miRTarBase - #MIRT090336


—
pre-miRNA Information
pre-miRNA hsa-mir-518a-1   
Genomic Coordinates chr19: 53731006 - 53731090
Synonyms MIRN518A-1, MIRN518A1, MIR518A1
Description Homo sapiens miR-518a-1 stem-loop
Comment The 5' mature product was previously named miR-527 in has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-518a-2   
Genomic Coordinates chr19: 53739333 - 53739419
Synonyms MIRN518A-2, MIRN518A2, MIR518A2
Description Homo sapiens miR-518a-2 stem-loop
Comment The 5' mature product was previously named miR-527 in has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-518a-5p
Sequence 14| CUGCAAAGGGAAGCCCUUUC |33
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs779337342 1 dbSNP
rs1220923096 2 dbSNP
rs748541083 3 dbSNP
rs1419564974 4 dbSNP
rs954777846 6 dbSNP
rs749384027 7 dbSNP
rs1466927206 9 dbSNP
rs1331417194 10 dbSNP
rs919574209 10 dbSNP
rs374228640 11 dbSNP
rs1442070388 13 dbSNP
rs759533489 16 dbSNP
rs1315177101 19 dbSNP
rs765231725 20 dbSNP
rs373104095 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SEC61A1   
Synonyms HNFJ4, HSEC61, SEC61, SEC61A
Description Sec61 translocon alpha 1 subunit
Transcript NM_013336   
Expression
Putative miRNA Targets on SEC61A1
3'UTR of SEC61A1
(miRNA target sites are highlighted)		 
>SEC61A1|NM_013336|3'UTR
   1 GCCCGTCTCCCGGACAGGTTGAGGAAGCTGCTCCAGAAGCGCCTCGGAAGGGGAGCTCTCATCATGGCGCGTGCTGCTGC
  81 GGCATATGGACTTTTAATAATGTTTTTGAATTTCGTATTCTTTCATTCCACTGTGTAAAGTGCTAGACATTTTCCAATTT
 161 AAAATTTTGCTTTTTATCCTGGCACTGGCAAAAAGAACTGTGAAAGTGAAATTTTATTCAGCCGACTGCCAGAGAAGTGG
 241 GAATGGTATAGGATTGTCCCCAAGTGTCCATGTAACTTTTGTTTTAACCTTTGCACCTTCTCAGTGCTGTATGCGGCTGC
 321 AGCCGTCTCACCTGTTTCCCCACAAAGGGAATTTCTCACTCTGGTTGGAAGCACAAACACTGAAATGTCTACGTTTCATT
 401 TTGGCAGTAGGGTGTGAAGCTGGGAGCAGATCATGTATTTCCCGGAGACGTGGGACCTTGCTGGCATGTCTCCTTCACAA
 481 TCAGGCGTGGGAATATCTGGCTTAGGACTGTTTCTCTCTAAGACACCATTGTTTTCCCTTATTTTAAAAGTGATTTTTTT
 561 AAGGACAGAACTTCTTCCAAAAGAGAGGGATGGCTTTCCCAGAAGACACTCCTGGCCATCTGTGGATTTGTCTGTGCACC
 641 TATTGGCTCTTCTAGCTGACTCTTCTGGTTGGGCTTAGAGTCTGCCTGTTTCTGCTAGCTCCGTGTTTAGTCCACTTGGG
 721 TCATCAGCTCTGCCAAGCTGAGCCTGGCCAAGCTAGGTGGACAGACCCTTGCAGTGATGTCCGTTTGTCCAGATTCTGCC
 801 AGTCATCACTGGACACGTCTCCTCGCAGCTGCCCTAGCAAGGGGAGACATTGTGGTAGCTATCAGACATGGACAGAAACT
 881 GACTTAGTGCTCACAAGCCCCTACACCTTCTGGGCTGAAGATCACCCAGCTGTGTTCAGAATTTTCTTACTGTGCTTAGG
 961 ACTGCACGCAAGTGAGCAGACACCACCGACTTCCTTTCTGCGTCACCAGTGTCGTCAGCAGAGAGAGGACAGCACAGGCT
1041 CAAGGTTGGTAGTGAAGTCAGGTTCGGGGTGCATGGGCTGTGGTGGTGTTGATCAGTTGCTCCAGTGTTTGAAATAAGAA
1121 GACTCATGTTTATGTCTGGAATAAGTTCTGTTTGTGCTGACAGGTGGCCTAGGTCCTGGAGATGAGCACCCTCTCTCTGG
1201 CCTTTAGGGAGTCCCCTCTTAGGACAGGCACTGCCCAGCAGCAAGGGCAGCAGAGTTGGGTGCTAAGATCCTGAGGAGCT
1281 CGAGGTTTCGAGCTGGCTTTAGACATTGGTGGGACCAAGGATGTTTTGCAGGATGCCCTGATCCTAAGAAGGGGGCCTGG
1361 GGGTGCGTGCAGCCTGTCGGGGAGACCCCACTCTGACAGTGGGCACACGGCAGCCTGCAAAGCACAGGGCCACCGCCACA
1441 GCCCGGCAGAGGGGCACACTCTGGAGACCTTGCTGGCAGTGCTAGCCAGGAAACAGAGTGACCAAGGGACAAGAAGGGAC
1521 TTGCCTAAAGCCACCCAGCAACTCAGCAGCAGAACCAAGATGGGCCCCAGGCTCCTCCATATGGCCCAGGGCTTACCACC
1601 CTATCACACGTGGCCTTGTCTAGACCCAGTCCTGAGCAGGGGAGAGGCTCTTGAGACCTGATGCCCTCCTACCCACATGG
1681 TTCTCCCACTGCCCTGTCTGCTCTGCTGCTACAGAGGGGCAGGGCCTCCCCCAGCCCACGCTTAGGAATGCTTGGCCTCT
1761 GGCAGGCAGGCAGCTGTACCCAAGCTGGTGGGCAGGGGGCTGGAAGGCACCAGGCCTCAGGAGGAGCCCCATAGTCCCGC
1841 CTGCAGCCTGTAACCATCGGCTGGGCCCTGCAAGGCCCACACTCACGCCCTGTGGGTGATGGTCACGGTGGGTGGGTGGG
1921 GGCTGACCCCAGCTTCCAGGGGACTGTCACTGTGGACGCCAAAATGGCATAACTGAGATAAGGTGAATAAGTGACAAATA
2001 AAGCCAGTTTTTTACAAGGTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuuccCGAAG--GGAAACGUc 5'
                |:||:  |||||||| 
Target 5' acttttGTTTTAACCTTTGCAc 3'
 275 - 296 152.00 -10.20
2 
miRNA  3' cuUUCCCGAAGGGAAACGUc 5'
            ||||    : :|||||| 
Target 5' ccAAGG---ATGTTTTGCAg 3'
 1315 - 1331 127.00 -11.20
3 
miRNA  3' cuuuCCCGAAGGGAAACGUc 5'
              || :|| :|| |||| 
Target 5' ctgtGGATTTGTCTGTGCAc 3'
 620 - 639 124.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27362034 34 COSMIC
COSN31502347 34 COSMIC
COSN31593914 46 COSMIC
COSN30525076 47 COSMIC
COSN20045980 69 COSMIC
COSN15664096 77 COSMIC
COSN30118458 81 COSMIC
COSN31509114 82 COSMIC
COSN24300281 115 COSMIC
COSN28752567 118 COSMIC
COSN30516625 121 COSMIC
COSN31606684 165 COSMIC
COSN31530558 166 COSMIC
COSN15335358 271 COSMIC
COSN7816664 309 COSMIC
COSN16482796 340 COSMIC
COSN32055923 432 COSMIC
COSN28672795 451 COSMIC
COSN1912827 871 COSMIC
COSN32103756 1042 COSMIC
COSN17996590 1090 COSMIC
COSN32062613 1219 COSMIC
COSN25086385 1410 COSMIC
COSN29784435 1445 COSMIC
COSN31590348 1718 COSMIC
COSN28807811 1745 COSMIC
COSN31569661 1823 COSMIC
COSN28758472 1859 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs149719226 2 dbSNP
rs771626900 5 dbSNP
rs201402764 6 dbSNP
rs1438483999 11 dbSNP
rs760011525 12 dbSNP
rs367612187 13 dbSNP
rs775748772 14 dbSNP
rs896141039 16 dbSNP
rs770546366 19 dbSNP
rs1353898844 22 dbSNP
rs763169823 24 dbSNP
rs764428081 25 dbSNP
rs1197061032 27 dbSNP
rs1490955684 32 dbSNP
rs1222925694 35 dbSNP
rs773906142 36 dbSNP
rs1222643950 39 dbSNP
rs761982000 40 dbSNP
rs371677667 41 dbSNP
rs199580097 42 dbSNP
rs750349006 44 dbSNP
rs1444185343 46 dbSNP
rs756025949 47 dbSNP
rs779854182 48 dbSNP
rs1406933869 49 dbSNP
rs754254454 51 dbSNP
rs753575555 53 dbSNP
rs1400542113 56 dbSNP
rs995466144 59 dbSNP
rs1469573955 62 dbSNP
rs1376454278 63 dbSNP
rs1201571960 65 dbSNP
rs762338678 67 dbSNP
rs1249979942 69 dbSNP
rs765520317 70 dbSNP
rs905137984 71 dbSNP
rs1000764286 77 dbSNP
rs1258912360 79 dbSNP
rs562589014 82 dbSNP
rs1015145929 84 dbSNP
rs188029607 87 dbSNP
rs1262352907 95 dbSNP
rs373776469 95 dbSNP
rs965990256 100 dbSNP
rs1448308184 102 dbSNP
rs1377220391 115 dbSNP
rs544969592 116 dbSNP
rs560436975 129 dbSNP
rs1244836595 132 dbSNP
rs550872666 143 dbSNP
rs979074409 150 dbSNP
rs1156966755 154 dbSNP
rs527957943 155 dbSNP
rs750800839 156 dbSNP
rs1010074310 158 dbSNP
rs756380184 166 dbSNP
rs1183153850 170 dbSNP
rs1440902646 171 dbSNP
rs954895865 179 dbSNP
rs371960548 190 dbSNP
rs191388178 194 dbSNP
rs1062603 196 dbSNP
rs1349917661 207 dbSNP
rs1417273567 209 dbSNP
rs758822406 216 dbSNP
rs1283746496 217 dbSNP
rs561318023 225 dbSNP
rs529034560 228 dbSNP
rs919426585 238 dbSNP
rs1242231255 247 dbSNP
rs988329526 249 dbSNP
rs1401206454 258 dbSNP
rs929449438 264 dbSNP
rs918046566 269 dbSNP
rs779539434 275 dbSNP
rs949572804 277 dbSNP
rs1045331100 281 dbSNP
rs1162998599 291 dbSNP
rs926861432 295 dbSNP
rs1370389007 298 dbSNP
rs767159874 302 dbSNP
rs1188037381 303 dbSNP
rs550701450 316 dbSNP
rs982955372 320 dbSNP
rs568934098 321 dbSNP
rs751273660 325 dbSNP
rs150961248 326 dbSNP
rs778149068 332 dbSNP
rs887216599 338 dbSNP
rs1290462778 339 dbSNP
rs551365500 342 dbSNP
rs1207519963 345 dbSNP
rs780785141 351 dbSNP
rs140673880 353 dbSNP
rs1284372426 360 dbSNP
rs748028304 362 dbSNP
rs1340211768 366 dbSNP
rs533826501 372 dbSNP
rs555577162 373 dbSNP
rs1402466218 390 dbSNP
rs936608366 393 dbSNP
rs761305302 394 dbSNP
rs901705678 399 dbSNP
rs892297404 405 dbSNP
rs3172518 411 dbSNP
rs1009379721 413 dbSNP
rs1393177537 414 dbSNP
rs1163994021 430 dbSNP
rs997346686 431 dbSNP
rs533160192 433 dbSNP
rs1206750020 435 dbSNP
rs1195545451 436 dbSNP
rs1478129713 437 dbSNP
rs1268044806 438 dbSNP
rs1030848382 445 dbSNP
rs149666851 450 dbSNP
rs10934847 451 dbSNP
rs1194935525 458 dbSNP
rs1248060105 468 dbSNP
rs1315673927 473 dbSNP
rs72974054 474 dbSNP
rs1177452720 481 dbSNP
rs577688184 488 dbSNP
rs956490406 489 dbSNP
rs1421001411 494 dbSNP
rs963312404 511 dbSNP
rs566615202 513 dbSNP
rs183958635 517 dbSNP
rs1026541658 519 dbSNP
rs1465346784 525 dbSNP
rs1405108496 530 dbSNP
rs1172594527 535 dbSNP
rs1465900700 536 dbSNP
rs1324679463 538 dbSNP
rs1189328449 546 dbSNP
rs1478963499 547 dbSNP
rs77179747 551 dbSNP
rs950961806 553 dbSNP
rs1180443601 554 dbSNP
rs368828300 555 dbSNP
rs186996241 564 dbSNP
rs1239578834 567 dbSNP
rs757501143 569 dbSNP
rs1318968817 570 dbSNP
rs917673025 575 dbSNP
rs1308812996 579 dbSNP
rs971328978 582 dbSNP
rs868089354 584 dbSNP
rs917386485 595 dbSNP
rs1446077870 602 dbSNP
rs529083199 608 dbSNP
rs1374981636 610 dbSNP
rs765312210 615 dbSNP
rs535532352 623 dbSNP
rs192729981 626 dbSNP
rs72974055 633 dbSNP
rs1173673398 638 dbSNP
rs926285637 643 dbSNP
rs936282882 644 dbSNP
rs1157564988 651 dbSNP
rs750659660 652 dbSNP
rs542951220 654 dbSNP
rs1456168945 664 dbSNP
rs945275556 666 dbSNP
rs1042907 668 dbSNP
rs1444664945 669 dbSNP
rs890287321 678 dbSNP
rs1007604733 684 dbSNP
rs775556416 685 dbSNP
rs1351513190 691 dbSNP
rs1311547502 693 dbSNP
rs1184834693 698 dbSNP
rs35934174 700 dbSNP
rs145595955 703 dbSNP
rs568847478 704 dbSNP
rs1300910936 728 dbSNP
rs185146783 732 dbSNP
rs1449909902 736 dbSNP
rs899187103 741 dbSNP
rs994817375 744 dbSNP
rs1397059666 746 dbSNP
rs1050224076 752 dbSNP
rs889054410 764 dbSNP
rs1026720355 768 dbSNP
rs533035595 775 dbSNP
rs1330871789 783 dbSNP
rs1422929899 784 dbSNP
rs1014916885 785 dbSNP
rs1000750941 792 dbSNP
rs1024510516 803 dbSNP
rs1393177161 807 dbSNP
rs1411129792 810 dbSNP
rs1032253144 813 dbSNP
rs1310727119 814 dbSNP
rs11542441 817 dbSNP
rs375050841 818 dbSNP
rs756050751 819 dbSNP
rs1245515761 826 dbSNP
rs1487585016 829 dbSNP
rs1288305049 831 dbSNP
rs1217397100 834 dbSNP
rs566335012 835 dbSNP
rs1310789372 841 dbSNP
rs375384345 854 dbSNP
rs1315781210 855 dbSNP
rs926336538 868 dbSNP
rs534143695 869 dbSNP
rs1258270785 878 dbSNP
rs1362357874 881 dbSNP
rs970477334 883 dbSNP
rs1481440162 893 dbSNP
rs957705103 899 dbSNP
rs776699769 902 dbSNP
rs537416648 905 dbSNP
rs952971165 918 dbSNP
rs913542194 925 dbSNP
rs777610160 928 dbSNP
rs567510012 929 dbSNP
rs765722726 931 dbSNP
rs1052081304 934 dbSNP
rs140448386 938 dbSNP
rs555919815 953 dbSNP
rs867114608 956 dbSNP
rs922690991 958 dbSNP
rs1335712112 960 dbSNP
rs899283676 961 dbSNP
rs571442324 968 dbSNP
rs1050259957 972 dbSNP
rs1170458982 977 dbSNP
rs1364958193 985 dbSNP
rs1294757198 989 dbSNP
rs1458137799 993 dbSNP
rs1399048609 994 dbSNP
rs538737741 1002 dbSNP
rs1047761185 1003 dbSNP
rs886430309 1009 dbSNP
rs113896720 1014 dbSNP
rs369123550 1015 dbSNP
rs1433111708 1020 dbSNP
rs1265433128 1025 dbSNP
rs1054137756 1043 dbSNP
rs1469105786 1045 dbSNP
rs1301161076 1047 dbSNP
rs1196541821 1063 dbSNP
rs749102249 1066 dbSNP
rs970232372 1067 dbSNP
rs1001676017 1070 dbSNP
rs1232511694 1074 dbSNP
rs1396690365 1087 dbSNP
rs1042911 1090 dbSNP
rs1302812903 1091 dbSNP
rs1440947422 1092 dbSNP
rs957837705 1103 dbSNP
rs774100458 1106 dbSNP
rs1445036799 1108 dbSNP
rs34415187 1116 dbSNP
rs72010506 1116 dbSNP
rs913603147 1116 dbSNP
rs199538513 1119 dbSNP
rs1308890556 1121 dbSNP
rs1230535317 1127 dbSNP
rs1033378829 1136 dbSNP
rs1376397787 1146 dbSNP
rs1178363021 1152 dbSNP
rs1255068719 1160 dbSNP
rs1345044984 1165 dbSNP
rs1379922935 1178 dbSNP
rs1042912 1191 dbSNP
rs984285939 1196 dbSNP
rs1251031188 1200 dbSNP
rs1199632409 1206 dbSNP
rs1482251306 1214 dbSNP
rs1257637488 1221 dbSNP
rs987422362 1231 dbSNP
rs1234405352 1237 dbSNP
rs1335452837 1260 dbSNP
rs554981615 1263 dbSNP
rs1306453785 1265 dbSNP
rs1241945479 1266 dbSNP
rs1016288181 1267 dbSNP
rs911778203 1270 dbSNP
rs1395769868 1275 dbSNP
rs771677641 1282 dbSNP
rs1305039320 1285 dbSNP
rs534411327 1288 dbSNP
rs1435876498 1289 dbSNP
rs1360043413 1291 dbSNP
rs1441816373 1309 dbSNP
rs1430667617 1313 dbSNP
rs576780309 1315 dbSNP
rs762183655 1324 dbSNP
rs190076308 1336 dbSNP
rs1377315963 1338 dbSNP
rs1211597269 1351 dbSNP
rs1487915977 1357 dbSNP
rs920425292 1360 dbSNP
rs930777976 1367 dbSNP
rs1048240872 1368 dbSNP
rs886444313 1369 dbSNP
rs950071002 1379 dbSNP
rs754664012 1380 dbSNP
rs770213339 1394 dbSNP
rs1053598402 1396 dbSNP
rs1360411271 1398 dbSNP
rs73210934 1399 dbSNP
rs945275304 1400 dbSNP
rs906142963 1404 dbSNP
rs1001771040 1407 dbSNP
rs565459830 1409 dbSNP
rs573838409 1410 dbSNP
rs1370037487 1425 dbSNP
rs1001821029 1429 dbSNP
rs1010665278 1431 dbSNP
rs1021098770 1435 dbSNP
rs1352141535 1436 dbSNP
rs1447010236 1438 dbSNP
rs1006145069 1443 dbSNP
rs966413495 1444 dbSNP
rs987125054 1445 dbSNP
rs72974058 1446 dbSNP
rs1189881459 1447 dbSNP
rs560145932 1457 dbSNP
rs1340471877 1460 dbSNP
rs1266915904 1471 dbSNP
rs964637963 1474 dbSNP
rs1029917605 1481 dbSNP
rs954051514 1482 dbSNP
rs1322962423 1488 dbSNP
rs1385361803 1489 dbSNP
rs1396923343 1495 dbSNP
rs377179303 1496 dbSNP
rs985445985 1508 dbSNP
rs527297166 1518 dbSNP
rs1159687689 1524 dbSNP
rs1421407383 1526 dbSNP
rs548936662 1530 dbSNP
rs1346922646 1552 dbSNP
rs11542440 1555 dbSNP
rs567479104 1556 dbSNP
rs930434202 1561 dbSNP
rs1196090380 1567 dbSNP
rs983574658 1568 dbSNP
rs531487840 1571 dbSNP
rs1253183853 1572 dbSNP
rs1214718854 1577 dbSNP
rs1292774527 1580 dbSNP
rs907922489 1583 dbSNP
rs1442731971 1585 dbSNP
rs950150494 1587 dbSNP
rs1306633639 1604 dbSNP
rs913704249 1610 dbSNP
rs945194043 1611 dbSNP
rs777823464 1620 dbSNP
rs78722933 1639 dbSNP
rs1319305085 1640 dbSNP
rs1397916081 1642 dbSNP
rs937706406 1645 dbSNP
rs1410503954 1652 dbSNP
rs1219810896 1655 dbSNP
rs1424322073 1658 dbSNP
rs1170315543 1660 dbSNP
rs1455148085 1661 dbSNP
rs937612209 1662 dbSNP
rs1054681302 1673 dbSNP
rs1054689150 1675 dbSNP
rs888214273 1676 dbSNP
rs1236789607 1679 dbSNP
rs1207032264 1680 dbSNP
rs893321100 1693 dbSNP
rs1278477847 1699 dbSNP
rs1265295806 1701 dbSNP
rs1350061873 1704 dbSNP
rs1469195392 1706 dbSNP
rs1293974861 1711 dbSNP
rs1010790749 1720 dbSNP
rs138054164 1722 dbSNP
rs538402436 1726 dbSNP
rs1439125348 1728 dbSNP
rs998743255 1728 dbSNP
rs762028355 1735 dbSNP
rs902282911 1737 dbSNP
rs954250360 1740 dbSNP
rs1332031480 1741 dbSNP
rs1042995 1745 dbSNP
rs1177889603 1761 dbSNP
rs1375588984 1766 dbSNP
rs1157508032 1768 dbSNP
rs1008598847 1772 dbSNP
rs4572721 1775 dbSNP
rs4583592 1776 dbSNP
rs140601048 1778 dbSNP
rs1032975737 1790 dbSNP
rs1179343609 1812 dbSNP
rs1470685055 1813 dbSNP
rs1237416307 1816 dbSNP
rs1209424866 1818 dbSNP
rs1163797646 1827 dbSNP
rs957695818 1833 dbSNP
rs964311972 1837 dbSNP
rs988943185 1838 dbSNP
rs566133567 1839 dbSNP
rs1462830174 1840 dbSNP
rs1224131799 1843 dbSNP
rs1378253251 1844 dbSNP
rs1282202131 1848 dbSNP
rs1328807507 1850 dbSNP
rs1355981780 1859 dbSNP
rs974633249 1860 dbSNP
rs1027962644 1867 dbSNP
rs1159296880 1871 dbSNP
rs1413586730 1872 dbSNP
rs11542437 1884 dbSNP
rs1186215573 1885 dbSNP
rs536270010 1885 dbSNP
rs750600841 1887 dbSNP
rs927897862 1888 dbSNP
rs1484893982 1889 dbSNP
rs560280602 1896 dbSNP
rs1262560556 1900 dbSNP
rs951927509 1905 dbSNP
rs1321329130 1907 dbSNP
rs983719418 1908 dbSNP
rs907682741 1911 dbSNP
rs1227040155 1921 dbSNP
rs1234866137 1929 dbSNP
rs971513933 1940 dbSNP
rs1335852550 1945 dbSNP
rs554925605 1948 dbSNP
rs576840616 1958 dbSNP
rs1256368367 1959 dbSNP
rs1363542494 1961 dbSNP
rs1288918382 1970 dbSNP
rs1054722095 1971 dbSNP
rs1347714539 1974 dbSNP
rs1163251687 1975 dbSNP
rs756954092 1976 dbSNP
rs1463286586 1980 dbSNP
rs72974063 1983 dbSNP
rs1170677269 1985 dbSNP
rs941022187 1987 dbSNP
rs1205288894 1991 dbSNP
rs1264010064 1996 dbSNP
rs1406907872 1996 dbSNP
rs937288068 1996 dbSNP
rs1036807176 2009 dbSNP
rs1054723688 2010 dbSNP
rs1488299018 2021 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29927.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29927.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_013336 | 3UTR | UGUAACUUUUGUUUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_013336 | 3UTR | UUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_013336 | 3UTR | GUUUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_013336 | 3UTR | AUGUAACUUUUGUUUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_013336 | 3UTR | UUGUUUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_013336 | 3UTR | AACUUUUGUUUUAACCUUUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000243253.3 | 3UTR | UUUAACCUUUGCACCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000243253.3 | 3UTR | GUUUUAACCUUUGCACCUUCUCAGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000243253.3 | 3UTR | GUUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000243253.3 | 3UTR | UUUUAACCUUUGCACCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.754 1.0e-5 0.765 6.7e-6 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.493 8.4e-3 -0.442 1.7e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.347 2.6e-2 0.286 5.6e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.414 3.5e-2 0.080 3.7e-1 20 Click to see details
GSE28544 Breast cancer 0.322 6.2e-2 0.578 1.5e-3 24 Click to see details
GSE28260 Renal cortex and medulla -0.375 1.0e-1 -0.060 4.2e-1 13 Click to see details
GSE38226 Liver fibrosis 0.266 1.2e-1 0.227 1.6e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.067 3.8e-1 -0.047 4.1e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.02 4.3e-1 0.025 4.1e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.439 0.28 0.400 0.3 4 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
HNSC -0.185 0.44 0.500 0.33 3 Click to see details
152 hsa-miR-518a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004667 MCL1 MCL1, BCL2 family apoptosis regulator 3 1
MIRT060823 CEP350 centrosomal protein 350 2 2
MIRT072482 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT076138 WDR81 WD repeat domain 81 2 2
MIRT076233 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT082391 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT090336 SEC61A1 Sec61 translocon alpha 1 subunit 2 8
MIRT091943 ZBTB47 zinc finger and BTB domain containing 47 2 6
MIRT092025 ABHD5 abhydrolase domain containing 5 2 6
MIRT095381 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT142423 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT149875 LDLR low density lipoprotein receptor 2 2
MIRT168656 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT178931 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT179070 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT193027 TMOD3 tropomodulin 3 2 8
MIRT195757 ATMIN ATM interactor 2 6
MIRT210001 LIMD1 LIM domains containing 1 2 2
MIRT211285 ANKRD50 ankyrin repeat domain 50 2 2
MIRT217608 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT230978 PRRG4 proline rich and Gla domain 4 2 2
MIRT248250 SP1 Sp1 transcription factor 2 2
MIRT249362 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT257798 CDC5L cell division cycle 5 like 2 4
MIRT267984 UCK2 uridine-cytidine kinase 2 2 2
MIRT301220 SH3BP4 SH3 domain binding protein 4 2 2
MIRT312573 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT315532 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT343048 ABHD2 abhydrolase domain containing 2 2 2
MIRT442635 TBC1D12 TBC1 domain family member 12 2 2
MIRT443425 MAPT microtubule associated protein tau 2 2
MIRT444153 ZNF701 zinc finger protein 701 2 2
MIRT444501 ZNF525 zinc finger protein 525 2 2
MIRT445203 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT447064 MCC mutated in colorectal cancers 2 4
MIRT448126 CCDC80 coiled-coil domain containing 80 2 2
MIRT460408 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT462941 ZNF800 zinc finger protein 800 2 12
MIRT463576 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT466375 TGOLN2 trans-golgi network protein 2 2 4
MIRT469271 RHOB ras homolog family member B 2 8
MIRT469301 RGS16 regulator of G protein signaling 16 2 2
MIRT469804 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470063 PTGES2 prostaglandin E synthase 2 2 2
MIRT470994 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT474951 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT475189 IMPDH1P11 inosine monophosphate dehydrogenase 1 pseudogene 11 2 6
MIRT475864 H3F3C H3 histone family member 3C 2 10
MIRT475898 H3F3B H3 histone family member 3B 2 8
MIRT481940 ANKRD11 ankyrin repeat domain 11 2 2
MIRT485556 FOXQ1 forkhead box Q1 2 2
MIRT491004 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492192 SOCS1 suppressor of cytokine signaling 1 2 4
MIRT493272 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT495273 NICN1 nicolin 1 2 4
MIRT495675 PRKD3 protein kinase D3 2 2
MIRT497541 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT500398 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500484 ZBTB4 zinc finger and BTB domain containing 4 2 6
MIRT500586 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 2 4
MIRT500635 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501641 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT501769 NRBF2 nuclear receptor binding factor 2 2 6
MIRT503666 SLC46A1 solute carrier family 46 member 1 2 2
MIRT504322 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT505177 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT506341 NUP54 nucleoporin 54 2 6
MIRT506435 NACC2 NACC family member 2 2 2
MIRT506667 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT510974 PFN2 profilin 2 2 6
MIRT511142 MRPL17 mitochondrial ribosomal protein L17 2 8
MIRT512601 EFCAB1 EF-hand calcium binding domain 1 2 4
MIRT521037 SLC30A4 solute carrier family 30 member 4 2 2
MIRT525736 SOD2 superoxide dismutase 2 2 2
MIRT526751 GAS7 growth arrest specific 7 2 2
MIRT526903 ZNF772 zinc finger protein 772 2 6
MIRT527346 FAM69C family with sequence similarity 69 member C 2 2
MIRT531901 GLP2R glucagon like peptide 2 receptor 2 2
MIRT532367 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT534253 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534744 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT535341 PFN1 profilin 1 2 2
MIRT535972 MESDC1 talin rod domain containing 1 2 2
MIRT536508 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT536885 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT537039 GRAMD4 GRAM domain containing 4 2 2
MIRT537425 FBXL7 F-box and leucine rich repeat protein 7 2 2
MIRT544578 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT546423 SNX5 sorting nexin 5 2 2
MIRT546754 RLIM ring finger protein, LIM domain interacting 2 2
MIRT547985 HCFC2 host cell factor C2 2 4
MIRT548408 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT549445 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549671 ZNF598 zinc finger protein 598 2 2
MIRT550526 MYZAP myocardial zonula adherens protein 2 2
MIRT551214 CIDEC cell death inducing DFFA like effector c 2 2
MIRT552307 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552430 ZNF460 zinc finger protein 460 2 2
MIRT553198 UBE2A ubiquitin conjugating enzyme E2 A 2 2
MIRT553337 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT554807 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555180 PRUNE2 prune homolog 2 2 2
MIRT556151 MECP2 methyl-CpG binding protein 2 2 2
MIRT557863 FGFR1OP FGFR1 oncogene partner 2 2
MIRT562085 KIAA0895 KIAA0895 2 2
MIRT563332 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT565309 TMEM41A transmembrane protein 41A 2 2
MIRT566135 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT567024 KLHL15 kelch like family member 15 2 2
MIRT567242 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT568560 AKAP10 A-kinase anchoring protein 10 2 2
MIRT570683 FZD5 frizzled class receptor 5 2 2
MIRT572221 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT573305 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT575743 Zfp618 zinc finger protein 618 1 1
MIRT613461 B3GNT6 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 2 2
MIRT614734 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT615118 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT623238 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623487 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623990 FAM104A family with sequence similarity 104 member A 2 2
MIRT624011 EPHB1 EPH receptor B1 2 2
MIRT626278 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT631416 CRLS1 cardiolipin synthase 1 2 4
MIRT641135 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT647830 RAB23 RAB23, member RAS oncogene family 2 2
MIRT649064 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT650284 PYCARD PYD and CARD domain containing 2 2
MIRT651512 WNT4 Wnt family member 4 2 2
MIRT651852 UNC5D unc-5 netrin receptor D 2 2
MIRT652215 TRIM33 tripartite motif containing 33 2 2
MIRT654704 PRRC2B proline rich coiled-coil 2B 2 2
MIRT656793 KNTC1 kinetochore associated 1 2 2
MIRT656926 KIAA1462 junctional cadherin 5 associated 2 2
MIRT659158 DCTN5 dynactin subunit 5 2 2
MIRT663086 METTL10 EEF1A lysine methyltransferase 2 2 2
MIRT676044 AUTS8 Autism, susceptibility to, 8 2 2
MIRT680129 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT689531 KIAA0513 KIAA0513 2 2
MIRT691474 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT692505 SPIN4 spindlin family member 4 2 2
MIRT702405 KITLG KIT ligand 2 2
MIRT704532 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT714231 ARMC10 armadillo repeat containing 10 2 2
MIRT718761 HOOK3 hook microtubule tethering protein 3 2 2
MIRT725422 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT732176 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 4 1
MIRT732272 CCL2 C-C motif chemokine ligand 2 2 1
MIRT732706 GZMB granzyme B 3 0
MIRT735791 CCR6 C-C motif chemokine receptor 6 3 0
MIRT756341 MMP2 matrix metallopeptidase 2 2 1
MIRT756342 MMP9 matrix metallopeptidase 9 2 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-518a-5p (-)-eburnamonine 71203 NSC322920 sensitive
hsa-miR-518a-5p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-518a-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-518a-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-518a-5p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-518a-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-518a-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-518a-5p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-518a-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-518a-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-518a-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-518a-5p (3Z)-1,1-dimethyl-3-[5-sulfanylidene-4-[(3,4,5-trimethoxyphenyl)methyl]-1,2,4-dithiazolidin-3-ylidene]thiourea 5914108 NSC645621 sensitive
hsa-miR-518a-5p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-518a-5p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-518a-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-518a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-518a-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-518a-5p (5E)-3-(4-chlorophenyl)-5-[(3-phenoxyphenyl)methylidene]-2-phenyl-1,3-thiazolidin-4-one 5470253 NSC699081 sensitive
hsa-miR-518a-5p (5E)-3-(4-methoxyphenyl)-1,1-dioxo-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470267 NSC699095 sensitive
hsa-miR-518a-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-518a-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-518a-5p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-518a-5p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-518a-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-518a-5p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-518a-5p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-518a-5p (8R,9S,13S,14S,17S)-13-methyl-2-(2,2,2-trifluoroethoxy)-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-3,17-diol 386444 NSC678473 sensitive
hsa-miR-518a-5p (8R,9S,13S,14S,17S)-3,17-dihydroxy-13-methyl-2-(2,2,2-trifluoroethoxy)-8,9,11,12,14,15,16,17-octahydro-7H-cyclopenta[a]phenanthren-6-one 387663 NSC681684 sensitive
hsa-miR-518a-5p (e)-1-(2,5-dimethoxyphenyl)-3-(2-fluoro-4,5-dihydroxyphenyl)prop-2-en-1-one 5471282 NSC710266 sensitive
hsa-miR-518a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-518a-5p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-518a-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-518a-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-518a-5p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-518a-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-518a-5p (E)-3-(6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 50908742 NSC750743 sensitive
hsa-miR-518a-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-518a-5p (E)-N-ethyl-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enamide 5388754 NSC638409 sensitive
hsa-miR-518a-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-518a-5p (z) 3,3',4,5-tetramethoxystilbene 5388774 NSC638492 sensitive
hsa-miR-518a-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-518a-5p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-518a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-518a-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-518a-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-518a-5p [(8R,9S,13S,14S)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] [(8S,9R,13R,14R)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] sulfite;ethyl acetate 389907 NSC686560 sensitive
hsa-miR-518a-5p [(E)-[3-(methylamino)pyridin-2-yl]methylideneamino]thiourea 9555629 NSC266748 resistant
hsa-miR-518a-5p [1-[[(2-amino-6-chloropyrimidin-4-yl)amino]methyl]-3-(2-phenylethyl)cyclobutyl]methanol 385232 NSC676345 sensitive
hsa-miR-518a-5p [3-(4-fluorophenyl)-8,9-dimethyl-2-oxo-5H-pyrano[3,2-c]chromen-5-yl] acetate 45113107 NSC747825 sensitive
hsa-miR-518a-5p [3,4,5-triacetyloxy-6-(1-cyano-2-sulfanylidene-4-thiophen-2-yl-5,6-dihydrobenzo[f]isoquinolin-3-yl)oxan-2-yl]methyl acetate 386291 NSC678049 sensitive
hsa-miR-518a-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-518a-5p [4-amino-2-[(4-methoxyphenyl)amino]thiazol-5-yl]-(2-furyl)methanone 399017 NSC709438 sensitive
hsa-miR-518a-5p [5-(n-[(z)-n-(dimethylcarbamothioyl)-c-methylsulfanylcarbonimidoyl]anilino)-1,2,4-dithiazol-3-ylidene]-dimethylazanium;iodide 9569862 NSC622588 sensitive
hsa-miR-518a-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-518a-5p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-518a-5p 1-(1-naphthylmethylene)-4-(1-naphthyl)semicarbazide 5859414 NSC680931 sensitive
hsa-miR-518a-5p 1-(2-naphthylmethyl)-4-[1-(2-naphthylmethyl)-4-piperidyl]piperidine hydrochloride 393913 NSC696885 sensitive
hsa-miR-518a-5p 1-(3-methoxyphenyl)-4-phenyl-[1,2,4]triazolo[4,3-a]quinoxaline 399100 NSC709516 sensitive
hsa-miR-518a-5p 1-(4-chlorophenyl)-1'-methyl-3,3-diphenylspiro[azetidine-4,3'-indole]-2,2'-dione 16096361 NSC737780 sensitive
hsa-miR-518a-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-518a-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-518a-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-518a-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-518a-5p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-518a-5p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-518a-5p 1-[2-(3-chlorophenyl)-2-oxoethyl]-2-acetylbenzimidazole 46911792 NSC748533 sensitive
hsa-miR-518a-5p 1-[4-[(1,3-dihydroxy-2-methylpropan-2-yl)amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406504 NSC724631 sensitive
hsa-miR-518a-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-518a-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-hex-1-ynyl-6-iodopyrimidine-2,4-dione 45028649 NSC743556 sensitive
hsa-miR-518a-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-518a-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 sensitive
hsa-miR-518a-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-518a-5p 11h-benzo[a]carbazole-1,4-dione, 7,11-dimethyl- 371271 NSC645330 sensitive
hsa-miR-518a-5p 15-phenyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 135426789 NSC718581 sensitive
hsa-miR-518a-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-518a-5p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-518a-5p 1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) NSC659162 sensitive
hsa-miR-518a-5p 2',6'-dibromo-2-(methoxymethyl)spiro[7,8-dihydro-6h-thieno[3,2-g]quinoline-5,4'-cyclohexa-2,5-diene]-1',4,9-trione 375900 NSC656211 sensitive
hsa-miR-518a-5p 2-(1-methylindol-3-yl)-4-(1-methylpyrrolo[2,3-b]pyridin-3-yl)-1,3-thiazole 60147980 NSC753377 sensitive
hsa-miR-518a-5p 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachlorobenzohydrazide 402423 NSC716354 sensitive
hsa-miR-518a-5p 2-(2-naphthyl)-5-methyl-1,8-naphthyridin-4(1h)-one 386570 NSC679018 sensitive
hsa-miR-518a-5p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-518a-5p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 sensitive
hsa-miR-518a-5p 2-(4-bromophenyl)-1,3-dichloro-5,6-dimethoxy-1h-indene 360785 NSC623166 sensitive
hsa-miR-518a-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-518a-5p 2-(4-hydroxy-3,5-dimethoxyphenyl)-9,9-dimethyl-5,8,10,14,16-pentaoxatetracyclo[9.7.0.03,7.013,17]octadeca-1(18),3(7),11,13(17)-tetraen-4-one 382068 NSC669382 sensitive
hsa-miR-518a-5p 2-(4-methoxyphenyl)-4-(1-methylpyrrolo[2,3-b]pyridin-3-yl)-1,3-thiazole 54613605 NSC749862 sensitive
hsa-miR-518a-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-518a-5p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-518a-5p 2-(6-bromo-2-chloroquinolin-3-yl)-2-[(4-methoxyphenyl)amino]acetamide 402332 NSC716223 sensitive
hsa-miR-518a-5p 2-(8-(4-methoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl)hydrazinecarboxamide NSC667911 sensitive
hsa-miR-518a-5p 2-(naphthalen-2-ylamino)-1,2-diphenylethanone 411561 NSC34924 sensitive
hsa-miR-518a-5p 2-(trifluoromethyl)benzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383194 NSC671313 sensitive
hsa-miR-518a-5p 2-[(2-aminophenyl)sulfanylmethyl]-3-methoxy-xanthen-9-one 330512 NSC319447 sensitive
hsa-miR-518a-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-518a-5p 2-[(dimethylamino)methyl]-1-(2-methylphenyl)prop-2-en-1-one;hydrochloride 13958695 NSC382002 sensitive
hsa-miR-518a-5p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 sensitive
hsa-miR-518a-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-518a-5p 2-[[(e)-(4-methoxyphenyl)iminocarbamoyl]amino]-4-methyl-pentanamide 390563 NSC688071 sensitive
hsa-miR-518a-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-518a-5p 2-[2-(4-chlorobenzoyl)benzimidazol-1-yl]-1-(4-methoxyphenyl)ethanone 45029097 NSC745455 sensitive
hsa-miR-518a-5p 2-[2-[(e)-[2-(2-hydroxy-1h-indol-3-yl)indol-3-ylidene]amino]oxyethoxy]-6-(hydroxymethyl)oxane-3,4,5-triol 135436306 NSC717859 resistant
hsa-miR-518a-5p 2-[2-[(E)-benzylideneamino]-6-phenylpyrimidin-4-yl]-4-chlorophenol 135509207 NSC678883 resistant
hsa-miR-518a-5p 2-[4-[5-(3,4-dimethoxyphenyl)imidazol-1-yl]phenyl]-5,7-dimethoxy-1,3-benzothiazole 60147635 NSC751902 sensitive
hsa-miR-518a-5p 2-[5-(2,2-dimethyl-1,3-dioxolan-4-yl)-2,2-dimethyl-1,3-dioxolan-4-yl]-6-methoxy-3-nitro-2H-chromene 358300 NSC618261 sensitive
hsa-miR-518a-5p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-518a-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-518a-5p 2-amino-4-(2-hydroxy-4-methylphenyl)-5-phenylpyrimidine 392744 NSC693547 sensitive
hsa-miR-518a-5p 2-amino-5-[[5-amino-3,4-dicyano-1-(4-fluorophenyl)pyrrol-2-yl]disulfanyl]-1-(4-fluorophenyl)pyrrole-3,4-dicarbonitrile 396951 NSC704171 sensitive
hsa-miR-518a-5p 2-benzylsulfanyl-1-(4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)imidazole 45027957 NSC740259 sensitive
hsa-miR-518a-5p 2-chloro-5,8-dihydroxy-3-(4-nitrophenoxy)naphthalene-1,4-dione 135409136 NSC658872 sensitive
hsa-miR-518a-5p 2-ethyl-n-phenyl-5,6,7,8-tetrahydrothieno[2,3-b]quinolin-4-amine 365483 NSC633116 sensitive
hsa-miR-518a-5p 2-ethylaminoestradiol 384235 NSC673652 sensitive
hsa-miR-518a-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-518a-5p 2-isoquinolin-2-ium-2-yl-1-phenanthren-3-ylethanone;iodide 5351160 NSC35489 sensitive
hsa-miR-518a-5p 2-methoxy-3-{[3-(4-methoxyphenyl)-3,3a,4,5-tetrahydro-2h-benzo[g]indazol-2-yl]sulfonyl}benzoic acid 403620 NSC718688 sensitive
hsa-miR-518a-5p 2-methoxy-4-(7-methyl-6-(4-morpholinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 380573 NSC666223 sensitive
hsa-miR-518a-5p 2-methyl-1-[10-[(2-methylquinolin-4-yl)amino]decyl]quinolin-1-ium-4-amine;chloride;hydrochloride 387885 NSC682096 sensitive
hsa-miR-518a-5p 2-methyl-5-nitro-n-[4-(5-phenyl-4,5-dihydro-1,2-oxazol-3-yl)phenyl]benzenesulfonamide 402358 NSC716270 sensitive
hsa-miR-518a-5p 2-n-[3-(diethylaminomethyl)-4-methoxyphenyl]-4-n-[4-(dimethylamino)cyclohexyl]quinazoline-2,4-diamine;hydrochloride 54610390 NSC174030 sensitive
hsa-miR-518a-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(4-methoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028705 NSC743874 sensitive
hsa-miR-518a-5p 2-naphthalen-2-yl-1h-[1,8]naphthyridin-4-one 386569 NSC679017 sensitive
hsa-miR-518a-5p 2-phenyl-3-(1-piperidyl)-4-[?]yl-thietane 1,1-dioxide 421543 NSC135371 sensitive
hsa-miR-518a-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-518a-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-518a-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-518a-5p 2,3-dibenzoyloxy-4-hydroxy-4-oxobutanoate;(2,5-dimethylphenyl)-(4-methylphenyl)-phenylsulfanium 5351228 NSC116693 sensitive
hsa-miR-518a-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-518a-5p 2,5-dibenzyl-2-undecyloctahydro-1h-pyrrolo[3,4-c]pyridin-2-ium bromide 378731 NSC661832 sensitive
hsa-miR-518a-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-518a-5p 2,6-epoxy-2h-1-benzoxocin-5(6h)-one, 6,8-dimethyl- 434882 NSC359892 sensitive
hsa-miR-518a-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-518a-5p 2,7-bis(methoxycarbonylmethyl)-10-methylphenothiazine 384444 NSC674225 sensitive
hsa-miR-518a-5p 3-(2-quinolyl)-6-(3,4,5-trimethoxyphenyl)pyridine-2,4-diol 135429924 NSC612223 sensitive
hsa-miR-518a-5p 3-(3-fluorophenyl)-n-pyridin-3-yl-2h-pyrazolo[3,4-d][1,3]thiazol-5-amine 60147811 NSC752461 sensitive
hsa-miR-518a-5p 3-(4-chlorophenoxy)-4-[4-(2-dimethylaminoethyloxy)phenyl]-7-methoxy-chromen-2-one 395152 NSC699452 sensitive
hsa-miR-518a-5p 3-(4-methoxy-2-methylphenyl)naphthol [2,1-c]furan-1(3h)-one 369148 NSC640735 sensitive
hsa-miR-518a-5p 3-(4-methoxyphenyl)-1-[(e)-2-(2-thienyl)vinyl]pyrazino[1,2-a]benzimidazole 5471218 NSC709480 sensitive
hsa-miR-518a-5p 3-(4-methoxyphenyl)-1-methylidene-2-phenylpyrazino[1,2-a]benzimidazole 390235 NSC687527 sensitive
hsa-miR-518a-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-518a-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-518a-5p 3-acetyl-3a-chloro-5,11b-dihydroxy-2-methyl-1-(4-methylphenyl)naphtho[2,3-g]indole-6,11-dione 405625 NSC722995 sensitive
hsa-miR-518a-5p 3-chloroindolo[2,1-b]quinazoline-6,12-dione 396706 NSC703315 sensitive
hsa-miR-518a-5p 3-chloropyrido[1,2-a]benzimidazole-1,4-dicarbonitrile 378325 NSC660334 sensitive
hsa-miR-518a-5p 3-methyl-5-[(2,3,4,5,6-pentafluorophenyl)-[2,3,5,6-tetrafluoro-4-[(3-methyl-1,2-oxazol-5-yl)methyl]phenyl]methyl]-1,2-oxazole 380224 NSC665700 sensitive
hsa-miR-518a-5p 3-nitro-n-[2-[2-[(3-nitroacridin-9-yl)amino]phenyl]phenyl]acridin-9-amine 3694250 NSC645158 sensitive
hsa-miR-518a-5p 3-oxospiro[1H-indene-2,6'-2,3,5,7-tetrahydro-1H-s-indacene]-4'-carboxylic acid 384728 NSC674964 sensitive
hsa-miR-518a-5p 3-phenyl-4-[(e)-(3,4,5-trimethoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556392 NSC702400 sensitive
hsa-miR-518a-5p 3-pyridinecarboxamide, n-[3-(phenylsulfonyl)-2-thienyl]- 393673 NSC696049 sensitive
hsa-miR-518a-5p 3,19-(4-acetamido)benzylidineandrographolide 54612901 NSC747452 sensitive
hsa-miR-518a-5p 3,4,7-trichloro-n,n-bis(2-chloroethyl)-11-oxobenzo[d][1,3,6,2]benzodioxathiaphosphocin-11-amine 382835 NSC670664 sensitive
hsa-miR-518a-5p 3,8-dimethyl-1,2-naphthoquinone 373912 NSC650935 sensitive
hsa-miR-518a-5p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-518a-5p 4-(2-oxo-2-phenylethoxy)-2h-1-benzopyran-2-one 386272 NSC678029 resistant
hsa-miR-518a-5p 4-(3h-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl acetate 384820 NSC675272 sensitive
hsa-miR-518a-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-518a-5p 4-(5-(4-(hydroxy(oxido)amino)phenyl)-2-furyl)-2-(4-toluidino)-1,3-thiazole 367868 NSC638034 sensitive
hsa-miR-518a-5p 4-(dimethylamino)-9-ethyl-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 397883 NSC706739 sensitive
hsa-miR-518a-5p 4-[(4-bromophenyl)diazenyl]benzene-1,3-diol NSC402590 sensitive
hsa-miR-518a-5p 4-[(4z)-5-oxo-4-[(4-phenoxyphenyl)methylidene]-2-phenylimidazol-1-yl]-n-(1,3-thiazol-2-yl)benzenesulfonamide 5472414 NSC718649 sensitive
hsa-miR-518a-5p 4-[(e)-2-[3-(3-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613026 NSC750039 sensitive
hsa-miR-518a-5p 4-[(e)-2-[3-(4-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613025 NSC750038 sensitive
hsa-miR-518a-5p 4-[(z)-indolo[1,2-b]indazol-11-ylidenemethyl]-n,n-dimethylaniline 5472473 NSC719163 sensitive
hsa-miR-518a-5p 4-[2-[4-[3-(4-chlorophenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399072 NSC709483 sensitive
hsa-miR-518a-5p 4-[2-[4-[3-(4-methoxyphenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399071 NSC709482 sensitive
hsa-miR-518a-5p 4-[3-[5-[2-(4-carboxyphenyl)prop-2-enyl]-1,3-dimethyl-2,4,6-trioxo-1,3-diazinan-5-yl]prop-1-en-2-yl]benzoic acid 24205530 NSC736104 sensitive
hsa-miR-518a-5p 4-[4-(3-methoxyphenyl)piperazin-1-yl]-5H-pyrrolo[3,2-d]pyrimidine 155815900 NSC754824 sensitive
hsa-miR-518a-5p 4-[6-(4-fluoro-3-phenoxyphenyl)-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazol-3-yl]phenol 135585388 NSC726267 resistant
hsa-miR-518a-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-518a-5p 4-benzyl-1-(2-chlorophenyl)-[1,2,4]triazolo[4,3-a]quinoxaline 46945878 NSC761676 sensitive
hsa-miR-518a-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-518a-5p 4-methylsulfanyl-N-[(3,4,5-trimethoxyphenyl)methyl]aniline 373808 NSC650772 sensitive
hsa-miR-518a-5p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-518a-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-518a-5p 4-thiomorpholinecarbodithioic acid, antimony complex NSC625497 sensitive
hsa-miR-518a-5p 4,5,15,16-tetraphenyl-10-(2,4,6-triphenylpyridin-1-ium-1-yl)-3,6,14,17-tetraoxa-23-azatricyclo[17.3.1.18,12]tetracosa-1(23),8(24),9,11,19,21-hexaen-24-olate 16129807 NSC674178 sensitive
hsa-miR-518a-5p 5-(dithiolan-3-yl)-N-(3-methoxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl)pentanamide 24205571 NSC736179 sensitive
hsa-miR-518a-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-[2-(4-fluorophenyl)ethyl]-2-methoxybenzamide 403660 NSC718728 sensitive
hsa-miR-518a-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-hexyl-2-methoxybenzamide 403659 NSC718727 sensitive
hsa-miR-518a-5p 5-[2-[3-phenylpropyl(propyl)amino]ethyl]-1,3-dihydrobenzimidazole-2-thione 3005423 NSC699427 sensitive
hsa-miR-518a-5p 5-[3-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374830 NSC762542 sensitive
hsa-miR-518a-5p 5-[5-(5-formyl-4-propyl-1h-pyrrol-2-yl)-2-thienyl]-3-propyl-1h-pyrrole-2-carbaldehyde 374810 NSC653147 sensitive
hsa-miR-518a-5p 5-{[2-(cyclobutylcarbonyl)-6-methoxy-1,2,3,4,5,8-hexahydroisoquinolin-1-yl]methyl}-2-methoxyphenol 401790 NSC715520 sensitive
hsa-miR-518a-5p 5-acetylspiro[1,3-dihydroindene-2,6'-2,3,5,7-tetrahydro-s-indacene]-1'-one 382730 NSC670408 sensitive
hsa-miR-518a-5p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-518a-5p 5-chroman-6-yl-2-(4-pyridyl)oxazole 380226 NSC665702 sensitive
hsa-miR-518a-5p 5-fluoro-2-deoxycytidine 240980 NSC48006 resistant
hsa-miR-518a-5p 5-hydroxy-3-phenylpyrano[3,2-c]chromen-2(5h)-one 24205741 NSC736555 sensitive
hsa-miR-518a-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-518a-5p 5,5,6'-trimethyl-3-phenylspiro[1,3-oxazolidine-4,2'-chromene]-2-thione 392265 NSC692406 sensitive
hsa-miR-518a-5p 5a-methoxy-9-(2-methoxyphenyl)-5a,6,8a,9-tetrahydro-8h-[1,3]dioxolo[4,5-g]furo[3,4-b]chromen-8-one 380086 NSC665484 sensitive
hsa-miR-518a-5p 6-(2-hydroxyethyl)indeno[1,2-c]isoquinoline-5,11-dione 334474 NSC339705 resistant
hsa-miR-518a-5p 6-bromo-1-(4-methylphenyl)sulfonyl-2,3-dihydroquinolin-4-one 395752 NSC700552 sensitive
hsa-miR-518a-5p 6-chloro-1-(2-nitrophenyl)sulfonyl-3,4-dihydro-2h-quinoline 380120 NSC665522 sensitive
hsa-miR-518a-5p 6-chloro-3-[(Z)-[2-(4-methoxyphenyl)benzimidazol-5-ylidene]methyl]-1H-indol-2-ol 155806854 NSC763703 sensitive
hsa-miR-518a-5p 6,6-dimethyl-1-[3-[(3-nitrophenyl)methoxy]phenyl]-1,3,5-triazine-2,4-diamine 419053 NSC109836 sensitive
hsa-miR-518a-5p 6,7-dimethyl-5,8-diazatetracyclo[10.2.2.02,11.04,9]hexadeca-2,4,6,8,10,13-hexaene-3,10-diol 135409115 NSC658387 sensitive
hsa-miR-518a-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-518a-5p 7-[(2-methoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148267 NSC754073 sensitive
hsa-miR-518a-5p 7-[(3-fluorophenyl)methoxy]-9-[(3-fluorophenyl)methyl]-2-[(4-fluorophenyl)methyl]-1-methylpyrido[3,4-b]indol-2-ium 54766740 NSC760181 sensitive
hsa-miR-518a-5p 7-benzyl-3-[(e)-3-oxo-3-phenylprop-1-enyl]-16-thia-2,4,5,7-tetrazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10(15)-tetraen-8-one 45028585 NSC743396 sensitive
hsa-miR-518a-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-518a-5p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-518a-5p 7,16-bis((2-methoxy-1-naphthyl)methyl)-1,4,10,13-tetraoxa-7,16-diazacyclooctadecane 374351 NSC651922 sensitive
hsa-miR-518a-5p 7,17-dimethoxy-10,14-dithia-3,12-diaza-1-azoniapentacyclo[11.7.0.03,11.04,9.015,20]icosa-1(13),4(9),5,7,11,15(20),16,18-octaene;iodide 404661 NSC721084 sensitive
hsa-miR-518a-5p 8-(1,3-benzodioxol-5-yl)-3-methoxy-2,5,12,14-tetraoxatetracyclo[7.7.0.03,7.011,15]hexadeca-1(16),9,11(15)-trien-6-one 380098 NSC665496 sensitive
hsa-miR-518a-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-518a-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-518a-5p 8-benzyl-1-phenyl-3-oxa-1,8-diazaspiro[4.5]decan-4-one 380263 NSC665741 sensitive
hsa-miR-518a-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-518a-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-518a-5p 9-(2,4-dimethoxyphenyl)-6,9-dihydro-8h-[1,3]dioxolo[4,5-g]furo[3,4-b]chromen-8-one 380092 NSC665490 sensitive
hsa-miR-518a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 sensitive
hsa-miR-518a-5p 9-[2-(2,5-dimethylpyrrol-1-yl)phenyl]-7-hydroxy-5,6-di(propan-2-yloxy)-3-oxa-1-azatricyclo[6.3.1.04,12]dodeca-4,6,8(12),10-tetraen-2-one 389261 NSC685014 sensitive
hsa-miR-518a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 sensitive
hsa-miR-518a-5p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-518a-5p 9,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 378584 NSC661224 sensitive
hsa-miR-518a-5p A15655 262000 NSC95170 sensitive
hsa-miR-518a-5p Acetic acid, [1,4,7,10-tetraazacyclododecane-1,7-diyl]bis 387352 NSC681105 sensitive
hsa-miR-518a-5p Aminothiadiazines 135550831 NSC742088 sensitive
hsa-miR-518a-5p Artelasticin 5471311 NSC710342 sensitive
hsa-miR-518a-5p Azur i 68275 NSC9598 sensitive
hsa-miR-518a-5p Baccharin 5358645 NSC269757 sensitive
hsa-miR-518a-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-518a-5p Benzyl (2r)-1-[3-methyl-2-[methyl-[3-methyl-2-[methyl-[(2s)-2-[methyl-[(2r)-3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]-3-phenylpropanoyl]amino]butanoyl]amino]butanoyl]pyrrolidin 54608164 NSC653627 sensitive
hsa-miR-518a-5p Benzyl (2s)-2-[methyl-[(2s)-1-[(2s)-3-methyl-2-[methyl-[3-methyl-2-[methyl-[(2s)-3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]butanoyl]amino]butanoyl]pyrrolidine-2-carbonyl]amino]- 6712043 NSC653624 sensitive
hsa-miR-518a-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-518a-5p Benzyl 3-methyl-2-[methyl-[2-[methyl-[3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]-3-phenylpropanoyl]amino]butanoate 375406 NSC655092 sensitive
hsa-miR-518a-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-518a-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-518a-5p Bromocriptine methanesulfonate 31100 NSC169774 sensitive
hsa-miR-518a-5p C12h8n2o2s 3838042 NSC675587 sensitive
hsa-miR-518a-5p C22h12f6o6s2 389883 NSC686511 sensitive
hsa-miR-518a-5p Caracemide 54747 NSC253272 sensitive
hsa-miR-518a-5p Carbon monoxide; cyclopentane; 1-ethoxy-3a-methyl-azulen-4-one; iron 499038 NSC649307 sensitive
hsa-miR-518a-5p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-518a-5p Chloroplatinum(1+); 2-diphenylphosphanyl-n,n-dimethyl-ethanamine 499568 NSC685470 sensitive
hsa-miR-518a-5p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-518a-5p Cuspidatin c 5459164 NSC636859 sensitive
hsa-miR-518a-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-518a-5p Dichlorobisoxinatotitanium(iv) NSC635157 sensitive
hsa-miR-518a-5p Diethyl 2-((4-(((3-chloro-2-phenyl-6-quinoxalinyl)methyl)amino)benzoyl)amino)pentanedioate 373186 NSC649150 sensitive
hsa-miR-518a-5p Diethyl 2-[[4-[3-phenyl-6-(trifluoromethyl)quinoxalin-2-yl]oxybenzoyl]amino]pentanedioate 390814 NSC688816 resistant
hsa-miR-518a-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-518a-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-518a-5p Dimethyl (E)-2-(2,4,6,8-tetramethylazulen-1-yl)but-2-enedioate 5468210 NSC666123 sensitive
hsa-miR-518a-5p Dromostanolone propionate 224004 NSC12198 sensitive
hsa-miR-518a-5p Eh00008 354026 NSC603974 sensitive
hsa-miR-518a-5p Ethyl (E)-3-(6-methoxy-1-thiophen-3-yl-3,4-dihydronaphthalen-2-yl)prop-2-enoate 24205739 NSC736553 sensitive
hsa-miR-518a-5p Ethyl 1-[2-oxo-2-[(4-oxo-6-phenoxy-3-phenylquinazolin-7-yl)amino]ethyl]piperidine-4-carboxylate 54613378 NSC747174 sensitive
hsa-miR-518a-5p Ethyl 1-methyl-5-[(1-methyl-5-nitroindole-2-carbonyl)amino]indole-2-carboxylate 24204472 NSC732001 resistant
hsa-miR-518a-5p Ethyl 4-[[(5s,5as)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-5-yl]amino]piperidine-1-carboxylate;hydrochloride 375038 NSC653864 resistant
hsa-miR-518a-5p Ethyl 4,5,15,16-tetramethoxy-10-azatetracyclo[7.7.1.02,7.013,17]heptadeca-1,3,5,7,9(17),13,15-heptaene-10-carboxylate 285758 NSC143241 sensitive
hsa-miR-518a-5p Ethyl 6-methyl-2-(4-methylbenzyl)-1-oxo-2-indanecarboxylate 382681 NSC670329 sensitive
hsa-miR-518a-5p Geldanamycin analog 5358467 NSC255104 sensitive
hsa-miR-518a-5p Glemyyhyohrblt-uhfffaoysa-n 381505 NSC668261 sensitive
hsa-miR-518a-5p Go-y103 1352182 NSC677240 sensitive
hsa-miR-518a-5p Gsk718429a 44587530 NSC756188 sensitive
hsa-miR-518a-5p Gw794607x 9604926 NSC756355 sensitive
hsa-miR-518a-5p Herveline o 5459269 NSC676002 sensitive
hsa-miR-518a-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-518a-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-518a-5p Indanthren corinth rk 5351878 NSC74702 sensitive
hsa-miR-518a-5p Inostamycin 368135 NSC638478 sensitive
hsa-miR-518a-5p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-518a-5p Iron;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578853 NSC633270 sensitive
hsa-miR-518a-5p Ixabepilone 6445540 NSC747973 sensitive
hsa-miR-518a-5p J3.572.907k 396709 NSC703318 sensitive
hsa-miR-518a-5p Juncusol deriv (compound 1) 24200489 NSC378135 sensitive
hsa-miR-518a-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-518a-5p Kuc100204 378309 NSC660313 sensitive
hsa-miR-518a-5p Kuc100232 381132 NSC667449 sensitive
hsa-miR-518a-5p L-alpha-aminobutyric acid 1573 NSC659853 sensitive
hsa-miR-518a-5p Lapachone 3885 NSC629749 sensitive
hsa-miR-518a-5p Lmpk12050091 165203 NSC646923 sensitive
hsa-miR-518a-5p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-518a-5p Ls-41225 57787 NSC664951 sensitive
hsa-miR-518a-5p Lychnopholide 49767028 NSC669145 sensitive
hsa-miR-518a-5p M-232 403374 NSC718170 sensitive
hsa-miR-518a-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-518a-5p Mecal 67686 NSC150555 sensitive
hsa-miR-518a-5p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-518a-5p Methyl-[2-methyl-2-(4-methylphenyl)propyl]-diphenylphosphanium;iodide 20835892 NSC176098 sensitive
hsa-miR-518a-5p Methyl (2E)-2-methoxyimino-2-[2-[[2-(trifluoromethyl)phenoxy]methyl]phenyl]acetate 6520923 NSC720765 sensitive
hsa-miR-518a-5p Methyl (2s,3s)-2-(4-hydroxyphenyl)-5-[(e)-3-methoxy-3-oxoprop-1-enyl]-2,3-dihydro-1-benzofuran-3-carboxylate 5468718 NSC675006 sensitive
hsa-miR-518a-5p Methyl (e)-3-[2-[[methyl-(4-methylphenyl)-oxo-lambda6-sulfanylidene]amino]phenyl]prop-2-enoate 24202623 NSC716715 sensitive
hsa-miR-518a-5p Methyl (E)-4-[4,5-dichloro-2-[2-[methyl-[(1S,2S)-2-pyrrolidin-1-ylcyclohexyl]amino]-2-oxoethyl]anilino]-4-oxobut-2-enoate 54611534 NSC707465 sensitive
hsa-miR-518a-5p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 sensitive
hsa-miR-518a-5p Methyl 2-((1-oxo-1,2,3,5,6,7-hexahydro-s-indacen-2-yl)methyl)benzoate 382689 NSC670337 sensitive
hsa-miR-518a-5p Methyl 2-(2,3-dihydro-1H-inden-5-ylmethyl)-1-oxo-3,6,7,8-tetrahydro-as-indacene-2-carboxylate 385670 NSC677016 sensitive
hsa-miR-518a-5p Methyl 2-[(1r,2r,6s,7s)-3,5-dithiatricyclo[5.2.1.02,6]dec-8-en-4-ylidene]-1,3-dithiole-4-carboxylate 403847 NSC719381 sensitive
hsa-miR-518a-5p Methyl 2-[6-(4-aminobenzoyl)-1,3-benzodioxol-5-yl]acetate 404212 NSC720379 sensitive
hsa-miR-518a-5p Methyl 4-[(e)-(5-methyl-2-phenylpyrazol-3-yl)iminomethyl]benzoate 9572413 NSC715229 sensitive
hsa-miR-518a-5p Methyl 4-methyl-2-((6-methyl-1-oxo-2,3-dihydro-1h-inden-2-yl)methyl)benzoate 385695 NSC677041 sensitive
hsa-miR-518a-5p Methyl 7-oxospiro[1,2,3,5-tetrahydro-s-indacene-6,6'-2,3,5,7-tetrahydro-1h-s-indacene]-4'-carboxylate 382665 NSC670313 sensitive
hsa-miR-518a-5p Methyl N-(4-chlorophenyl)sulfonyl-N'-[3-[[[(4-chlorophenyl)sulfonylamino]-methylsulfanylmethylidene]amino]propyl]carbamimidothioate 382843 NSC670673 sensitive
hsa-miR-518a-5p Methyl n-[6-[(4-fluorophenyl)sulfonylamino]-1h-benzimidazol-2-yl]carbamate 404125 NSC720248 sensitive
hsa-miR-518a-5p Mitomycin 281834 NSC134727 resistant
hsa-miR-518a-5p N'-(4-chloroanilino)pyrazine-2-carboximidamide 9572225 NSC709079 sensitive
hsa-miR-518a-5p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-518a-5p N'-[8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]-4-methylbenzenesulfonohydrazide 383134 NSC671175 sensitive
hsa-miR-518a-5p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-518a-5p N-(3-hydroxy-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-6-yl)acetamide 374007 NSC651081 sensitive
hsa-miR-518a-5p N-(4-((4-anilino-1-benzyl-4-piperidinyl)ethynyl)-1-benzyl-4-piperidinyl)-n-phenylamine 379997 NSC665299 sensitive
hsa-miR-518a-5p N-(4-(1-adamantyl)-1,3-thiazol-2-yl)-7-hydroxy-2-oxo-2h-chromene-3-carboxamide 5466102 NSC675799 sensitive
hsa-miR-518a-5p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-518a-5p N-[4-chloro-2-(2-chlorobenzoyl)phenyl]-2-(4-pyridin-2-ylpiperazin-1-yl)acetamide 24206025 NSC737733 sensitive
hsa-miR-518a-5p N-[6'-(diethylamino)-3-oxospiro[2-benzofuran-1,9'-xanthene]-2'-yl]-N-phenylacetamide 389678 NSC686130 sensitive
hsa-miR-518a-5p N-anthracen-2-yl-8-chloro-5,5-dioxoimidazo[1,2-b][1,4,2]benzodithiazine-7-carboxamide 403255 NSC717956 sensitive
hsa-miR-518a-5p N-dam 152320 NSC653499 sensitive
hsa-miR-518a-5p N-methyl-1,5-bis(4-cyanophenoxy)-3-aza-pentane 45028719 NSC743907 sensitive
hsa-miR-518a-5p N,N-diethyl-4-[[4-(4-methylimidazo[4,5-b]pyridin-2-yl)phenyl]diazenyl]aniline;hydroiodide 366879 NSC635922 sensitive
hsa-miR-518a-5p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-518a-5p Nabor orange r 135436499 NSC4434 sensitive
hsa-miR-518a-5p Naphtho[2,3-f]quinoxaline-7,12-dione, 3-hydroxy-2-methyl- 371563 NSC645892 resistant
hsa-miR-518a-5p Neuro_000286 3004220 NSC636984 sensitive
hsa-miR-518a-5p None 12201866 NSC179207 sensitive
hsa-miR-518a-5p NSC310547 NSC310547 sensitive
hsa-miR-518a-5p NSC600301 NSC600301 sensitive
hsa-miR-518a-5p NSC621339 NSC621339 sensitive
hsa-miR-518a-5p NSC625492 NSC625492 sensitive
hsa-miR-518a-5p NSC657270 NSC657270 sensitive
hsa-miR-518a-5p NSC658455 NSC658455 sensitive
hsa-miR-518a-5p NSC676495 NSC676495 resistant
hsa-miR-518a-5p NSC699071 NSC699071 sensitive
hsa-miR-518a-5p NSC750717 NSC750717 sensitive
hsa-miR-518a-5p NSC751830 NSC751830 resistant
hsa-miR-518a-5p O-[5-(6-benzamidopurin-9-yl)-2-[[tert-butyl(dimethyl)silyl]oxymethyl]oxolan-3-yl] methylsulfanylmethanethioate 356579 NSC613002 sensitive
hsa-miR-518a-5p Paullone analog 47 396411 NSC702373 sensitive
hsa-miR-518a-5p Phenyl-[2-[2,3,4,5-tetrachloro-6-(5-phenyl-1,3,4-oxadiazol-2-yl)phenyl]-3h-benzimidazol-5-yl]methanone 402241 NSC716132 sensitive
hsa-miR-518a-5p Phosphonium, (3-bromopropyl)triphenyl- bromide 2723862 NSC84074 sensitive
hsa-miR-518a-5p Prumycin 5458561 NSC278619 resistant
hsa-miR-518a-5p Regid_for_cid_289745 289745 NSC151982 sensitive
hsa-miR-518a-5p Rozex 5280954 NSC15628 sensitive
hsa-miR-518a-5p Rsc002586 399616 NSC710525 sensitive
hsa-miR-518a-5p Simvastatin 54454 NSC633782 approved resistant
hsa-miR-518a-5p Spiro[3,6,7,8-tetrahydro-1h-cyclopenta[a]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5',9-dione 382635 NSC670284 sensitive
hsa-miR-518a-5p Spiro[as-indacene-2(1h),2'(1'h)-[s]indacen]-1-one, 4'-acetyl-3,3',5',6,6',7,7',8-octahydro- 385658 NSC677004 sensitive
hsa-miR-518a-5p Spiropitan 5265 NSC170983 resistant
hsa-miR-518a-5p Stk366297 242249 NSC50648 sensitive
hsa-miR-518a-5p Stk673166 NSC717468 sensitive
hsa-miR-518a-5p Stk766820 381153 NSC667471 sensitive
hsa-miR-518a-5p Stl323035 383655 NSC672073 sensitive
hsa-miR-518a-5p Stl338719 393017 NSC694265 resistant
hsa-miR-518a-5p Streptonigrin analog (meo-n3) 494043 NSC81052 sensitive
hsa-miR-518a-5p Sudan red 11980862 NSC11241 sensitive
hsa-miR-518a-5p Tannic acid 16134267 NSC758670 resistant
hsa-miR-518a-5p Tetraoxo[?]dione 388215 NSC682809 sensitive
hsa-miR-518a-5p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 sensitive
hsa-miR-518a-5p Thioperoxydicarbonic diamide, tetramethyl- 5455 NSC622696 sensitive
hsa-miR-518a-5p Tolonium chloride 7083 NSC36758 sensitive
hsa-miR-518a-5p Tp4ek NSC676497 resistant
hsa-miR-518a-5p Tributyrin 6050 NSC661583 sensitive
hsa-miR-518a-5p Triciribine phosphate 43860 NSC280594 resistant
hsa-miR-518a-5p Triphenyl(2-triphenylphosphaniumylethyl)phosphanium 2785216 NSC64111 sensitive
hsa-miR-518a-5p Tunicamycin 16727450 NSC177382 resistant
hsa-miR-518a-5p Ver a 5351232 NSC126728 sensitive
hsa-miR-518a-5p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-518a-5p Z198955462 135528004 NSC744178 sensitive
hsa-miR-518a-5p Z28714792 2671841 NSC746248 sensitive
hsa-miR-518a-5p Zinc pyrithione NSC68093 sensitive
hsa-miR-518a-5p Imatinib 5291 NSC743414 approved sensitive Low Gastrointestinal Stromal Tumor tissue and cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-518a-5p Ponatinib 24826799 NSC758487 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-518a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-518a-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-518a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-518a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-518a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-518a-5p Sunitinib 5329102 NSC750690 approved sensitive tissue
hsa-miR-518a-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-518a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-518a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission