miRTarBase - #MIRT089490


—
pre-miRNA Information
pre-miRNA hsa-mir-548g   
Genomic Coordinates chr4: 147344629 - 147344717
Synonyms MIRN548G, hsa-mir-548g, MIR548G
Description Homo sapiens miR-548g stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548g-5p
Sequence 15| UGCAAAAGUAAUUGCAGUUUUUG |37
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 4 - 147344700 29233923 MiREDiBase
A-to-I 7 4 - 147344697 29233923 MiREDiBase
A-to-I 16 4 - 147344688 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1428532945 1 dbSNP
rs749197968 2 dbSNP
rs1271780804 3 dbSNP
rs375562730 4 dbSNP
rs1340837915 12 dbSNP
rs1222552086 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTHFD2   
Synonyms NMDMC
Description methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Transcript NM_006636   
Expression
Putative miRNA Targets on MTHFD2
3'UTR of MTHFD2
(miRNA target sites are highlighted)		 
>MTHFD2|NM_006636|3'UTR
   1 CTACTGTGTCTTCTGTGTCACAAACAGCACTCCAGGCCAGCTCAAGAAGCAAAGCAGGCCAATAGAAATGCAATATTTTT
  81 AATTTATTCTACTGAAATGGTTTAAAATGATGCCTTGTATTTATTGAAAGCTTAAATGGGTGGGTGTTTCTGCACATACC
 161 TCTGCAGTACCTCACCAGGGAGCATTCCAGTATCATGCAGGGTCCTGTGATCTAGCCAGGAGCAGCCATTAACCTAGTGA
 241 TTAATATGGGAGACATTACCATATGGAGGATGGATGCTTCACTTTGTCAAGCACCTCAGTTACACATTCGCCTTTTCTAG
 321 GATTGCATTTCCCAAGTGCTATTGCAATAACAGTTGATACTCATTTTAGGTACCAAACCTTTTGAGTTCAACTGATCAAA
 401 CCAAAGGAAAAGTGTTGCTAGAGAAAATTAGGGAAAAGGTGAAAAAGAAAAAATGGTAGTAATTGAGCAGAAAAAAATTA
 481 ATTTATATATGTATTGATTGGCAACCAGATTTATCTAAGTAGAACTGAATTGGCTAGGAAAAAAGAAAAACTGCATGTTA
 561 ATCATTTTCCTAAGCTGTCCTTTTGAGGCTTAGTCAGTTTATTGGGAAAATGTTTAGGATTATTCCTTGCTATTAGTACT
 641 CATTTTATGTATGTTACCCTTCAGTAAGTTCTCCCCATTTTAGTTTTCTAGGACTGAAAGGATTCTTTTCTACATTATAC
 721 ATGTGTGTTGTCATATTTGGCTTTTGCTATATACTTTAACTTCATTGTTAAATTTTTGTATTGTATAGTTTCTTTGGTGT
 801 ATCTTAAAACCTATTTTTGAAAAACAAACTTGGCTTGATAATCATTTGGGCAGCTTGGGTAAGTACGCAACTTACTTTTC
 881 CACCAAAGAACTGTCAGCAGCTGCCTGCTTTTCTGTGATGTATGTATCCTGTTGACTTTTCCAGAAATTTTTTAAGAGTT
 961 TGAGTTACTATTGAATTTAATCAGACTTTCTGATTAAAGGGTTTTCTTTCTTTTTTAATAAAACACATCTGTCTGGTATG
1041 GTATGAATTTCTGAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guuuuUGAC-GU-UAA--UGAAAACGu 5'
               ::|| || |||  :||||||| 
Target 5' tgtgtGTTGTCATATTTGGCTTTTGCt 3'
 722 - 748 152.00 -9.10
2 
miRNA  3' guUUUUGACGUU-AAUGAAAACGu 5'
            |: || |||| |||||||| | 
Target 5' taAGTAC-GCAACTTACTTTTCCa 3'
 860 - 882 140.00 -11.20
3 
miRNA  3' guuUUUGACGUUAAUGAAAACgu 5'
             ||:|||    | ||||||  
Target 5' cctAAGCTG----TCCTTTTGag 3'
 569 - 587 134.00 -8.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31579901 29 COSMIC
COSN30476290 30 COSMIC
COSN30113132 66 COSMIC
COSN1242451 176 COSMIC
COSN16322991 344 COSMIC
COSN26647312 375 COSMIC
COSN26633224 448 COSMIC
COSN30545054 469 COSMIC
COSN17386612 479 COSMIC
COSN9386592 654 COSMIC
COSN29240187 720 COSMIC
COSN31579217 894 COSMIC
COSN1854057 988 COSMIC
COSN30541853 1018 COSMIC
COSN30541350 1042 COSMIC
COSN18764865 1199 COSMIC
COSN20728021 1357 COSMIC
COSN32064405 1557 COSMIC
COSN26482638 1597 COSMIC
COSN23708232 2461 COSMIC
COSN29790932 3026 COSMIC
COSN19396235 3244 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779412452 2 dbSNP
rs376752504 5 dbSNP
rs758490956 8 dbSNP
rs747020124 10 dbSNP
rs1481944411 14 dbSNP
rs1375527474 22 dbSNP
rs1309460044 23 dbSNP
rs770966548 26 dbSNP
rs780016557 31 dbSNP
rs1448561916 32 dbSNP
rs749210026 33 dbSNP
rs1402861226 34 dbSNP
rs768507672 36 dbSNP
rs1332654173 37 dbSNP
rs976266897 43 dbSNP
rs369935410 48 dbSNP
rs545179486 56 dbSNP
rs921605889 64 dbSNP
rs781376317 65 dbSNP
rs1178473915 71 dbSNP
rs1179435819 74 dbSNP
rs1441806556 75 dbSNP
rs1240999681 81 dbSNP
rs1378790135 84 dbSNP
rs1442934095 91 dbSNP
rs1280567956 92 dbSNP
rs1422063378 118 dbSNP
rs1352275562 120 dbSNP
rs746432377 137 dbSNP
rs1286149357 141 dbSNP
rs1241829932 143 dbSNP
rs1160414593 151 dbSNP
rs1380187382 161 dbSNP
rs1282773955 163 dbSNP
rs931675108 165 dbSNP
rs560300554 166 dbSNP
rs572137065 168 dbSNP
rs1418429547 173 dbSNP
rs1359932825 177 dbSNP
rs945957430 183 dbSNP
rs1421725687 184 dbSNP
rs1411984096 187 dbSNP
rs1181505995 188 dbSNP
rs186683201 191 dbSNP
rs1239012768 197 dbSNP
rs1190890056 201 dbSNP
rs1300530837 202 dbSNP
rs149200674 210 dbSNP
rs1452843120 211 dbSNP
rs531945281 212 dbSNP
rs1218235375 215 dbSNP
rs530536487 217 dbSNP
rs1003616061 224 dbSNP
rs1228546953 225 dbSNP
rs1357434048 235 dbSNP
rs143060676 236 dbSNP
rs776104586 248 dbSNP
rs1284932185 249 dbSNP
rs1340498123 260 dbSNP
rs895237261 262 dbSNP
rs1401854340 263 dbSNP
rs775360818 278 dbSNP
rs1348222676 279 dbSNP
rs1164290763 290 dbSNP
rs1406205338 294 dbSNP
rs1012170619 299 dbSNP
rs1168333457 303 dbSNP
rs565384104 307 dbSNP
rs552427212 310 dbSNP
rs1424327710 311 dbSNP
rs1195758526 323 dbSNP
rs191331336 324 dbSNP
rs952274897 333 dbSNP
rs114602496 342 dbSNP
rs565849242 348 dbSNP
rs866167089 354 dbSNP
rs536328141 358 dbSNP
rs1236763220 360 dbSNP
rs1015080014 370 dbSNP
rs1441874583 373 dbSNP
rs572219915 375 dbSNP
rs1425128749 380 dbSNP
rs975853945 387 dbSNP
rs921637682 398 dbSNP
rs1293060208 404 dbSNP
rs931727201 407 dbSNP
rs1431936419 429 dbSNP
rs12196 431 dbSNP
rs773339134 436 dbSNP
rs1407573078 448 dbSNP
rs914257134 448 dbSNP
rs1470026477 455 dbSNP
rs1172669897 464 dbSNP
rs564308500 468 dbSNP
rs1423815495 476 dbSNP
rs1431397593 476 dbSNP
rs945926765 477 dbSNP
rs1330213037 478 dbSNP
rs1478796762 478 dbSNP
rs1197644560 483 dbSNP
rs1457562407 484 dbSNP
rs774206929 486 dbSNP
rs1444164537 495 dbSNP
rs761368255 500 dbSNP
rs1279919561 504 dbSNP
rs537799806 505 dbSNP
rs1366894917 508 dbSNP
rs1300665995 509 dbSNP
rs1217348528 518 dbSNP
rs1219958146 520 dbSNP
rs1285276467 526 dbSNP
rs74334588 535 dbSNP
rs907025538 551 dbSNP
rs938476476 564 dbSNP
rs577821260 574 dbSNP
rs538852206 584 dbSNP
rs1464461897 603 dbSNP
rs185039984 604 dbSNP
rs56319203 605 dbSNP
rs1205740231 614 dbSNP
rs879428254 623 dbSNP
rs895193541 631 dbSNP
rs1012306453 633 dbSNP
rs1246436459 637 dbSNP
rs879169141 637 dbSNP
rs1027595637 640 dbSNP
rs887808170 650 dbSNP
rs189417275 681 dbSNP
rs1255849645 692 dbSNP
rs1015631529 697 dbSNP
rs966322161 701 dbSNP
rs1284010159 703 dbSNP
rs192990350 710 dbSNP
rs1377985857 711 dbSNP
rs1311159054 714 dbSNP
rs1169307620 721 dbSNP
rs1378193935 731 dbSNP
rs560761650 734 dbSNP
rs1450166406 736 dbSNP
rs1358042504 740 dbSNP
rs953083567 745 dbSNP
rs369730653 752 dbSNP
rs760478439 757 dbSNP
rs914225695 762 dbSNP
rs1329310901 765 dbSNP
rs185092301 766 dbSNP
rs1434251473 770 dbSNP
rs1304824192 772 dbSNP
rs1422371828 776 dbSNP
rs1346043075 783 dbSNP
rs977119347 787 dbSNP
rs928510984 794 dbSNP
rs1261090274 812 dbSNP
rs1216054019 816 dbSNP
rs1354675114 826 dbSNP
rs938626514 827 dbSNP
rs1276376789 840 dbSNP
rs1056013748 859 dbSNP
rs915768811 860 dbSNP
rs1215320406 863 dbSNP
rs1289658794 867 dbSNP
rs373605566 868 dbSNP
rs1225159415 874 dbSNP
rs1270285297 877 dbSNP
rs1400010347 889 dbSNP
rs1165369866 899 dbSNP
rs1488247929 906 dbSNP
rs879873474 911 dbSNP
rs1368223528 920 dbSNP
rs1165985766 937 dbSNP
rs1192375607 944 dbSNP
rs1422187787 948 dbSNP
rs1476463434 948 dbSNP
rs766308197 956 dbSNP
rs1239803626 959 dbSNP
rs1476191710 961 dbSNP
rs1168093406 965 dbSNP
rs1193577289 969 dbSNP
rs1488632054 970 dbSNP
rs548567594 972 dbSNP
rs1403443825 978 dbSNP
rs1049169003 983 dbSNP
rs189609046 985 dbSNP
rs763276666 985 dbSNP
rs15132 987 dbSNP
rs1005253200 1003 dbSNP
rs1399304604 1005 dbSNP
rs1036372649 1013 dbSNP
rs1219194719 1026 dbSNP
rs1328239462 1033 dbSNP
rs10186488 1034 dbSNP
rs8001 1039 dbSNP
rs1385854882 1041 dbSNP
rs1283876846 1042 dbSNP
rs532629743 1046 dbSNP
rs10186497 1052 dbSNP
rs1463279507 1061 dbSNP
rs828853 1063 dbSNP
rs1170546730 1068 dbSNP
rs1029555732 1070 dbSNP
rs1374847861 1088 dbSNP
rs953554077 1093 dbSNP
rs1353638997 1095 dbSNP
rs1215001188 1105 dbSNP
rs1268238005 1115 dbSNP
rs1215806004 1124 dbSNP
rs1281563274 1129 dbSNP
rs1257220267 1130 dbSNP
rs181143438 1135 dbSNP
rs1341445724 1140 dbSNP
rs1021422561 1144 dbSNP
rs1231971580 1145 dbSNP
rs185160885 1151 dbSNP
rs1331181803 1152 dbSNP
rs967129364 1156 dbSNP
rs768014061 1157 dbSNP
rs1375112087 1161 dbSNP
rs576945702 1162 dbSNP
rs1193245942 1164 dbSNP
rs1421133059 1168 dbSNP
rs928340229 1168 dbSNP
rs1171340890 1175 dbSNP
rs1465559642 1178 dbSNP
rs1195688563 1180 dbSNP
rs1378304115 1180 dbSNP
rs1438107589 1181 dbSNP
rs1199814554 1182 dbSNP
rs1296003224 1182 dbSNP
rs1302556100 1182 dbSNP
rs1345045216 1182 dbSNP
rs1236573481 1183 dbSNP
rs960212330 1187 dbSNP
rs1237482410 1199 dbSNP
rs1352610218 1199 dbSNP
rs76087452 1200 dbSNP
rs1185251823 1201 dbSNP
rs991451958 1201 dbSNP
rs1385566087 1202 dbSNP
rs1395992554 1203 dbSNP
rs1376111289 1206 dbSNP
rs1175656499 1207 dbSNP
rs1418083468 1210 dbSNP
rs1419059465 1215 dbSNP
rs547962323 1219 dbSNP
rs1471005239 1220 dbSNP
rs1235542507 1221 dbSNP
rs188291622 1224 dbSNP
rs1258994897 1226 dbSNP
rs1401400933 1233 dbSNP
rs1286217346 1239 dbSNP
rs1333589784 1244 dbSNP
rs1338986378 1258 dbSNP
rs1282832422 1259 dbSNP
rs756489128 1262 dbSNP
rs915737419 1292 dbSNP
rs1316175107 1298 dbSNP
rs114462874 1303 dbSNP
rs1048216852 1311 dbSNP
rs1263065900 1313 dbSNP
rs570007340 1323 dbSNP
rs1351985779 1338 dbSNP
rs940798130 1345 dbSNP
rs1205272739 1350 dbSNP
rs901865439 1356 dbSNP
rs1191436790 1357 dbSNP
rs537463778 1359 dbSNP
rs1339235683 1363 dbSNP
rs115100660 1366 dbSNP
rs1459708812 1367 dbSNP
rs1217459244 1369 dbSNP
rs1335910799 1369 dbSNP
rs373325463 1369 dbSNP
rs889283419 1369 dbSNP
rs1295584824 1371 dbSNP
rs1011720276 1377 dbSNP
rs1217356945 1377 dbSNP
rs1021817313 1385 dbSNP
rs1245632410 1387 dbSNP
rs757394603 1390 dbSNP
rs1438911320 1392 dbSNP
rs1179360158 1393 dbSNP
rs1365533120 1404 dbSNP
rs538913200 1406 dbSNP
rs1323151500 1413 dbSNP
rs1461718574 1414 dbSNP
rs1396442299 1425 dbSNP
rs180812549 1430 dbSNP
rs763693113 1434 dbSNP
rs1035751390 1436 dbSNP
rs572259927 1437 dbSNP
rs959767706 1441 dbSNP
rs991813650 1449 dbSNP
rs1022799233 1459 dbSNP
rs1193888195 1460 dbSNP
rs781430572 1461 dbSNP
rs1287178064 1462 dbSNP
rs1337580309 1463 dbSNP
rs1399806722 1470 dbSNP
rs952638218 1471 dbSNP
rs1273803620 1472 dbSNP
rs1216340336 1479 dbSNP
rs983889277 1491 dbSNP
rs1274435470 1493 dbSNP
rs908401419 1495 dbSNP
rs186445949 1497 dbSNP
rs1390066730 1511 dbSNP
rs190711549 1512 dbSNP
rs1336928713 1516 dbSNP
rs1465024210 1523 dbSNP
rs972200531 1524 dbSNP
rs1172451645 1528 dbSNP
rs750787486 1533 dbSNP
rs1412207596 1534 dbSNP
rs148225667 1542 dbSNP
rs543418771 1549 dbSNP
rs539126364 1555 dbSNP
rs1255272895 1559 dbSNP
rs183483844 1566 dbSNP
rs868708580 1567 dbSNP
rs1480515622 1568 dbSNP
rs933374383 1571 dbSNP
rs1207271006 1577 dbSNP
rs1224798690 1587 dbSNP
rs1310478122 1587 dbSNP
rs1235273190 1592 dbSNP
rs1256317009 1603 dbSNP
rs1306799654 1609 dbSNP
rs1263419758 1617 dbSNP
rs1457039828 1619 dbSNP
rs1193920604 1620 dbSNP
rs865928339 1629 dbSNP
rs1445771021 1637 dbSNP
rs889344132 1641 dbSNP
rs141126837 1643 dbSNP
rs1427314772 1647 dbSNP
rs1378031306 1650 dbSNP
rs570328452 1652 dbSNP
rs1418819466 1654 dbSNP
rs1409214136 1658 dbSNP
rs1179431957 1666 dbSNP
rs1482591951 1670 dbSNP
rs374153994 1671 dbSNP
rs1211770520 1672 dbSNP
rs1486697079 1674 dbSNP
rs186846816 1679 dbSNP
rs10199560 1683 dbSNP
rs895559033 1695 dbSNP
rs542018193 1697 dbSNP
rs1308926283 1708 dbSNP
rs1226511193 1709 dbSNP
rs1378434280 1724 dbSNP
rs865993673 1729 dbSNP
rs1012502327 1736 dbSNP
rs867873502 1739 dbSNP
rs1416032385 1744 dbSNP
rs1358102877 1748 dbSNP
rs1297162282 1752 dbSNP
rs1397571797 1753 dbSNP
rs147355100 1756 dbSNP
rs1364719252 1761 dbSNP
rs1161809432 1770 dbSNP
rs1301894772 1774 dbSNP
rs1022598622 1775 dbSNP
rs1189281808 1787 dbSNP
rs952607626 1788 dbSNP
rs1347908508 1803 dbSNP
rs1261164257 1805 dbSNP
rs1204741762 1806 dbSNP
rs984026534 1814 dbSNP
rs1283354208 1823 dbSNP
rs1262255703 1827 dbSNP
rs1219030248 1842 dbSNP
rs1333907149 1845 dbSNP
rs1316938493 1846 dbSNP
rs778535657 1851 dbSNP
rs530880662 1856 dbSNP
rs1252887845 1868 dbSNP
rs1382427496 1869 dbSNP
rs1386772441 1869 dbSNP
rs549377175 1870 dbSNP
rs1456656710 1879 dbSNP
rs1208995814 1881 dbSNP
rs1166228396 1884 dbSNP
rs972554827 1896 dbSNP
rs1192634619 1898 dbSNP
rs552569797 1908 dbSNP
rs191278254 1910 dbSNP
rs933416462 1917 dbSNP
rs1189718694 1921 dbSNP
rs771653833 1942 dbSNP
rs137948393 1944 dbSNP
rs183372557 1948 dbSNP
rs1194234146 1950 dbSNP
rs947607676 1953 dbSNP
rs1227436159 1962 dbSNP
rs1327693283 1971 dbSNP
rs1043363894 1973 dbSNP
rs1439742092 1974 dbSNP
rs376240080 1988 dbSNP
rs374758710 1999 dbSNP
rs1463462050 2009 dbSNP
rs1457758761 2011 dbSNP
rs1162056068 2034 dbSNP
rs1368072890 2038 dbSNP
rs1406029408 2040 dbSNP
rs1167858967 2044 dbSNP
rs1303236098 2044 dbSNP
rs1374894577 2054 dbSNP
rs760399538 2059 dbSNP
rs565933851 2060 dbSNP
rs57421736 2066 dbSNP
rs1297336248 2068 dbSNP
rs36085572 2071 dbSNP
rs1195343892 2077 dbSNP
rs1326619155 2077 dbSNP
rs1456282780 2078 dbSNP
rs1249658485 2080 dbSNP
rs1196328597 2100 dbSNP
rs1051836 2101 dbSNP
rs1012637645 2104 dbSNP
rs1044021294 2113 dbSNP
rs1348221780 2113 dbSNP
rs1361516443 2116 dbSNP
rs1304617225 2117 dbSNP
rs1443493079 2132 dbSNP
rs1334377245 2143 dbSNP
rs1223042378 2147 dbSNP
rs1285435223 2150 dbSNP
rs1392521600 2171 dbSNP
rs191575428 2174 dbSNP
rs759435381 2177 dbSNP
rs1311204185 2178 dbSNP
rs1005415626 2184 dbSNP
rs1395851880 2200 dbSNP
rs1015547995 2207 dbSNP
rs1188329054 2212 dbSNP
rs961591464 2228 dbSNP
rs1182393334 2236 dbSNP
rs1423452863 2237 dbSNP
rs1253446128 2238 dbSNP
rs997993260 2239 dbSNP
rs1051837 2242 dbSNP
rs147227181 2246 dbSNP
rs576430745 2251 dbSNP
rs1348946090 2256 dbSNP
rs182278079 2267 dbSNP
rs1451043892 2283 dbSNP
rs968746017 2286 dbSNP
rs1311600311 2297 dbSNP
rs1414188149 2298 dbSNP
rs1376164172 2307 dbSNP
rs1314953515 2313 dbSNP
rs553262416 2335 dbSNP
rs924855348 2338 dbSNP
rs934920057 2341 dbSNP
rs1260156815 2344 dbSNP
rs1366575554 2354 dbSNP
rs35159777 2355 dbSNP
rs1057275313 2356 dbSNP
rs917429458 2362 dbSNP
rs781597594 2365 dbSNP
rs948459501 2367 dbSNP
rs1446130920 2374 dbSNP
rs1384670400 2378 dbSNP
rs1246645476 2382 dbSNP
rs1284007112 2383 dbSNP
rs1044156227 2388 dbSNP
rs761917351 2389 dbSNP
rs187906394 2393 dbSNP
rs558079871 2400 dbSNP
rs1356131115 2404 dbSNP
rs1295250484 2428 dbSNP
rs1326137568 2428 dbSNP
rs1319231220 2430 dbSNP
rs1402170327 2432 dbSNP
rs1261329482 2434 dbSNP
rs1164093253 2443 dbSNP
rs1461940521 2450 dbSNP
rs1483050896 2456 dbSNP
rs1201967044 2462 dbSNP
rs1245381585 2467 dbSNP
rs1037110847 2470 dbSNP
rs1184330546 2475 dbSNP
rs897048974 2488 dbSNP
rs1466041426 2492 dbSNP
rs1242282903 2494 dbSNP
rs1194910828 2504 dbSNP
rs1271704605 2507 dbSNP
rs998535677 2510 dbSNP
rs1336180890 2515 dbSNP
rs1275120483 2520 dbSNP
rs1029486687 2544 dbSNP
rs542432886 2545 dbSNP
rs1433206890 2546 dbSNP
rs1304096572 2559 dbSNP
rs1406510795 2561 dbSNP
rs768541404 2564 dbSNP
rs1325042737 2566 dbSNP
rs1441542987 2580 dbSNP
rs750603559 2581 dbSNP
rs1396516939 2583 dbSNP
rs563708751 2586 dbSNP
rs1160670148 2603 dbSNP
rs1408814551 2607 dbSNP
rs1345193775 2608 dbSNP
rs1169253039 2609 dbSNP
rs60438577 2615 dbSNP
rs545972165 2617 dbSNP
rs1017662165 2635 dbSNP
rs1453192742 2636 dbSNP
rs193213325 2637 dbSNP
rs968798476 2644 dbSNP
rs1225329272 2662 dbSNP
rs1306963715 2666 dbSNP
rs978757805 2684 dbSNP
rs924623634 2686 dbSNP
rs576349959 2694 dbSNP
rs185227951 2698 dbSNP
rs1346074315 2704 dbSNP
rs1302961100 2707 dbSNP
rs1234684515 2717 dbSNP
rs1372943683 2718 dbSNP
rs956296898 2738 dbSNP
rs1441436223 2742 dbSNP
rs370833915 2747 dbSNP
rs1307837416 2776 dbSNP
rs1330370868 2778 dbSNP
rs1322853688 2786 dbSNP
rs1432470582 2795 dbSNP
rs546972980 2796 dbSNP
rs1394030819 2797 dbSNP
rs559457989 2797 dbSNP
rs1265273498 2800 dbSNP
rs1454941077 2806 dbSNP
rs1427732038 2808 dbSNP
rs1461936634 2814 dbSNP
rs1480625333 2821 dbSNP
rs565994280 2824 dbSNP
rs948927335 2834 dbSNP
rs564050452 2843 dbSNP
rs756607907 2844 dbSNP
rs1304658863 2848 dbSNP
rs1223127917 2849 dbSNP
rs941124737 2853 dbSNP
rs1036683462 2857 dbSNP
rs74932250 2861 dbSNP
rs1374343552 2865 dbSNP
rs1452547230 2866 dbSNP
rs1313065191 2869 dbSNP
rs780563315 2873 dbSNP
rs1436255505 2883 dbSNP
rs1361249047 2891 dbSNP
rs1173632091 2895 dbSNP
rs1157463253 2900 dbSNP
rs1418868319 2908 dbSNP
rs754438708 2911 dbSNP
rs569743618 2917 dbSNP
rs1431051336 2920 dbSNP
rs1469949199 2924 dbSNP
rs56067994 2933 dbSNP
rs139562763 2939 dbSNP
rs889710837 2950 dbSNP
rs1484392236 2961 dbSNP
rs1298728999 2967 dbSNP
rs1214723364 2969 dbSNP
rs1006694377 2970 dbSNP
rs1269887229 2988 dbSNP
rs1022151973 3000 dbSNP
rs1293437740 3001 dbSNP
rs1416241293 3004 dbSNP
rs770828122 3006 dbSNP
rs1287940550 3018 dbSNP
rs771351220 3018 dbSNP
rs1324551600 3026 dbSNP
rs1000710856 3027 dbSNP
rs574152380 3031 dbSNP
rs956269662 3033 dbSNP
rs993090392 3034 dbSNP
rs200547223 3043 dbSNP
rs1425635254 3045 dbSNP
rs1259841526 3051 dbSNP
rs1186168025 3053 dbSNP
rs1486049175 3054 dbSNP
rs534332940 3055 dbSNP
rs702462 3063 dbSNP
rs371516812 3069 dbSNP
rs1268888633 3088 dbSNP
rs777346749 3090 dbSNP
rs372139224 3096 dbSNP
rs941107932 3098 dbSNP
rs1294360980 3106 dbSNP
rs972930527 3109 dbSNP
rs1363071327 3116 dbSNP
rs1323033345 3139 dbSNP
rs1439331267 3156 dbSNP
rs559673316 3157 dbSNP
rs1478170127 3162 dbSNP
rs1459463225 3167 dbSNP
rs933612578 3168 dbSNP
rs1050791746 3169 dbSNP
rs770750261 3176 dbSNP
rs1429388729 3177 dbSNP
rs889679690 3178 dbSNP
rs1191442410 3179 dbSNP
rs1467881286 3181 dbSNP
rs942613377 3182 dbSNP
rs1416924175 3190 dbSNP
rs1211599732 3194 dbSNP
rs1479356734 3200 dbSNP
rs1227681732 3203 dbSNP
rs1250323943 3203 dbSNP
rs1343938235 3215 dbSNP
rs1043559813 3216 dbSNP
rs776384986 3222 dbSNP
rs1212582935 3224 dbSNP
rs1254327881 3233 dbSNP
rs1232472529 3236 dbSNP
rs767960955 3240 dbSNP
rs903716247 3242 dbSNP
rs1170872677 3248 dbSNP
rs1394396542 3249 dbSNP
rs1000277372 3258 dbSNP
rs745609691 3284 dbSNP
rs1392195466 3286 dbSNP
rs1422606823 3289 dbSNP
rs11888707 3292 dbSNP
rs891879562 3300 dbSNP
rs190125575 3301 dbSNP
rs1430300719 3302 dbSNP
rs1200893371 3309 dbSNP
rs1417310005 3316 dbSNP
rs1249200974 3318 dbSNP
rs192874393 3323 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10797.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10797.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000394053.2 | 3UTR | CUUUUGCUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
249 hsa-miR-548g-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057504 CEP55 centrosomal protein 55 2 4
MIRT060829 CEP350 centrosomal protein 350 2 4
MIRT062719 MLEC malectin 2 4
MIRT064766 CCND2 cyclin D2 2 8
MIRT075336 SF3B3 splicing factor 3b subunit 3 2 2
MIRT080205 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080236 SMAD4 SMAD family member 4 2 6
MIRT087395 AGFG1 ArfGAP with FG repeats 1 2 4
MIRT088228 GRAMD4 GRAM domain containing 4 2 2
MIRT089490 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT091222 USP13 ubiquitin specific peptidase 13 2 2
MIRT092959 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT094091 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 4
MIRT097469 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT102252 HBP1 HMG-box transcription factor 1 2 4
MIRT105440 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT107286 FAM73B mitoguardin 2 2 2
MIRT113584 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT113886 KPNA6 karyopherin subunit alpha 6 2 6
MIRT126457 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT135023 ADSS adenylosuccinate synthase 2 6
MIRT139889 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT149702 LDLR low density lipoprotein receptor 2 2
MIRT163230 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT165198 GRAMD3 GRAM domain containing 2B 2 2
MIRT172169 FZD6 frizzled class receptor 6 2 8
MIRT177396 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT179427 TBRG1 transforming growth factor beta regulator 1 2 6
MIRT195617 FAM195A MAPK regulated corepressor interacting protein 2 2 6
MIRT208727 MED12L mediator complex subunit 12 like 2 6
MIRT211508 ELMOD2 ELMO domain containing 2 2 2
MIRT213434 MOB1B MOB kinase activator 1B 2 6
MIRT240121 NDRG1 N-myc downstream regulated 1 2 2
MIRT243102 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT247387 HCFC2 host cell factor C2 2 4
MIRT248057 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT249457 ZNF691 zinc finger protein 691 2 4
MIRT253421 EVI5L ecotropic viral integration site 5 like 2 2
MIRT254148 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT258906 LAPTM4B lysosomal protein transmembrane 4 beta 2 4
MIRT259391 SLC6A8 solute carrier family 6 member 8 2 4
MIRT266966 LRRC55 leucine rich repeat containing 55 2 4
MIRT279001 GMFB glia maturation factor beta 2 10
MIRT288802 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT325678 ZNF367 zinc finger protein 367 2 2
MIRT330543 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT334269 RCC2 regulator of chromosome condensation 2 2 2
MIRT350225 PRNP prion protein 2 2
MIRT400510 SKIL SKI like proto-oncogene 2 10
MIRT405635 WBP4 WW domain binding protein 4 2 4
MIRT408651 QKI QKI, KH domain containing RNA binding 2 2
MIRT444161 ZNF701 zinc finger protein 701 2 2
MIRT444509 ZNF525 zinc finger protein 525 2 2
MIRT445209 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT446844 FOXP1 forkhead box P1 2 2
MIRT449026 ADRB1 adrenoceptor beta 1 2 2
MIRT450746 POLI DNA polymerase iota 2 4
MIRT450793 OTUD7A OTU deubiquitinase 7A 2 2
MIRT454916 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455266 DDX39B DExD-box helicase 39B 2 10
MIRT455715 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT456098 MB21D1 Mab-21 domain containing 1 2 6
MIRT463635 YY1 YY1 transcription factor 2 8
MIRT463891 WNT7B Wnt family member 7B 2 2
MIRT466262 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT466820 STX6 syntaxin 6 2 6
MIRT466879 STX16 syntaxin 16 2 2
MIRT467524 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT468199 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT468633 SELT selenoprotein T 2 2
MIRT470367 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470998 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471559 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472277 NFIB nuclear factor I B 2 4
MIRT472758 MTMR6 myotubularin related protein 6 2 8
MIRT474719 KIF13A kinesin family member 13A 2 6
MIRT475869 H3F3C H3 histone family member 3C 2 10
MIRT475903 H3F3B H3 histone family member 3B 2 8
MIRT477350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477486 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478096 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479805 CCNA2 cyclin A2 2 6
MIRT480813 BLCAP bladder cancer associated protein 2 10
MIRT481947 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483060 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484143 LRRC45 leucine rich repeat containing 45 2 4
MIRT484904 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485080 SOX4 SRY-box 4 2 10
MIRT485639 DICER1 dicer 1, ribonuclease III 2 4
MIRT485798 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT486271 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT486740 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT487167 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT491642 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491934 WDR45B WD repeat domain 45B 2 8
MIRT492232 SLC48A1 solute carrier family 48 member 1 2 2
MIRT493089 MMGT1 membrane magnesium transporter 1 2 12
MIRT494479 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT494986 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 2
MIRT495671 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT498467 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT499268 NBPF11 NBPF member 11 2 2
MIRT499855 SVOP SV2 related protein 2 12
MIRT500307 ZNF622 zinc finger protein 622 2 8
MIRT500640 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501222 SEMA4C semaphorin 4C 2 6
MIRT501526 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 8
MIRT501569 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502430 G3BP2 G3BP stress granule assembly factor 2 2 10
MIRT502967 CCNL1 cyclin L1 2 8
MIRT503470 ZNF154 zinc finger protein 154 2 6
MIRT504572 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 4
MIRT504956 ZNRF2 zinc and ring finger 2 2 6
MIRT505206 UBN2 ubinuclein 2 2 8
MIRT505238 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT507570 DEK DEK proto-oncogene 2 2
MIRT509412 MCM7 minichromosome maintenance complex component 7 2 6
MIRT510715 SPG20 spartin 2 6
MIRT510859 RAN RAN, member RAS oncogene family 2 8
MIRT510914 PSMA2 proteasome subunit alpha 2 2 4
MIRT510944 PPTC7 PTC7 protein phosphatase homolog 2 8
MIRT511072 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511213 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511959 ELOVL5 ELOVL fatty acid elongase 5 2 6
MIRT512123 CREBL2 cAMP responsive element binding protein like 2 2 8
MIRT513686 RNF111 ring finger protein 111 2 2
MIRT513896 GRB10 growth factor receptor bound protein 10 2 6
MIRT516305 F8A2 coagulation factor VIII associated 2 2 2
MIRT516331 F8A3 coagulation factor VIII associated 3 2 2
MIRT517521 ITM2C integral membrane protein 2C 2 6
MIRT517930 IMPA1 inositol monophosphatase 1 2 2
MIRT521368 RNF11 ring finger protein 11 2 6
MIRT525192 ZNF93 zinc finger protein 93 2 2
MIRT527216 CCNL2 cyclin L2 2 2
MIRT527835 NUPL1 nucleoporin 58 2 2
MIRT529433 MALT1 MALT1 paracaspase 2 2
MIRT530166 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT530515 C4orf32 family with sequence similarity 241 member A 2 4
MIRT532372 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT533855 TEAD1 TEA domain transcription factor 1 2 2
MIRT534750 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT534795 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT538602 CDK19 cyclin dependent kinase 19 2 2
MIRT539247 ANKRD50 ankyrin repeat domain 50 2 2
MIRT539467 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT543100 TNFRSF11A TNF receptor superfamily member 11a 2 2
MIRT543897 ESYT1 extended synaptotagmin 1 2 2
MIRT544980 MFF mitochondrial fission factor 2 4
MIRT545794 ZNF772 zinc finger protein 772 2 4
MIRT546009 WDR26 WD repeat domain 26 2 4
MIRT546378 STOX2 storkhead box 2 2 4
MIRT546681 RORA RAR related orphan receptor A 2 4
MIRT546947 SFTPA1 surfactant protein A1 2 2
MIRT547034 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547397 MKX mohawk homeobox 2 2
MIRT547470 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547501 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT548077 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548500 E2F8 E2F transcription factor 8 2 2
MIRT548883 CHEK2 checkpoint kinase 2 2 4
MIRT549063 CALM1 calmodulin 1 2 2
MIRT549166 BMP3 bone morphogenetic protein 3 2 2
MIRT549310 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549345 ARC activity regulated cytoskeleton associated protein 2 2
MIRT549475 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549678 ZNF598 zinc finger protein 598 2 2
MIRT550209 MAVS mitochondrial antiviral signaling protein 2 4
MIRT550356 INCENP inner centromere protein 2 4
MIRT550531 MYZAP myocardial zonula adherens protein 2 2
MIRT551156 ZNF678 zinc finger protein 678 2 2
MIRT552311 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552880 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553383 TRIM33 tripartite motif containing 33 2 2
MIRT554453 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT554868 RCAN2 regulator of calcineurin 2 2 2
MIRT556022 MYBL1 MYB proto-oncogene like 1 2 2
MIRT556175 MCC mutated in colorectal cancers 2 2
MIRT556238 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT556878 ITGA2 integrin subunit alpha 2 2 2
MIRT557575 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557690 GATA6 GATA binding protein 6 2 2
MIRT557906 FBXO8 F-box protein 8 2 2
MIRT558132 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT558481 DBN1 drebrin 1 2 2
MIRT558744 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT558760 CFL2 cofilin 2 2 2
MIRT559122 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT559406 GDNF glial cell derived neurotrophic factor 2 4
MIRT559476 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559677 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT560049 ZNF680 zinc finger protein 680 2 2
MIRT560643 ZNF107 zinc finger protein 107 2 2
MIRT562581 CBX3 chromobox 3 2 2
MIRT564188 CLVS2 clavesin 2 2 2
MIRT564530 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT564540 CCDC80 coiled-coil domain containing 80 2 2
MIRT565290 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565315 TMEM41A transmembrane protein 41A 2 2
MIRT565950 RRAGD Ras related GTP binding D 2 2
MIRT566633 NFYA nuclear transcription factor Y subunit alpha 2 4
MIRT566818 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT567529 FGFR1OP FGFR1 oncogene partner 2 2
MIRT568631 ACVR2A activin A receptor type 2A 2 2
MIRT572141 DESI1 desumoylating isopeptidase 1 2 2
MIRT616029 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT620048 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT620531 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621878 TAOK3 TAO kinase 3 2 2
MIRT623242 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623994 FAM104A family with sequence similarity 104 member A 2 2
MIRT624301 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT626283 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT627771 RAB30 RAB30, member RAS oncogene family 2 2
MIRT641139 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT644587 SPOP speckle type BTB/POZ protein 2 2
MIRT644820 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT645971 NHLRC2 NHL repeat containing 2 2 2
MIRT646171 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646496 ZNF429 zinc finger protein 429 2 2
MIRT647834 RAB23 RAB23, member RAS oncogene family 2 2
MIRT648463 CCDC127 coiled-coil domain containing 127 2 2
MIRT657281 HRK harakiri, BCL2 interacting protein 2 2
MIRT658644 ENAH ENAH, actin regulator 2 2
MIRT658677 EMP2 epithelial membrane protein 2 2 2
MIRT665229 ZZZ3 zinc finger ZZ-type containing 3 2 2
MIRT669277 C19orf44 chromosome 19 open reading frame 44 2 2
MIRT676048 AUTS8 Autism, susceptibility to, 8 2 2
MIRT681484 DIP2A disco interacting protein 2 homolog A 2 2
MIRT681555 UBXN2A UBX domain protein 2A 2 2
MIRT683143 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT688535 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT689429 CYB561 cytochrome b561 2 2
MIRT689535 KIAA0513 KIAA0513 2 2
MIRT689895 SOD2 superoxide dismutase 2 2 2
MIRT695990 SNX19 sorting nexin 19 2 2
MIRT697781 UBXN7 UBX domain protein 7 2 2
MIRT702915 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703145 GPR137C G protein-coupled receptor 137C 2 2
MIRT703525 FKBP15 FK506 binding protein 15 2 2
MIRT704537 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704998 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT705722 AMMECR1L AMMECR1 like 2 2
MIRT707121 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT707452 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707776 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT707889 SLC30A7 solute carrier family 30 member 7 2 2
MIRT720532 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT723860 CD209 CD209 molecule 2 2
MIRT725350 MUC21 mucin 21, cell surface associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548g Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-548g Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission