAC--ACAACTTt 3'	103 - 121	151.00	-9.20
2	miRNA 3' gcUUAGGU--GGUGCUUGUUGAAg 5' | |||| :: : ||:||:|| Target 5' tgATTCCAGGTTTTAAATAATTTg 3'	72 - 95	122.00	-6.00
3	miRNA 3' gcUUAGGUGGUGCUUGUUGAAg 5' :||||| | :| ::||:|| Target 5' atGATCCAAC-TGTGTAATTTc 3'	44 - 64	115.00	-13.00

Mutant ID	Mutant Position	Mutant Source
COSN30498460	19	COSMIC
COSN30462898	28	COSMIC
COSN30130447	30	COSMIC
COSN31560366	34	COSMIC
COSN509911	40	COSMIC
COSN30531705	99	COSMIC
COSN30135559	199	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1195921512	1	dbSNP
rs372775083	4	dbSNP
rs1257393815	8	dbSNP
rs757248753	9	dbSNP
rs1192226334	12	dbSNP
rs781090011	14	dbSNP
rs376966237	16	dbSNP
rs755613390	17	dbSNP
rs1362166330	18	dbSNP
rs1453263143	21	dbSNP
rs757330525	26	dbSNP
rs1271251023	28	dbSNP
rs1194875392	29	dbSNP
rs1389018484	30	dbSNP
rs192105693	31	dbSNP
rs748359478	31	dbSNP
rs369638534	32	dbSNP
rs748492618	35	dbSNP
rs772753345	36	dbSNP
rs1387315527	37	dbSNP
rs1451596805	37	dbSNP
rs11545482	42	dbSNP
rs199623299	45	dbSNP
rs1237802251	46	dbSNP
rs770917988	47	dbSNP
rs1330846502	48	dbSNP
rs1212186814	50	dbSNP
rs376589774	52	dbSNP
rs759730864	53	dbSNP
rs1172956253	54	dbSNP
rs530697527	55	dbSNP
rs547114091	57	dbSNP
rs567013801	63	dbSNP
rs1164355837	67	dbSNP
rs539016952	68	dbSNP
rs745431326	70	dbSNP
rs552629382	78	dbSNP
rs185030267	82	dbSNP
rs1239658227	86	dbSNP
rs1275007935	89	dbSNP
rs1307942340	92	dbSNP
rs1467653274	92	dbSNP
rs1203737083	94	dbSNP
rs1230026981	96	dbSNP
rs1249068322	98	dbSNP
rs1348438974	98	dbSNP
rs13402589	100	dbSNP
rs1239464996	102	dbSNP
rs1378784242	105	dbSNP
rs1490703283	111	dbSNP
rs1438906793	114	dbSNP
rs769207371	115	dbSNP
rs1393836671	119	dbSNP
rs977396900	128	dbSNP
rs924583075	129	dbSNP
rs957699402	135	dbSNP
rs1440725112	137	dbSNP
rs1479658367	144	dbSNP
rs779714822	147	dbSNP
rs1191372275	148	dbSNP
rs538155245	149	dbSNP
rs1453422021	153	dbSNP
rs1253149903	158	dbSNP
rs1188596451	160	dbSNP
rs11545481	162	dbSNP
rs746508371	163	dbSNP
rs1420676849	165	dbSNP
rs990228143	168	dbSNP
rs1355602000	173	dbSNP
rs189462743	180	dbSNP
rs1168984782	181	dbSNP
rs915083856	181	dbSNP
rs1367509529	183	dbSNP
rs1370504730	192	dbSNP
rs1425429834	194	dbSNP
rs931822569	198	dbSNP
rs1438660637	203	dbSNP
rs1050367181	204	dbSNP
rs1040145333	205	dbSNP
rs1364005079	206	dbSNP
rs771329491	213	dbSNP
rs1433166436	214	dbSNP
rs1362926909	217	dbSNP
rs1172150738	221	dbSNP
rs1453471140	222	dbSNP
rs1036035704	226	dbSNP
rs748894413	227	dbSNP
rs1192531425	228	dbSNP
rs1474153331	233	dbSNP
rs768946898	237	dbSNP
rs1277493653	239	dbSNP
rs1194307228	243	dbSNP
rs777122984	249	dbSNP
rs1213868755	250	dbSNP
rs796285440	251	dbSNP
rs758716176	254	dbSNP
rs1347477302	257	dbSNP
rs765157859	259	dbSNP
rs1043295	265	dbSNP
rs1359964884	270	dbSNP
rs1222669570	272	dbSNP
rs1401211662	274	dbSNP
rs774768147	275	dbSNP
rs1311486239	285	dbSNP
rs1342914631	285	dbSNP
rs1434523754	287	dbSNP
rs1489682214	295	dbSNP
rs1177806220	302	dbSNP
rs1407789677	309	dbSNP
rs1418251626	311	dbSNP
rs370079510	326	dbSNP
rs1478788096	327	dbSNP
rs1013084959	329	dbSNP
rs894671166	329	dbSNP
rs1483464303	333	dbSNP
rs374090763	336	dbSNP
rs1475322260	337	dbSNP
rs971632134	339	dbSNP
rs762281126	352	dbSNP
rs748575003	353	dbSNP
rs1320046030	356	dbSNP
rs1292006150	358	dbSNP
rs917179183	360	dbSNP
rs962248906	364	dbSNP
rs1414641181	371	dbSNP
rs999034763	383	dbSNP
rs1304955419	387	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.