miRTarBase - #MIRT089509


—
pre-miRNA Information
pre-miRNA hsa-mir-548aq   
Genomic Coordinates chr3: 185767847 - 185767904
Description Homo sapiens miR-548aq stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548aq-5p
Sequence 1| GAAAGUAAUUGCUGUUUUUGCC |22
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 3 - 185767898 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs148741643 4 dbSNP
rs373424261 5 dbSNP
rs954388082 9 dbSNP
rs1008952958 10 dbSNP
rs1443286362 15 dbSNP
rs778852684 17 dbSNP
rs1042518237 21 dbSNP
rs1299293460 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTHFD2   
Synonyms NMDMC
Description methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
Transcript NM_006636   
Expression
Putative miRNA Targets on MTHFD2
3'UTR of MTHFD2
(miRNA target sites are highlighted)		 
>MTHFD2|NM_006636|3'UTR
   1 CTACTGTGTCTTCTGTGTCACAAACAGCACTCCAGGCCAGCTCAAGAAGCAAAGCAGGCCAATAGAAATGCAATATTTTT
  81 AATTTATTCTACTGAAATGGTTTAAAATGATGCCTTGTATTTATTGAAAGCTTAAATGGGTGGGTGTTTCTGCACATACC
 161 TCTGCAGTACCTCACCAGGGAGCATTCCAGTATCATGCAGGGTCCTGTGATCTAGCCAGGAGCAGCCATTAACCTAGTGA
 241 TTAATATGGGAGACATTACCATATGGAGGATGGATGCTTCACTTTGTCAAGCACCTCAGTTACACATTCGCCTTTTCTAG
 321 GATTGCATTTCCCAAGTGCTATTGCAATAACAGTTGATACTCATTTTAGGTACCAAACCTTTTGAGTTCAACTGATCAAA
 401 CCAAAGGAAAAGTGTTGCTAGAGAAAATTAGGGAAAAGGTGAAAAAGAAAAAATGGTAGTAATTGAGCAGAAAAAAATTA
 481 ATTTATATATGTATTGATTGGCAACCAGATTTATCTAAGTAGAACTGAATTGGCTAGGAAAAAAGAAAAACTGCATGTTA
 561 ATCATTTTCCTAAGCTGTCCTTTTGAGGCTTAGTCAGTTTATTGGGAAAATGTTTAGGATTATTCCTTGCTATTAGTACT
 641 CATTTTATGTATGTTACCCTTCAGTAAGTTCTCCCCATTTTAGTTTTCTAGGACTGAAAGGATTCTTTTCTACATTATAC
 721 ATGTGTGTTGTCATATTTGGCTTTTGCTATATACTTTAACTTCATTGTTAAATTTTTGTATTGTATAGTTTCTTTGGTGT
 801 ATCTTAAAACCTATTTTTGAAAAACAAACTTGGCTTGATAATCATTTGGGCAGCTTGGGTAAGTACGCAACTTACTTTTC
 881 CACCAAAGAACTGTCAGCAGCTGCCTGCTTTTCTGTGATGTATGTATCCTGTTGACTTTTCCAGAAATTTTTTAAGAGTT
 961 TGAGTTACTATTGAATTTAATCAGACTTTCTGATTAAAGGGTTTTCTTTCTTTTTTAATAAAACACATCTGTCTGGTATG
1041 GTATGAATTTCTGAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccGUUUUUGUCGUU-AAUGAAAg 5'
            :||: || |||| ||||||| 
Target 5' ggTAAGTAC-GCAACTTACTTTt 3'
 858 - 879 163.00 -14.60
2 
miRNA  3' ccGUUUUUGUCGUUAAUGAAAg 5'
            ||:||| |  ||||| ||| 
Target 5' agCAGAAAAA--AATTAATTTa 3'
 466 - 485 136.00 -6.50
3 
miRNA  3' ccGUUUUUGUCGUU-----AAUGAAAg 5'
            :|:|||: ||||     ||| ||| 
Target 5' aaTAGAAAT-GCAATATTTTTAATTTa 3'
 61 - 86 127.00 -8.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31579901 29 COSMIC
COSN30476290 30 COSMIC
COSN30113132 66 COSMIC
COSN1242451 176 COSMIC
COSN16322991 344 COSMIC
COSN26647312 375 COSMIC
COSN26633224 448 COSMIC
COSN30545054 469 COSMIC
COSN17386612 479 COSMIC
COSN9386592 654 COSMIC
COSN29240187 720 COSMIC
COSN31579217 894 COSMIC
COSN1854057 988 COSMIC
COSN30541853 1018 COSMIC
COSN30541350 1042 COSMIC
COSN18764865 1199 COSMIC
COSN20728021 1357 COSMIC
COSN32064405 1557 COSMIC
COSN26482638 1597 COSMIC
COSN23708232 2461 COSMIC
COSN29790932 3026 COSMIC
COSN19396235 3244 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779412452 2 dbSNP
rs376752504 5 dbSNP
rs758490956 8 dbSNP
rs747020124 10 dbSNP
rs1481944411 14 dbSNP
rs1375527474 22 dbSNP
rs1309460044 23 dbSNP
rs770966548 26 dbSNP
rs780016557 31 dbSNP
rs1448561916 32 dbSNP
rs749210026 33 dbSNP
rs1402861226 34 dbSNP
rs768507672 36 dbSNP
rs1332654173 37 dbSNP
rs976266897 43 dbSNP
rs369935410 48 dbSNP
rs545179486 56 dbSNP
rs921605889 64 dbSNP
rs781376317 65 dbSNP
rs1178473915 71 dbSNP
rs1179435819 74 dbSNP
rs1441806556 75 dbSNP
rs1240999681 81 dbSNP
rs1378790135 84 dbSNP
rs1442934095 91 dbSNP
rs1280567956 92 dbSNP
rs1422063378 118 dbSNP
rs1352275562 120 dbSNP
rs746432377 137 dbSNP
rs1286149357 141 dbSNP
rs1241829932 143 dbSNP
rs1160414593 151 dbSNP
rs1380187382 161 dbSNP
rs1282773955 163 dbSNP
rs931675108 165 dbSNP
rs560300554 166 dbSNP
rs572137065 168 dbSNP
rs1418429547 173 dbSNP
rs1359932825 177 dbSNP
rs945957430 183 dbSNP
rs1421725687 184 dbSNP
rs1411984096 187 dbSNP
rs1181505995 188 dbSNP
rs186683201 191 dbSNP
rs1239012768 197 dbSNP
rs1190890056 201 dbSNP
rs1300530837 202 dbSNP
rs149200674 210 dbSNP
rs1452843120 211 dbSNP
rs531945281 212 dbSNP
rs1218235375 215 dbSNP
rs530536487 217 dbSNP
rs1003616061 224 dbSNP
rs1228546953 225 dbSNP
rs1357434048 235 dbSNP
rs143060676 236 dbSNP
rs776104586 248 dbSNP
rs1284932185 249 dbSNP
rs1340498123 260 dbSNP
rs895237261 262 dbSNP
rs1401854340 263 dbSNP
rs775360818 278 dbSNP
rs1348222676 279 dbSNP
rs1164290763 290 dbSNP
rs1406205338 294 dbSNP
rs1012170619 299 dbSNP
rs1168333457 303 dbSNP
rs565384104 307 dbSNP
rs552427212 310 dbSNP
rs1424327710 311 dbSNP
rs1195758526 323 dbSNP
rs191331336 324 dbSNP
rs952274897 333 dbSNP
rs114602496 342 dbSNP
rs565849242 348 dbSNP
rs866167089 354 dbSNP
rs536328141 358 dbSNP
rs1236763220 360 dbSNP
rs1015080014 370 dbSNP
rs1441874583 373 dbSNP
rs572219915 375 dbSNP
rs1425128749 380 dbSNP
rs975853945 387 dbSNP
rs921637682 398 dbSNP
rs1293060208 404 dbSNP
rs931727201 407 dbSNP
rs1431936419 429 dbSNP
rs12196 431 dbSNP
rs773339134 436 dbSNP
rs1407573078 448 dbSNP
rs914257134 448 dbSNP
rs1470026477 455 dbSNP
rs1172669897 464 dbSNP
rs564308500 468 dbSNP
rs1423815495 476 dbSNP
rs1431397593 476 dbSNP
rs945926765 477 dbSNP
rs1330213037 478 dbSNP
rs1478796762 478 dbSNP
rs1197644560 483 dbSNP
rs1457562407 484 dbSNP
rs774206929 486 dbSNP
rs1444164537 495 dbSNP
rs761368255 500 dbSNP
rs1279919561 504 dbSNP
rs537799806 505 dbSNP
rs1366894917 508 dbSNP
rs1300665995 509 dbSNP
rs1217348528 518 dbSNP
rs1219958146 520 dbSNP
rs1285276467 526 dbSNP
rs74334588 535 dbSNP
rs907025538 551 dbSNP
rs938476476 564 dbSNP
rs577821260 574 dbSNP
rs538852206 584 dbSNP
rs1464461897 603 dbSNP
rs185039984 604 dbSNP
rs56319203 605 dbSNP
rs1205740231 614 dbSNP
rs879428254 623 dbSNP
rs895193541 631 dbSNP
rs1012306453 633 dbSNP
rs1246436459 637 dbSNP
rs879169141 637 dbSNP
rs1027595637 640 dbSNP
rs887808170 650 dbSNP
rs189417275 681 dbSNP
rs1255849645 692 dbSNP
rs1015631529 697 dbSNP
rs966322161 701 dbSNP
rs1284010159 703 dbSNP
rs192990350 710 dbSNP
rs1377985857 711 dbSNP
rs1311159054 714 dbSNP
rs1169307620 721 dbSNP
rs1378193935 731 dbSNP
rs560761650 734 dbSNP
rs1450166406 736 dbSNP
rs1358042504 740 dbSNP
rs953083567 745 dbSNP
rs369730653 752 dbSNP
rs760478439 757 dbSNP
rs914225695 762 dbSNP
rs1329310901 765 dbSNP
rs185092301 766 dbSNP
rs1434251473 770 dbSNP
rs1304824192 772 dbSNP
rs1422371828 776 dbSNP
rs1346043075 783 dbSNP
rs977119347 787 dbSNP
rs928510984 794 dbSNP
rs1261090274 812 dbSNP
rs1216054019 816 dbSNP
rs1354675114 826 dbSNP
rs938626514 827 dbSNP
rs1276376789 840 dbSNP
rs1056013748 859 dbSNP
rs915768811 860 dbSNP
rs1215320406 863 dbSNP
rs1289658794 867 dbSNP
rs373605566 868 dbSNP
rs1225159415 874 dbSNP
rs1270285297 877 dbSNP
rs1400010347 889 dbSNP
rs1165369866 899 dbSNP
rs1488247929 906 dbSNP
rs879873474 911 dbSNP
rs1368223528 920 dbSNP
rs1165985766 937 dbSNP
rs1192375607 944 dbSNP
rs1422187787 948 dbSNP
rs1476463434 948 dbSNP
rs766308197 956 dbSNP
rs1239803626 959 dbSNP
rs1476191710 961 dbSNP
rs1168093406 965 dbSNP
rs1193577289 969 dbSNP
rs1488632054 970 dbSNP
rs548567594 972 dbSNP
rs1403443825 978 dbSNP
rs1049169003 983 dbSNP
rs189609046 985 dbSNP
rs763276666 985 dbSNP
rs15132 987 dbSNP
rs1005253200 1003 dbSNP
rs1399304604 1005 dbSNP
rs1036372649 1013 dbSNP
rs1219194719 1026 dbSNP
rs1328239462 1033 dbSNP
rs10186488 1034 dbSNP
rs8001 1039 dbSNP
rs1385854882 1041 dbSNP
rs1283876846 1042 dbSNP
rs532629743 1046 dbSNP
rs10186497 1052 dbSNP
rs1463279507 1061 dbSNP
rs828853 1063 dbSNP
rs1170546730 1068 dbSNP
rs1029555732 1070 dbSNP
rs1374847861 1088 dbSNP
rs953554077 1093 dbSNP
rs1353638997 1095 dbSNP
rs1215001188 1105 dbSNP
rs1268238005 1115 dbSNP
rs1215806004 1124 dbSNP
rs1281563274 1129 dbSNP
rs1257220267 1130 dbSNP
rs181143438 1135 dbSNP
rs1341445724 1140 dbSNP
rs1021422561 1144 dbSNP
rs1231971580 1145 dbSNP
rs185160885 1151 dbSNP
rs1331181803 1152 dbSNP
rs967129364 1156 dbSNP
rs768014061 1157 dbSNP
rs1375112087 1161 dbSNP
rs576945702 1162 dbSNP
rs1193245942 1164 dbSNP
rs1421133059 1168 dbSNP
rs928340229 1168 dbSNP
rs1171340890 1175 dbSNP
rs1465559642 1178 dbSNP
rs1195688563 1180 dbSNP
rs1378304115 1180 dbSNP
rs1438107589 1181 dbSNP
rs1199814554 1182 dbSNP
rs1296003224 1182 dbSNP
rs1302556100 1182 dbSNP
rs1345045216 1182 dbSNP
rs1236573481 1183 dbSNP
rs960212330 1187 dbSNP
rs1237482410 1199 dbSNP
rs1352610218 1199 dbSNP
rs76087452 1200 dbSNP
rs1185251823 1201 dbSNP
rs991451958 1201 dbSNP
rs1385566087 1202 dbSNP
rs1395992554 1203 dbSNP
rs1376111289 1206 dbSNP
rs1175656499 1207 dbSNP
rs1418083468 1210 dbSNP
rs1419059465 1215 dbSNP
rs547962323 1219 dbSNP
rs1471005239 1220 dbSNP
rs1235542507 1221 dbSNP
rs188291622 1224 dbSNP
rs1258994897 1226 dbSNP
rs1401400933 1233 dbSNP
rs1286217346 1239 dbSNP
rs1333589784 1244 dbSNP
rs1338986378 1258 dbSNP
rs1282832422 1259 dbSNP
rs756489128 1262 dbSNP
rs915737419 1292 dbSNP
rs1316175107 1298 dbSNP
rs114462874 1303 dbSNP
rs1048216852 1311 dbSNP
rs1263065900 1313 dbSNP
rs570007340 1323 dbSNP
rs1351985779 1338 dbSNP
rs940798130 1345 dbSNP
rs1205272739 1350 dbSNP
rs901865439 1356 dbSNP
rs1191436790 1357 dbSNP
rs537463778 1359 dbSNP
rs1339235683 1363 dbSNP
rs115100660 1366 dbSNP
rs1459708812 1367 dbSNP
rs1217459244 1369 dbSNP
rs1335910799 1369 dbSNP
rs373325463 1369 dbSNP
rs889283419 1369 dbSNP
rs1295584824 1371 dbSNP
rs1011720276 1377 dbSNP
rs1217356945 1377 dbSNP
rs1021817313 1385 dbSNP
rs1245632410 1387 dbSNP
rs757394603 1390 dbSNP
rs1438911320 1392 dbSNP
rs1179360158 1393 dbSNP
rs1365533120 1404 dbSNP
rs538913200 1406 dbSNP
rs1323151500 1413 dbSNP
rs1461718574 1414 dbSNP
rs1396442299 1425 dbSNP
rs180812549 1430 dbSNP
rs763693113 1434 dbSNP
rs1035751390 1436 dbSNP
rs572259927 1437 dbSNP
rs959767706 1441 dbSNP
rs991813650 1449 dbSNP
rs1022799233 1459 dbSNP
rs1193888195 1460 dbSNP
rs781430572 1461 dbSNP
rs1287178064 1462 dbSNP
rs1337580309 1463 dbSNP
rs1399806722 1470 dbSNP
rs952638218 1471 dbSNP
rs1273803620 1472 dbSNP
rs1216340336 1479 dbSNP
rs983889277 1491 dbSNP
rs1274435470 1493 dbSNP
rs908401419 1495 dbSNP
rs186445949 1497 dbSNP
rs1390066730 1511 dbSNP
rs190711549 1512 dbSNP
rs1336928713 1516 dbSNP
rs1465024210 1523 dbSNP
rs972200531 1524 dbSNP
rs1172451645 1528 dbSNP
rs750787486 1533 dbSNP
rs1412207596 1534 dbSNP
rs148225667 1542 dbSNP
rs543418771 1549 dbSNP
rs539126364 1555 dbSNP
rs1255272895 1559 dbSNP
rs183483844 1566 dbSNP
rs868708580 1567 dbSNP
rs1480515622 1568 dbSNP
rs933374383 1571 dbSNP
rs1207271006 1577 dbSNP
rs1224798690 1587 dbSNP
rs1310478122 1587 dbSNP
rs1235273190 1592 dbSNP
rs1256317009 1603 dbSNP
rs1306799654 1609 dbSNP
rs1263419758 1617 dbSNP
rs1457039828 1619 dbSNP
rs1193920604 1620 dbSNP
rs865928339 1629 dbSNP
rs1445771021 1637 dbSNP
rs889344132 1641 dbSNP
rs141126837 1643 dbSNP
rs1427314772 1647 dbSNP
rs1378031306 1650 dbSNP
rs570328452 1652 dbSNP
rs1418819466 1654 dbSNP
rs1409214136 1658 dbSNP
rs1179431957 1666 dbSNP
rs1482591951 1670 dbSNP
rs374153994 1671 dbSNP
rs1211770520 1672 dbSNP
rs1486697079 1674 dbSNP
rs186846816 1679 dbSNP
rs10199560 1683 dbSNP
rs895559033 1695 dbSNP
rs542018193 1697 dbSNP
rs1308926283 1708 dbSNP
rs1226511193 1709 dbSNP
rs1378434280 1724 dbSNP
rs865993673 1729 dbSNP
rs1012502327 1736 dbSNP
rs867873502 1739 dbSNP
rs1416032385 1744 dbSNP
rs1358102877 1748 dbSNP
rs1297162282 1752 dbSNP
rs1397571797 1753 dbSNP
rs147355100 1756 dbSNP
rs1364719252 1761 dbSNP
rs1161809432 1770 dbSNP
rs1301894772 1774 dbSNP
rs1022598622 1775 dbSNP
rs1189281808 1787 dbSNP
rs952607626 1788 dbSNP
rs1347908508 1803 dbSNP
rs1261164257 1805 dbSNP
rs1204741762 1806 dbSNP
rs984026534 1814 dbSNP
rs1283354208 1823 dbSNP
rs1262255703 1827 dbSNP
rs1219030248 1842 dbSNP
rs1333907149 1845 dbSNP
rs1316938493 1846 dbSNP
rs778535657 1851 dbSNP
rs530880662 1856 dbSNP
rs1252887845 1868 dbSNP
rs1382427496 1869 dbSNP
rs1386772441 1869 dbSNP
rs549377175 1870 dbSNP
rs1456656710 1879 dbSNP
rs1208995814 1881 dbSNP
rs1166228396 1884 dbSNP
rs972554827 1896 dbSNP
rs1192634619 1898 dbSNP
rs552569797 1908 dbSNP
rs191278254 1910 dbSNP
rs933416462 1917 dbSNP
rs1189718694 1921 dbSNP
rs771653833 1942 dbSNP
rs137948393 1944 dbSNP
rs183372557 1948 dbSNP
rs1194234146 1950 dbSNP
rs947607676 1953 dbSNP
rs1227436159 1962 dbSNP
rs1327693283 1971 dbSNP
rs1043363894 1973 dbSNP
rs1439742092 1974 dbSNP
rs376240080 1988 dbSNP
rs374758710 1999 dbSNP
rs1463462050 2009 dbSNP
rs1457758761 2011 dbSNP
rs1162056068 2034 dbSNP
rs1368072890 2038 dbSNP
rs1406029408 2040 dbSNP
rs1167858967 2044 dbSNP
rs1303236098 2044 dbSNP
rs1374894577 2054 dbSNP
rs760399538 2059 dbSNP
rs565933851 2060 dbSNP
rs57421736 2066 dbSNP
rs1297336248 2068 dbSNP
rs36085572 2071 dbSNP
rs1195343892 2077 dbSNP
rs1326619155 2077 dbSNP
rs1456282780 2078 dbSNP
rs1249658485 2080 dbSNP
rs1196328597 2100 dbSNP
rs1051836 2101 dbSNP
rs1012637645 2104 dbSNP
rs1044021294 2113 dbSNP
rs1348221780 2113 dbSNP
rs1361516443 2116 dbSNP
rs1304617225 2117 dbSNP
rs1443493079 2132 dbSNP
rs1334377245 2143 dbSNP
rs1223042378 2147 dbSNP
rs1285435223 2150 dbSNP
rs1392521600 2171 dbSNP
rs191575428 2174 dbSNP
rs759435381 2177 dbSNP
rs1311204185 2178 dbSNP
rs1005415626 2184 dbSNP
rs1395851880 2200 dbSNP
rs1015547995 2207 dbSNP
rs1188329054 2212 dbSNP
rs961591464 2228 dbSNP
rs1182393334 2236 dbSNP
rs1423452863 2237 dbSNP
rs1253446128 2238 dbSNP
rs997993260 2239 dbSNP
rs1051837 2242 dbSNP
rs147227181 2246 dbSNP
rs576430745 2251 dbSNP
rs1348946090 2256 dbSNP
rs182278079 2267 dbSNP
rs1451043892 2283 dbSNP
rs968746017 2286 dbSNP
rs1311600311 2297 dbSNP
rs1414188149 2298 dbSNP
rs1376164172 2307 dbSNP
rs1314953515 2313 dbSNP
rs553262416 2335 dbSNP
rs924855348 2338 dbSNP
rs934920057 2341 dbSNP
rs1260156815 2344 dbSNP
rs1366575554 2354 dbSNP
rs35159777 2355 dbSNP
rs1057275313 2356 dbSNP
rs917429458 2362 dbSNP
rs781597594 2365 dbSNP
rs948459501 2367 dbSNP
rs1446130920 2374 dbSNP
rs1384670400 2378 dbSNP
rs1246645476 2382 dbSNP
rs1284007112 2383 dbSNP
rs1044156227 2388 dbSNP
rs761917351 2389 dbSNP
rs187906394 2393 dbSNP
rs558079871 2400 dbSNP
rs1356131115 2404 dbSNP
rs1295250484 2428 dbSNP
rs1326137568 2428 dbSNP
rs1319231220 2430 dbSNP
rs1402170327 2432 dbSNP
rs1261329482 2434 dbSNP
rs1164093253 2443 dbSNP
rs1461940521 2450 dbSNP
rs1483050896 2456 dbSNP
rs1201967044 2462 dbSNP
rs1245381585 2467 dbSNP
rs1037110847 2470 dbSNP
rs1184330546 2475 dbSNP
rs897048974 2488 dbSNP
rs1466041426 2492 dbSNP
rs1242282903 2494 dbSNP
rs1194910828 2504 dbSNP
rs1271704605 2507 dbSNP
rs998535677 2510 dbSNP
rs1336180890 2515 dbSNP
rs1275120483 2520 dbSNP
rs1029486687 2544 dbSNP
rs542432886 2545 dbSNP
rs1433206890 2546 dbSNP
rs1304096572 2559 dbSNP
rs1406510795 2561 dbSNP
rs768541404 2564 dbSNP
rs1325042737 2566 dbSNP
rs1441542987 2580 dbSNP
rs750603559 2581 dbSNP
rs1396516939 2583 dbSNP
rs563708751 2586 dbSNP
rs1160670148 2603 dbSNP
rs1408814551 2607 dbSNP
rs1345193775 2608 dbSNP
rs1169253039 2609 dbSNP
rs60438577 2615 dbSNP
rs545972165 2617 dbSNP
rs1017662165 2635 dbSNP
rs1453192742 2636 dbSNP
rs193213325 2637 dbSNP
rs968798476 2644 dbSNP
rs1225329272 2662 dbSNP
rs1306963715 2666 dbSNP
rs978757805 2684 dbSNP
rs924623634 2686 dbSNP
rs576349959 2694 dbSNP
rs185227951 2698 dbSNP
rs1346074315 2704 dbSNP
rs1302961100 2707 dbSNP
rs1234684515 2717 dbSNP
rs1372943683 2718 dbSNP
rs956296898 2738 dbSNP
rs1441436223 2742 dbSNP
rs370833915 2747 dbSNP
rs1307837416 2776 dbSNP
rs1330370868 2778 dbSNP
rs1322853688 2786 dbSNP
rs1432470582 2795 dbSNP
rs546972980 2796 dbSNP
rs1394030819 2797 dbSNP
rs559457989 2797 dbSNP
rs1265273498 2800 dbSNP
rs1454941077 2806 dbSNP
rs1427732038 2808 dbSNP
rs1461936634 2814 dbSNP
rs1480625333 2821 dbSNP
rs565994280 2824 dbSNP
rs948927335 2834 dbSNP
rs564050452 2843 dbSNP
rs756607907 2844 dbSNP
rs1304658863 2848 dbSNP
rs1223127917 2849 dbSNP
rs941124737 2853 dbSNP
rs1036683462 2857 dbSNP
rs74932250 2861 dbSNP
rs1374343552 2865 dbSNP
rs1452547230 2866 dbSNP
rs1313065191 2869 dbSNP
rs780563315 2873 dbSNP
rs1436255505 2883 dbSNP
rs1361249047 2891 dbSNP
rs1173632091 2895 dbSNP
rs1157463253 2900 dbSNP
rs1418868319 2908 dbSNP
rs754438708 2911 dbSNP
rs569743618 2917 dbSNP
rs1431051336 2920 dbSNP
rs1469949199 2924 dbSNP
rs56067994 2933 dbSNP
rs139562763 2939 dbSNP
rs889710837 2950 dbSNP
rs1484392236 2961 dbSNP
rs1298728999 2967 dbSNP
rs1214723364 2969 dbSNP
rs1006694377 2970 dbSNP
rs1269887229 2988 dbSNP
rs1022151973 3000 dbSNP
rs1293437740 3001 dbSNP
rs1416241293 3004 dbSNP
rs770828122 3006 dbSNP
rs1287940550 3018 dbSNP
rs771351220 3018 dbSNP
rs1324551600 3026 dbSNP
rs1000710856 3027 dbSNP
rs574152380 3031 dbSNP
rs956269662 3033 dbSNP
rs993090392 3034 dbSNP
rs200547223 3043 dbSNP
rs1425635254 3045 dbSNP
rs1259841526 3051 dbSNP
rs1186168025 3053 dbSNP
rs1486049175 3054 dbSNP
rs534332940 3055 dbSNP
rs702462 3063 dbSNP
rs371516812 3069 dbSNP
rs1268888633 3088 dbSNP
rs777346749 3090 dbSNP
rs372139224 3096 dbSNP
rs941107932 3098 dbSNP
rs1294360980 3106 dbSNP
rs972930527 3109 dbSNP
rs1363071327 3116 dbSNP
rs1323033345 3139 dbSNP
rs1439331267 3156 dbSNP
rs559673316 3157 dbSNP
rs1478170127 3162 dbSNP
rs1459463225 3167 dbSNP
rs933612578 3168 dbSNP
rs1050791746 3169 dbSNP
rs770750261 3176 dbSNP
rs1429388729 3177 dbSNP
rs889679690 3178 dbSNP
rs1191442410 3179 dbSNP
rs1467881286 3181 dbSNP
rs942613377 3182 dbSNP
rs1416924175 3190 dbSNP
rs1211599732 3194 dbSNP
rs1479356734 3200 dbSNP
rs1227681732 3203 dbSNP
rs1250323943 3203 dbSNP
rs1343938235 3215 dbSNP
rs1043559813 3216 dbSNP
rs776384986 3222 dbSNP
rs1212582935 3224 dbSNP
rs1254327881 3233 dbSNP
rs1232472529 3236 dbSNP
rs767960955 3240 dbSNP
rs903716247 3242 dbSNP
rs1170872677 3248 dbSNP
rs1394396542 3249 dbSNP
rs1000277372 3258 dbSNP
rs745609691 3284 dbSNP
rs1392195466 3286 dbSNP
rs1422606823 3289 dbSNP
rs11888707 3292 dbSNP
rs891879562 3300 dbSNP
rs190125575 3301 dbSNP
rs1430300719 3302 dbSNP
rs1200893371 3309 dbSNP
rs1417310005 3316 dbSNP
rs1249200974 3318 dbSNP
rs192874393 3323 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10797.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10797.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000394053.2 | 3UTR | CUAUAUACUUUAACUUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000394053.2 | 3UTR | CAACUUACUUUUCCACCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548aq-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057134 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063382 ETNK1 ethanolamine kinase 1 2 2
MIRT072505 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082197 ACTN4 actinin alpha 4 2 6
MIRT083047 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085199 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088917 FOXN2 forkhead box N2 2 4
MIRT089509 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092051 ABHD5 abhydrolase domain containing 5 2 2
MIRT094694 FEM1C fem-1 homolog C 2 2
MIRT095408 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096514 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101306 FAM135A family with sequence similarity 135 member A 2 2
MIRT103369 CBX3 chromobox 3 2 2
MIRT103887 FOXK1 forkhead box K1 2 2
MIRT104347 CLDN12 claudin 12 2 2
MIRT104511 PEG10 paternally expressed 10 2 6
MIRT111811 MPZL1 myelin protein zero like 1 2 2
MIRT177250 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177285 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177635 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178051 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179111 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179598 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195309 LEPROT leptin receptor overlapping transcript 2 2
MIRT203155 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208439 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214587 SMAD5 SMAD family member 5 2 4
MIRT216114 IL6ST interleukin 6 signal transducer 2 2
MIRT216366 CCNB1 cyclin B1 2 4
MIRT220062 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226739 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227708 TBC1D13 TBC1 domain family member 13 2 2
MIRT230083 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248647 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254803 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264390 YAP1 Yes associated protein 1 2 2
MIRT266985 LRRC55 leucine rich repeat containing 55 2 4
MIRT273960 SPRYD4 SPRY domain containing 4 2 2
MIRT281812 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293265 DR1 down-regulator of transcription 1 2 2
MIRT297107 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308184 PDE12 phosphodiesterase 12 2 2
MIRT309027 USP53 ubiquitin specific peptidase 53 2 2
MIRT311481 PRRC1 proline rich coiled-coil 1 2 2
MIRT312599 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328139 ZNF711 zinc finger protein 711 2 2
MIRT329324 FAM53C family with sequence similarity 53 member C 2 2
MIRT334652 NEK7 NIMA related kinase 7 2 2
MIRT340683 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378867 ITGB8 integrin subunit beta 8 2 2
MIRT395804 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405650 WBP4 WW domain binding protein 4 2 4
MIRT408296 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442110 ZNRF2 zinc and ring finger 2 2 8
MIRT442853 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443129 VLDLR very low density lipoprotein receptor 2 2
MIRT443160 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443311 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445093 ZNF207 zinc finger protein 207 2 2
MIRT445397 PTCHD1 patched domain containing 1 2 4
MIRT447083 MCC mutated in colorectal cancers 2 2
MIRT447313 ZNF562 zinc finger protein 562 2 2
MIRT447526 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449524 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449915 C11orf34 placenta expressed transcript 1 1 2
MIRT450564 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450732 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454936 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455905 KIF2C kinesin family member 2C 2 2
MIRT463745 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471195 PHB2 prohibitin 2 2 2
MIRT472777 MTMR6 myotubularin related protein 6 2 8
MIRT474470 KLHL11 kelch like family member 11 2 8
MIRT475998 GTPBP2 GTP binding protein 2 2 2
MIRT482290 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485871 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486205 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488622 FAM3C family with sequence similarity 3 member C 2 6
MIRT489997 DDB1 damage specific DNA binding protein 1 2 2
MIRT493489 IPMK inositol polyphosphate multikinase 2 2
MIRT494293 CEP120 centrosomal protein 120 2 2
MIRT498005 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498486 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498572 TMEM30B transmembrane protein 30B 2 2
MIRT499880 SVOP SV2 related protein 2 10
MIRT500233 INHBA inhibin beta A subunit 2 10
MIRT500707 TRIM37 tripartite motif containing 37 2 2
MIRT501001 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501036 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502749 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502811 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502900 CDK4 cyclin dependent kinase 4 2 8
MIRT503496 ZNF154 zinc finger protein 154 2 6
MIRT503730 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505150 YOD1 YOD1 deubiquitinase 2 2
MIRT505815 RSBN1 round spermatid basic protein 1 2 8
MIRT505854 POLR1B RNA polymerase I subunit B 2 4
MIRT509297 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516842 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520532 TRA2B transformer 2 beta homolog 2 2
MIRT520736 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525416 SHISA9 shisa family member 9 2 4
MIRT525880 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526026 RBM4B RNA binding motif protein 4B 2 2
MIRT526097 TMEM41B transmembrane protein 41B 2 2
MIRT527944 FRY FRY microtubule binding protein 2 2
MIRT528831 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531075 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535508 PANX1 pannexin 1 2 2
MIRT536695 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536848 HMBOX1 homeobox containing 1 2 2
MIRT537215 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537847 EFNA5 ephrin A5 2 2
MIRT538358 CSE1L chromosome segregation 1 like 2 4
MIRT541255 GPC4 glypican 4 2 2
MIRT543248 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543463 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543724 XKR9 XK related 9 2 2
MIRT543920 ESYT1 extended synaptotagmin 1 2 2
MIRT544012 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544083 METTL8 methyltransferase like 8 2 2
MIRT544200 ANGPTL3 angiopoietin like 3 2 2
MIRT544821 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545059 PRELID1 PRELI domain containing 1 2 2
MIRT545227 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545302 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545563 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546510 SIK1 salt inducible kinase 1 2 2
MIRT546927 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547688 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547781 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548700 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548914 CHEK2 checkpoint kinase 2 2 4
MIRT549970 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550502 TMEM241 transmembrane protein 241 2 2
MIRT551062 MKLN1 muskelin 1 2 2
MIRT552824 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553158 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553843 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554271 SIX4 SIX homeobox 4 2 2
MIRT555794 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556331 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556512 LIPA lipase A, lysosomal acid type 2 2
MIRT556706 KLHL28 kelch like family member 28 2 2
MIRT556765 KLF7 Kruppel like factor 7 2 2
MIRT557003 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557159 HOXA13 homeobox A13 2 2
MIRT557500 GPR27 G protein-coupled receptor 27 2 4
MIRT558115 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559357 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560348 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561312 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561896 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561940 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562948 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563304 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563418 KIF3A kinesin family member 3A 2 2
MIRT563575 KIAA1586 KIAA1586 2 2
MIRT565888 NHS NHS actin remodeling regulator 2 2
MIRT566094 RCC2 regulator of chromosome condensation 2 2 2
MIRT566409 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567272 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571481 CCDC80 coiled-coil domain containing 80 2 2
MIRT572952 VDAC2 voltage dependent anion channel 2 2 2
MIRT573641 ZNF724P zinc finger protein 724 2 2
MIRT573730 KHSRP KH-type splicing regulatory protein 2 2
MIRT609101 SMIM15 small integral membrane protein 15 2 6
MIRT617949 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618392 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619640 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623468 KDM5A lysine demethylase 5A 2 2
MIRT629158 CTCFL CCCTC-binding factor like 2 2
MIRT638534 LYRM2 LYR motif containing 2 2 2
MIRT649496 CLDN16 claudin 16 2 2
MIRT683161 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691673 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693214 MKI67 marker of proliferation Ki-67 2 2
MIRT695347 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701036 PCGF5 polycomb group ring finger 5 2 2
MIRT708766 RYBP RING1 and YY1 binding protein 2 2
MIRT717571 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719299 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725185 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548aq Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission