pre-miRNA Information
pre-miRNA hsa-mir-758   
Genomic Coordinates chr14: 101026020 - 101026107
Synonyms MIRN758, hsa-mir-758, MIR758
Description Homo sapiens miR-758 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-758-5p
Sequence 15| GAUGGUUGACCAGAGAGCACAC |36
Evidence Experimental
Experiments SOLiD
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 16 14 + 101026049 29233923 MiREDiBase
A-to-I 21 14 + 101026054 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs372417522 1 dbSNP
rs748092616 2 dbSNP
rs1270901332 4 dbSNP
rs1364206491 5 dbSNP
rs1483583954 8 dbSNP
rs770931807 10 dbSNP
rs776760808 11 dbSNP
rs1360350664 12 dbSNP
rs759742151 13 dbSNP
rs1002938972 15 dbSNP
rs770107042 17 dbSNP
rs369242818 20 dbSNP
rs1217090272 21 dbSNP
rs763341052 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TET3
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cacacgagaGACCAGUUGGUAg 5'
                   ||   ||||||| 
Target 5' -------aaCUUAACAACCAUa 3'
1 - 15
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000409262.3 | 3UTR | AACUUAACAACCAUACUUGAAUAUUCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
62 hsa-miR-758-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT085323 MORC3 MORC family CW-type zinc finger 3 2 2
MIRT089441 STAMBP STAM binding protein 2 2
MIRT089456 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT111856 CCND1 cyclin D1 2 2
MIRT184933 ZNF268 zinc finger protein 268 2 2
MIRT215288 CREBRF CREB3 regulatory factor 2 2
MIRT237300 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT238446 MYO10 myosin X 2 4
MIRT273827 RPL41 ribosomal protein L41 2 2
MIRT282703 HOOK1 hook microtubule tethering protein 1 2 2
MIRT347970 ZNF850 zinc finger protein 850 2 2
MIRT371076 KLF3 Kruppel like factor 3 2 2
MIRT464339 USP6NL USP6 N-terminal like 2 2
MIRT470034 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT477506 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT482886 CACNA2D3 calcium voltage-gated channel auxiliary subunit alpha2delta 3 2 2
MIRT492606 POLR3E RNA polymerase III subunit E 2 2
MIRT502294 GNG12 G protein subunit gamma 12 2 6
MIRT507600 DCTN4 dynactin subunit 4 2 4
MIRT510728 SON SON DNA binding protein 2 6
MIRT514065 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 8
MIRT519718 ZNF512B zinc finger protein 512B 2 4
MIRT520890 STRN striatin 2 2
MIRT521760 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT526874 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT530232 WSB2 WD repeat and SOCS box containing 2 2 2
MIRT532003 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT533371 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 4
MIRT547106 PIGW phosphatidylinositol glycan anchor biosynthesis class W 2 2
MIRT548189 FOXA1 forkhead box A1 2 2
MIRT552935 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT560085 ZNF195 zinc finger protein 195 2 2
MIRT561726 PPP2CA protein phosphatase 2 catalytic subunit alpha 2 2
MIRT562713 ZNF415 zinc finger protein 415 2 2
MIRT562761 ZNF846 zinc finger protein 846 2 2
MIRT564159 ZNF117 zinc finger protein 117 2 2
MIRT565673 SETD5 SET domain containing 5 2 2
MIRT565718 SESN3 sestrin 3 2 2
MIRT566026 RFX1 regulatory factor X1 2 2
MIRT569048 ZNF655 zinc finger protein 655 2 2
MIRT570367 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT570410 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT570443 TMEM189 transmembrane protein 189 2 2
MIRT571738 RNF11 ring finger protein 11 2 2
MIRT575042 Tpgs2 tubulin polyglutamylase complex subunit 2 2 4
MIRT614330 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT617629 RAB3IP RAB3A interacting protein 2 2
MIRT621667 UBE4B ubiquitination factor E4B 2 2
MIRT639906 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT651436 XRCC5 X-ray repair cross complementing 5 2 2
MIRT683853 ZNF208 zinc finger protein 208 2 2
MIRT684841 TPGS2 tubulin polyglutamylase complex subunit 2 2 5
MIRT689347 ZNF83 zinc finger protein 83 2 2
MIRT692492 SPIN4 spindlin family member 4 2 2
MIRT695711 OLA1 Obg like ATPase 1 2 2
MIRT698219 TMEM248 transmembrane protein 248 2 2
MIRT711560 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT712867 TMEM67 transmembrane protein 67 2 2
MIRT722956 TSPAN1 tetraspanin 1 2 2
MIRT723622 SOBP sine oculis binding protein homolog 2 2
MIRT724176 ABCF2 ATP binding cassette subfamily F member 2 2 2
MIRT755363 LMBR1 limb development membrane protein 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-758 Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-758 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-758 5-Fluorouracil approved 3385 Quantitative real-time PCR human squamous cell carcinoma cell line KYSE410 21743970 2011 up-regulated
miR-758 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-758 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-758 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-758 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-758-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-758-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-758-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-758-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-758-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-758-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-758-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-758-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission