miRTarBase - #MIRT089615


—
pre-miRNA Information
pre-miRNA hsa-mir-7515   
Genomic Coordinates chr2: 6650373 - 6650439
Description Homo sapiens miR-7515 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7515
Sequence 46| AGAAGGGAAGAUGGUGAC |63
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1451879371 1 dbSNP
rs576086800 3 dbSNP
rs753372632 5 dbSNP
rs1337497055 7 dbSNP
rs1405449301 9 dbSNP
rs1032296398 10 dbSNP
rs960195576 12 dbSNP
rs1470711310 14 dbSNP
Putative Targets

Gene Information
Gene Symbol MAT2A   
Synonyms MATA2, MATII, SAMS2
Description methionine adenosyltransferase 2A
Transcript NM_005911   
Expression
Putative miRNA Targets on MAT2A
3'UTR of MAT2A
(miRNA target sites are highlighted)		 
>MAT2A|NM_005911|3'UTR
   1 AAGTGTTAGCCTTTTTTCCCCAGACTTGTTGGCGTAGGCTACAGAGAAGCCTTCAAGCTCTGAGGGAAAGGGCCCTCCTT
  81 CCTAAATTTTCCTGTCCTCTTTCAGCTCCTGACCAGTTGCAGTCACTCTAGTCAATGACATGAATTTTAGCTTTTGTGGG
 161 GGACTGTAAGTTGGGCTTGCTATTCTGTCCCTAGGTGTTTTGTTCACCATTATAATGAATTTAGTGAGCATAGGTGATCC
 241 ATGTAACTGCCTAGAAACAACACTGTAGTAAATAATGCTTTGAAATTGAACCTTTGTGCCCTATCACCCAACGCTCCAAA
 321 GTCATAATTGCATTGACTTTCCCCACCAGATGCTGAAAATGTCCTTGTGATGTGCACGTAAAGTACTTGTAGTTCCACTT
 401 ATAGCCTCTGTCTGGCAATGCCACAGCCCTGTCAGCATGAATTTGTAATGTCTTGAGCTCTATTATGAATGTGAAGCCTT
 481 CCCCTTATCCTCCCTGTAACTTGATCCATTTCTAATTATGTAGCTCTTTGTCAGGGAGTGTTCCCTATCCAATCAATCTT
 561 GCATGTAACGCAAGTTCCCAGTTGGAGCTCCAGCCTGACATCAAAAAAGGCAGTTACCATTAAACCATCTCCCTGGTGCT
 641 TATGCTCTTAATTGCCACCTCTAACAGCACCAAATCAAAATCTCTCCACTTTCAGCTGTCTTTTGGAGGACGTACGTAAT
 721 AAGGTTTTAATTTAGTAAACCAATCCTATGCATGGTTTCAGCACTAGCCAAACCTCACCAACTCCTAGTTCTAGAAAAAC
 801 AGGCACTTGGCAGCCTTGTGATGTCATACAGAGAAGTCACAGGGCAGTACCTGAGGGTCTGTAGGTTGCACACTTTGGTA
 881 CCAGATAACTTTTTTTTTTCTTTATAAGAAAGCCTGAGTACTCCACACTGCACAATAACTCCTCCCAGGGTTTTAACTTT
 961 GTTTTATTTTCAAAACCAGGTCCAATGAGCTTTCTGAACAGCTGGTGTAGCTACAGAGAAACCAGCTTCCTTCAGAGAGC
1041 AGTGCTTTTGGCGGGGAGGAGGAAATCCCTTCATACTTGAACGTTTTCTAATTGCTTATTTATTGTATTCTGGGGTATGG
1121 CGTAAGTACAGAGAAGCCATCACCTCAGATGGCAGCTTTTAAAAGATTTTTTTTTTTTCTCTCAACACCATGATTCCTTT
1201 AACAACATGTTTCCAGCATTCCCAGGTAGGCCAAGGTGTCCTACAGAAAAACCTTGGGTTAGACCTACAGGGGGTCTGGC
1281 TGGTGTTAACAGAAGGGAGGGCAGAGCTGGTGCGGCTGGCCATGGAGAAAGCTGACTTGGCTGGTGTGGTACAGAGAAGC
1361 CAGCTTGTTTACATGCTTATTCCATGACTGCTTGCCCTAAGCAGAAAGTGCCTTTCAGGATCTATTTTTGGAGGTTTATT
1441 ACGTATGTCTGGTTCTCAATTCCAACAGTTTAATGAAGATCTAAATAAAATGCTAGGTTCTACCTTAAAAAAAAAAAAAA
1521 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cagugguagaAGGGAAGa 5'
                    ||||||| 
Target 5' gaggaggaaaTCCCTTCa 3'
 1056 - 1073 140.00 -9.30
2 
miRNA  3' cagUGGUAGAAGGGAAGa 5'
             |||| | |:||||| 
Target 5' gaaACCAGC-TTCCTTCa 3'
 1018 - 1034 138.00 -12.30
3 
miRNA  3' caGUGGUAGAAGGGAAGa 5'
            ||||||  |:||||: 
Target 5' aaCACCATGATTCCTTTa 3'
 1184 - 1201 132.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
337171 1166 ClinVar
337172 1167 ClinVar
337173 1268 ClinVar
898899 1315 ClinVar
898900 1323 ClinVar
898901 1365 ClinVar
337174 1419 ClinVar
337175 1437 ClinVar
895937 1443 ClinVar
895938 1482 ClinVar
COSN31491713 2 COSMIC
COSN30569488 8 COSMIC
COSN31518289 17 COSMIC
COSN31482386 30 COSMIC
COSN14532144 93 COSMIC
COSN9391534 100 COSMIC
COSN20288801 186 COSMIC
COSN26556738 250 COSMIC
COSN20090570 279 COSMIC
COSN31601278 302 COSMIC
COSN26670157 313 COSMIC
COSN5865552 336 COSMIC
COSN31588545 347 COSMIC
COSN31559515 535 COSMIC
COSN31545991 562 COSMIC
COSN26601554 580 COSMIC
COSN6559526 605 COSMIC
COSN31563363 643 COSMIC
COSN31489295 662 COSMIC
COSN31518105 716 COSMIC
COSN22229193 749 COSMIC
COSN31959778 769 COSMIC
COSN16524245 775 COSMIC
COSN28669283 869 COSMIC
COSN28250198 914 COSMIC
COSN20090571 1017 COSMIC
COSN27886919 1152 COSMIC
COSN31529730 1180 COSMIC
COSN28249874 1182 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1171039097 1 dbSNP
rs776431969 8 dbSNP
rs1359092024 10 dbSNP
rs1412686279 11 dbSNP
rs1332323028 12 dbSNP
rs372099842 13 dbSNP
rs1448793530 17 dbSNP
rs1315047771 19 dbSNP
rs1338624920 21 dbSNP
rs749458057 23 dbSNP
rs769156900 30 dbSNP
rs774638304 31 dbSNP
rs1342163005 34 dbSNP
rs762233743 37 dbSNP
rs1277360846 39 dbSNP
rs1312288358 50 dbSNP
rs952350922 58 dbSNP
rs1180192001 70 dbSNP
rs1483002521 76 dbSNP
rs1236811167 86 dbSNP
rs1204174398 92 dbSNP
rs1233656160 98 dbSNP
rs1486508152 104 dbSNP
rs984413834 106 dbSNP
rs1484269551 109 dbSNP
rs148739699 112 dbSNP
rs1342436786 114 dbSNP
rs1297358338 120 dbSNP
rs1417541111 123 dbSNP
rs940192158 125 dbSNP
rs1417193735 126 dbSNP
rs1369041877 129 dbSNP
rs1475832951 136 dbSNP
rs1430875852 141 dbSNP
rs1165445622 143 dbSNP
rs530472867 149 dbSNP
rs1163012698 153 dbSNP
rs1423286919 155 dbSNP
rs1407707065 158 dbSNP
rs1414665222 163 dbSNP
rs1188510143 164 dbSNP
rs1476155208 165 dbSNP
rs1249259783 166 dbSNP
rs1480869596 167 dbSNP
rs992982477 167 dbSNP
rs1252678305 168 dbSNP
rs1218975506 174 dbSNP
rs1320547079 177 dbSNP
rs549048191 179 dbSNP
rs917340680 183 dbSNP
rs1235611950 184 dbSNP
rs1349174972 186 dbSNP
rs948859314 192 dbSNP
rs1376036100 195 dbSNP
rs1291961810 201 dbSNP
rs1457616314 206 dbSNP
rs1044866892 220 dbSNP
rs1411469041 222 dbSNP
rs904570942 223 dbSNP
rs1354525598 233 dbSNP
rs1455769270 234 dbSNP
rs1409644134 236 dbSNP
rs1181427467 237 dbSNP
rs1419417499 239 dbSNP
rs1245439519 240 dbSNP
rs935963530 242 dbSNP
rs1337599363 243 dbSNP
rs1053637181 246 dbSNP
rs1487960386 251 dbSNP
rs1273503817 264 dbSNP
rs1215007075 266 dbSNP
rs142372744 277 dbSNP
rs15351 278 dbSNP
rs1268023991 288 dbSNP
rs1009830797 292 dbSNP
rs1319055395 295 dbSNP
rs1299662967 302 dbSNP
rs1386364304 304 dbSNP
rs371796804 305 dbSNP
rs1328239893 308 dbSNP
rs1432962922 311 dbSNP
rs1344621433 312 dbSNP
rs868266117 313 dbSNP
rs562646394 314 dbSNP
rs990394448 317 dbSNP
rs1486164948 320 dbSNP
rs796159921 322 dbSNP
rs534733325 325 dbSNP
rs996646224 332 dbSNP
rs1253219143 341 dbSNP
rs1195159153 343 dbSNP
rs1028075771 354 dbSNP
rs1246905898 357 dbSNP
rs952362235 361 dbSNP
rs983754653 364 dbSNP
rs1254828628 372 dbSNP
rs1166772986 378 dbSNP
rs1232969237 378 dbSNP
rs1390206551 379 dbSNP
rs1226499473 381 dbSNP
rs1431271658 382 dbSNP
rs1015867868 387 dbSNP
rs961626588 388 dbSNP
rs1382644226 390 dbSNP
rs546694561 392 dbSNP
rs571712952 396 dbSNP
rs539230166 398 dbSNP
rs867903069 399 dbSNP
rs1175075474 401 dbSNP
rs1447298989 401 dbSNP
rs6711750 403 dbSNP
rs1193273739 404 dbSNP
rs542611069 406 dbSNP
rs1254658584 407 dbSNP
rs926003757 410 dbSNP
rs936014197 419 dbSNP
rs1282935879 427 dbSNP
rs1429890230 430 dbSNP
rs1203210023 431 dbSNP
rs1298450528 432 dbSNP
rs1367371874 437 dbSNP
rs1271054365 438 dbSNP
rs1229679322 458 dbSNP
rs1053024782 464 dbSNP
rs1232376902 465 dbSNP
rs536237196 467 dbSNP
rs1279873920 471 dbSNP
rs866919338 473 dbSNP
rs1375773820 478 dbSNP
rs1314498025 479 dbSNP
rs1427660599 482 dbSNP
rs1346217852 485 dbSNP
rs1168185796 489 dbSNP
rs1476090835 490 dbSNP
rs1202519257 493 dbSNP
rs1282815268 494 dbSNP
rs913204821 506 dbSNP
rs184837848 508 dbSNP
rs1187391928 509 dbSNP
rs945343846 513 dbSNP
rs1259962509 515 dbSNP
rs572981137 516 dbSNP
rs1446960833 519 dbSNP
rs1482963105 520 dbSNP
rs1041354002 531 dbSNP
rs1197813121 540 dbSNP
rs1354284705 542 dbSNP
rs540302323 544 dbSNP
rs1264952628 549 dbSNP
rs901047641 550 dbSNP
rs144911618 553 dbSNP
rs189711755 557 dbSNP
rs1407740658 563 dbSNP
rs1329069013 564 dbSNP
rs1411323189 566 dbSNP
rs888167879 569 dbSNP
rs545194929 570 dbSNP
rs1394079550 571 dbSNP
rs1180702708 574 dbSNP
rs1466395839 575 dbSNP
rs1233843420 581 dbSNP
rs1174140129 582 dbSNP
rs1382451569 588 dbSNP
rs1267022322 589 dbSNP
rs1214387799 590 dbSNP
rs1400054167 590 dbSNP
rs1337103806 591 dbSNP
rs1321062296 592 dbSNP
rs1226528403 593 dbSNP
rs1391009441 593 dbSNP
rs1438785764 595 dbSNP
rs1279932835 600 dbSNP
rs1302500481 604 dbSNP
rs1328990250 607 dbSNP
rs748649521 610 dbSNP
rs1331864210 614 dbSNP
rs1396076361 617 dbSNP
rs758737664 618 dbSNP
rs560991019 620 dbSNP
rs1278165339 625 dbSNP
rs1014546284 632 dbSNP
rs1024938276 641 dbSNP
rs1477278722 645 dbSNP
rs1377263991 647 dbSNP
rs1194545491 650 dbSNP
rs1469847286 654 dbSNP
rs1350329421 656 dbSNP
rs1206678255 662 dbSNP
rs535170379 672 dbSNP
rs771181010 679 dbSNP
rs1342668115 682 dbSNP
rs1302190722 683 dbSNP
rs970259542 685 dbSNP
rs1465902185 690 dbSNP
rs1867880 693 dbSNP
rs1211243117 694 dbSNP
rs1429503543 697 dbSNP
rs1346298077 701 dbSNP
rs980209264 712 dbSNP
rs1433435376 713 dbSNP
rs1394885634 715 dbSNP
rs1174440135 717 dbSNP
rs1455753618 725 dbSNP
rs528550929 726 dbSNP
rs1185999529 729 dbSNP
rs926054748 742 dbSNP
rs1242607591 744 dbSNP
rs957473607 753 dbSNP
rs1440434587 764 dbSNP
rs1472139632 773 dbSNP
rs191347244 775 dbSNP
rs1211074871 778 dbSNP
rs1349598237 782 dbSNP
rs1390710350 790 dbSNP
rs988841637 792 dbSNP
rs913267650 793 dbSNP
rs1362093910 794 dbSNP
rs1459975102 798 dbSNP
rs1446487539 802 dbSNP
rs1375156011 803 dbSNP
rs1313871355 805 dbSNP
rs1437043321 807 dbSNP
rs1325336696 809 dbSNP
rs1368931892 813 dbSNP
rs1170067959 814 dbSNP
rs944702983 816 dbSNP
rs1388750477 821 dbSNP
rs1474188092 825 dbSNP
rs1188379943 828 dbSNP
rs1256810184 828 dbSNP
rs1486559712 831 dbSNP
rs1249232250 838 dbSNP
rs1050108 845 dbSNP
rs1040972738 847 dbSNP
rs1189695949 848 dbSNP
rs1307513466 857 dbSNP
rs1274512537 858 dbSNP
rs563435482 866 dbSNP
rs922479891 874 dbSNP
rs1229375817 877 dbSNP
rs1290796235 879 dbSNP
rs1294499613 879 dbSNP
rs1333378698 882 dbSNP
rs1233158991 886 dbSNP
rs932486523 887 dbSNP
rs1005336170 890 dbSNP
rs1461045183 890 dbSNP
rs550275542 890 dbSNP
rs888264150 890 dbSNP
rs1417054644 892 dbSNP
rs11537669 901 dbSNP
rs1165619589 903 dbSNP
rs1488483037 905 dbSNP
rs1248174300 914 dbSNP
rs1176207786 915 dbSNP
rs1037185525 918 dbSNP
rs1211335116 922 dbSNP
rs1234315806 924 dbSNP
rs1211262858 926 dbSNP
rs778027496 927 dbSNP
rs1482634166 928 dbSNP
rs745453983 936 dbSNP
rs1024572825 937 dbSNP
rs1327454679 940 dbSNP
rs1306742962 945 dbSNP
rs1474196562 949 dbSNP
rs970689927 950 dbSNP
rs1001721327 958 dbSNP
rs1375788347 958 dbSNP
rs1440227577 969 dbSNP
rs1369199015 975 dbSNP
rs1395355837 978 dbSNP
rs1459501859 979 dbSNP
rs780961774 979 dbSNP
rs1033168197 981 dbSNP
rs1166426235 984 dbSNP
rs957528509 995 dbSNP
rs1361776737 1001 dbSNP
rs1410624452 1022 dbSNP
rs530858793 1031 dbSNP
rs1310265555 1033 dbSNP
rs193153527 1034 dbSNP
rs1409676015 1045 dbSNP
rs1353893910 1046 dbSNP
rs1191402246 1053 dbSNP
rs1414711596 1054 dbSNP
rs1253100585 1058 dbSNP
rs1020750494 1062 dbSNP
rs377450065 1063 dbSNP
rs1260713803 1066 dbSNP
rs1240186938 1068 dbSNP
rs769445498 1069 dbSNP
rs1246324876 1074 dbSNP
rs1301478989 1081 dbSNP
rs528107494 1083 dbSNP
rs371101314 1084 dbSNP
rs1371743567 1087 dbSNP
rs1205363146 1091 dbSNP
rs1382671421 1096 dbSNP
rs976460747 1096 dbSNP
rs922563709 1108 dbSNP
rs1484566600 1115 dbSNP
rs1454093295 1117 dbSNP
rs1346775237 1122 dbSNP
rs1171306013 1123 dbSNP
rs1453427925 1123 dbSNP
rs932581248 1141 dbSNP
rs1194943870 1144 dbSNP
rs985362499 1155 dbSNP
rs370014861 1166 dbSNP
rs909754447 1166 dbSNP
rs1036790776 1167 dbSNP
rs1348859473 1167 dbSNP
rs886056355 1167 dbSNP
rs1305968246 1169 dbSNP
rs896867660 1170 dbSNP
rs1325970199 1172 dbSNP
rs1382731073 1178 dbSNP
rs571321000 1178 dbSNP
rs1363731984 1179 dbSNP
rs1181271111 1180 dbSNP
rs1256752195 1182 dbSNP
rs1425680790 1184 dbSNP
rs1168466588 1185 dbSNP
rs1459993932 1190 dbSNP
rs1372026232 1191 dbSNP
rs1194450449 1192 dbSNP
rs1430810005 1200 dbSNP
rs749255803 1201 dbSNP
rs1437425988 1207 dbSNP
rs1430661455 1210 dbSNP
rs1486229480 1213 dbSNP
rs538854890 1218 dbSNP
rs1282699198 1233 dbSNP
rs1194325563 1234 dbSNP
rs905521973 1235 dbSNP
rs15352 1248 dbSNP
rs1001773700 1252 dbSNP
rs1033223988 1253 dbSNP
rs759788569 1268 dbSNP
rs1465842371 1270 dbSNP
rs1303982107 1275 dbSNP
rs1010329050 1283 dbSNP
rs1020382748 1290 dbSNP
rs1355892117 1295 dbSNP
rs1335730437 1302 dbSNP
rs1063503 1304 dbSNP
rs1389337847 1308 dbSNP
rs551196531 1314 dbSNP
rs867667606 1315 dbSNP
rs149495444 1323 dbSNP
rs1164880630 1327 dbSNP
rs1260077362 1345 dbSNP
rs976174967 1345 dbSNP
rs914377375 1346 dbSNP
rs1179848329 1350 dbSNP
rs1029437962 1351 dbSNP
rs3209936 1357 dbSNP
rs953351844 1365 dbSNP
rs3209940 1367 dbSNP
rs1332821220 1373 dbSNP
rs1276321340 1384 dbSNP
rs985377047 1386 dbSNP
rs909765667 1389 dbSNP
rs1335176210 1393 dbSNP
rs1285740639 1395 dbSNP
rs1236696498 1402 dbSNP
rs1334790056 1418 dbSNP
rs886056356 1419 dbSNP
rs1345531861 1420 dbSNP
rs1448306589 1425 dbSNP
rs1391688425 1430 dbSNP
rs377381751 1437 dbSNP
rs972954833 1440 dbSNP
rs1484208583 1443 dbSNP
rs1157180478 1444 dbSNP
rs1469993083 1452 dbSNP
rs1364569447 1466 dbSNP
rs554866641 1474 dbSNP
rs949866556 1482 dbSNP
rs1252467856 1497 dbSNP
rs1450161562 1499 dbSNP
rs1190813876 1503 dbSNP
rs1468853701 1507 dbSNP
rs1292008040 1509 dbSNP
rs1203132381 1510 dbSNP
rs772325888 1510 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 4144.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 4144.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 4144.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000306434.3 | 3UTR | GGAGGAGGAAAUCCCUUCAUACUUGAACGUUUUCUAAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000306434.3 | 3UTR | AGGAGGAAAUCCCUUCAUACUUGAACGUUUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000306434.3 | 3UTR | AGGAAAUCCCUUCAUACUUGAACGUUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACGUUUUCUAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000306434.3 | 3UTR | AAAUCCCUUCAUACUUGAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
116 hsa-miR-7515 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063460 SKI SKI proto-oncogene 2 4
MIRT089615 MAT2A methionine adenosyltransferase 2A 2 10
MIRT100238 PRR3 proline rich 3 2 4
MIRT159239 NRBP1 nuclear receptor binding protein 1 2 2
MIRT183526 BTG2 BTG anti-proliferation factor 2 2 2
MIRT266866 SLC25A44 solute carrier family 25 member 44 2 2
MIRT304116 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT331077 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT350659 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT438442 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT443555 ZFP3 ZFP3 zinc finger protein 2 2
MIRT447969 MSH6 mutS homolog 6 2 2
MIRT448635 ONECUT1 one cut homeobox 1 2 2
MIRT451778 USP36 ubiquitin specific peptidase 36 2 2
MIRT452615 REPIN1 replication initiator 1 2 2
MIRT453433 GLG1 golgi glycoprotein 1 2 2
MIRT454015 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT454961 TPM2 tropomyosin 2 2 2
MIRT455364 KDM5C lysine demethylase 5C 2 2
MIRT455434 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT455456 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455595 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT455689 GLO1 glyoxalase I 2 2
MIRT455949 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT456135 SAMD10 sterile alpha motif domain containing 10 2 2
MIRT456821 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457441 NOL10 nucleolar protein 10 2 2
MIRT458048 TSEN54 tRNA splicing endonuclease subunit 54 2 2
MIRT458237 NXPH3 neurexophilin 3 2 2
MIRT458671 GPR35 G protein-coupled receptor 35 2 2
MIRT458741 CES2 carboxylesterase 2 2 2
MIRT459102 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT459676 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459776 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT461975 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462267 TPI1 triosephosphate isomerase 1 2 2
MIRT463296 ZFP91 ZFP91 zinc finger protein 2 2
MIRT463446 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT464379 URM1 ubiquitin related modifier 1 2 2
MIRT465552 TOB2 transducer of ERBB2, 2 2 2
MIRT467359 SP2 Sp2 transcription factor 2 2
MIRT467638 SLC7A5 solute carrier family 7 member 5 2 2
MIRT467795 SLC2A14 solute carrier family 2 member 14 2 2
MIRT468466 SET SET nuclear proto-oncogene 2 4
MIRT468725 SDC4 syndecan 4 2 2
MIRT468784 SCAMP5 secretory carrier membrane protein 5 2 2
MIRT469154 RNF121 ring finger protein 121 2 2
MIRT473436 MDM4 MDM4, p53 regulator 2 2
MIRT473636 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474242 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT474654 KLF13 Kruppel like factor 13 2 2
MIRT475384 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475400 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476369 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT478017 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT478459 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478791 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT478952 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480412 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT481455 ARRB2 arrestin beta 2 2 2
MIRT481556 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT481740 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT483592 SLC26A9 solute carrier family 26 member 9 2 2
MIRT484423 SNX19 sorting nexin 19 2 2
MIRT484727 HOXB8 homeobox B8 2 6
MIRT487419 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487622 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT488048 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488064 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488587 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488696 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT489175 ANKRD45 ankyrin repeat domain 45 2 4
MIRT490435 MYL9 myosin light chain 9 2 2
MIRT490452 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490704 FSTL4 follistatin like 4 2 2
MIRT491038 ALPK3 alpha kinase 3 2 2
MIRT491249 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491632 SEMA4G semaphorin 4G 2 2
MIRT492491 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492506 RANBP10 RAN binding protein 10 2 4
MIRT493917 FAM127B retrotransposon Gag like 8A 2 4
MIRT494012 DUSP9 dual specificity phosphatase 9 2 2
MIRT499188 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499813 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT501837 NCOA2 nuclear receptor coactivator 2 2 2
MIRT504067 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT505313 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT511829 H2AFX H2A histone family member X 2 4
MIRT515497 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT518629 NONO non-POU domain containing octamer binding 2 2
MIRT519774 ZNF354B zinc finger protein 354B 2 8
MIRT521806 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522621 MAP7D1 MAP7 domain containing 1 2 4
MIRT532803 CLDN11 claudin 11 2 2
MIRT533783 TMEM119 transmembrane protein 119 2 2
MIRT536433 KMT2B lysine methyltransferase 2B 2 6
MIRT538700 CASP16 caspase 16, pseudogene 2 4
MIRT544603 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT556730 KLHL15 kelch like family member 15 2 4
MIRT560587 LCE1B late cornified envelope 1B 2 2
MIRT560617 ANKRD36 ankyrin repeat domain 36 2 2
MIRT564348 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568925 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT570946 CPE carboxypeptidase E 2 2
MIRT571235 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT573805 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574149 MARVELD1 MARVEL domain containing 1 2 2
MIRT575772 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT576154 Hmox1 heme oxygenase 1 2 2
MIRT611312 CA8 carbonic anhydrase 8 2 4
MIRT615891 MT1A metallothionein 1A 2 2
MIRT669589 AK2 adenylate kinase 2 2 2
MIRT687186 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 2 2
MIRT692711 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT701346 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT701997 MIER3 MIER family member 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-7 Berbamine derivative(BBMD3) NULL NULL Illumina HiSeq2000 brain 24732116 2014 down-regulated
miR-7 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-7 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-7 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-7 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-7 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-7 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-7 Interleukin 13 (IL-13) NULL NULL Quantitative real-time PCR bronchial epithelial cells 22453679 2012 down-regulated
miR-7 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-7 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-7515 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)

Error report submission