miRTarBase - #MIRT092698


—
pre-miRNA Information
pre-miRNA hsa-mir-6074   
Genomic Coordinates chr12: 66023620 - 66023726
Description Homo sapiens miR-6074 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6074
Sequence 58| GAUAUUCAGAGGCUAGGUGG |77
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1488787926 3 dbSNP
rs939973609 9 dbSNP
rs1388151331 16 dbSNP
rs1362255472 17 dbSNP
rs1384033658 18 dbSNP
rs909868825 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C3orf38   
Synonyms -
Description chromosome 3 open reading frame 38
Transcript NM_173824   
Expression
Putative miRNA Targets on C3orf38
3'UTR of C3orf38
(miRNA target sites are highlighted)		 
>C3orf38|NM_173824|3'UTR
   1 GGTAGTGGAAATGAGACATTGCTGAACAAAAGAGAACTGGGTTTACCTGACCCTCTAAAGCGCTAAGTACTGTCAGCCTG
  81 AAAAAAATCTTCTATACAGAAACTCTTCCAAATACTATATCAGTAATGTCTGAATGATTTCAGATGTGAAAATTGACATA
 161 TTTTAGTTGAAATACCTTTCTGGACTACAGACTTACATATCATGTGAATACTTACCTATTTCTACCCGAGTTGCAGCAAG
 241 TATTCTGAAAGCTTAATGCAAATAAATCCCACTTTAGATCTTACAGCTAACTGTGTGCCTTAGAAACCAGGTAATATTTT
 321 CCTTTTACTTAGTGAATATTCTGCTAATATCTGCACTTTTCATGTGGGAAAGGATTAATAATGGTCCAGGCTTCCCCTCT
 401 TTAAGTTTCATGTTTACTTTTGTCTAACTCTGGATAATTGTATTTTACAAATGCATCTCACTGTAGTATATTTTTAAAAC
 481 TATTAAATATTTTAGAGATGTTTAACGTAAACTCAAAGTTCTCATTTTAGAAAATTTAAATAACATTCTTTTTGCAAAAA
 561 AGTCCAATAATTTAACAGTTGAAGAAAAACTTACTACCTCTTTAAAGATTTGAGAAACATTTTTCAAAGTTATCAGCTGT
 641 AGTCCAAGCTAAATATCTTTTGTAATCTGCAACATTTTCCTTACTGTTTTTGGGCAGTGATAAATGCTGTTCTCGAAATA
 721 GACTTTATTCTTACCTAGGCTTCAGACAACAGTTTTATAGAGCAGTTACTGTAATACAATATAAAGGAAATATGCTGTTG
 801 AAATTTTAAAGGTATGCCCAGTTCCTAACTTTTAAACGAATTACCGTTCTTCCTCTTGGCTGATCTTGGCAGAGATGACA
 881 AAAAAAACCCCAAAACAACCCATGCATGTATAATGTGTGTATACACATATACATAAGTATACATATACTCCCACATTATA
 961 ACTTAGAATATTTAGTTTTTTACCTGTTACTAGGTTTGAGTTACATGGTTGAGTTGCCAAATTATTTACATGCTTTGTTT
1041 AAATTCTTCATCACCTAGCAACTGTTTGCTGATCATGGATTTACTTAGTTACTTTAATTTATAAAATTACCATTTGGAAA
1121 AGAACTCAATTGGGAAATGTGATGACGTATTGTACATGTTACTTTTTCCTTTGCTATAATCATCTAGGGAGACTGATAAG
1201 AATTTTGGAAATGGGAGCCTGGAAACTCATCTTTGTTTTTTTAATGCTATGCCTCTTACGAGGAATACGAATTGGTATGT
1281 CCTAAAATAAGAACTTAATAAAGGAGGGAAATCCCTTTTGTCTGCTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
1361 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
1441 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggUGGAUCGGAGACUUAUAg 5'
            ||:|||    ||||||| 
Target 5' ttACTTAG----TGAATATt 3'
 325 - 340 152.00 -9.60
2 
miRNA  3' ggUGGAUCGGAGACUUAUag 5'
            ::|||  |||||:|||  
Target 5' ttGTCTA-ACTCTGGATAat 3'
 420 - 438 125.00 -12.30
3 
miRNA  3' ggUGG--AUCGGAGACUUA-UAg 5'
            |:|  || : ||||||| || 
Target 5' atATCAGTAATGTCTGAATGATt 3'
 117 - 139 124.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30102540 16 COSMIC
COSN26968677 38 COSMIC
COSN1283085 62 COSMIC
COSN30143747 86 COSMIC
COSN30109575 95 COSMIC
COSN30459625 122 COSMIC
COSN28202271 173 COSMIC
COSN28202269 214 COSMIC
COSN28202254 233 COSMIC
COSN28202270 254 COSMIC
COSN28202267 306 COSMIC
COSN28202261 371 COSMIC
COSN28202268 496 COSMIC
COSN28202255 511 COSMIC
COSN7715660 516 COSMIC
COSN28202250 804 COSMIC
COSN30030758 899 COSMIC
COSN7715661 1024 COSMIC
COSN27267718 1323 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753043969 4 dbSNP
rs1238994031 6 dbSNP
rs1334549804 9 dbSNP
rs375832169 17 dbSNP
rs1333520830 18 dbSNP
rs1405542192 21 dbSNP
rs192135826 22 dbSNP
rs371947917 24 dbSNP
rs1412494635 28 dbSNP
rs201228824 34 dbSNP
rs1358860350 42 dbSNP
rs113250573 49 dbSNP
rs1452937745 54 dbSNP
rs1378466153 57 dbSNP
rs1179966287 59 dbSNP
rs574978125 62 dbSNP
rs1242077119 63 dbSNP
rs7427416 64 dbSNP
rs1314883893 73 dbSNP
rs542420870 75 dbSNP
rs1226661773 77 dbSNP
rs1298222981 79 dbSNP
rs1204976661 80 dbSNP
rs1344127485 81 dbSNP
rs891494160 93 dbSNP
rs1240898485 94 dbSNP
rs553555418 95 dbSNP
rs998250774 100 dbSNP
rs543854564 109 dbSNP
rs1450431525 117 dbSNP
rs1341351312 118 dbSNP
rs1334547403 120 dbSNP
rs545373957 127 dbSNP
rs563774940 147 dbSNP
rs531493812 152 dbSNP
rs1016694027 155 dbSNP
rs1384100819 158 dbSNP
rs1160989567 160 dbSNP
rs1201706531 166 dbSNP
rs116765324 168 dbSNP
rs562019757 169 dbSNP
rs1427387847 182 dbSNP
rs1193168747 185 dbSNP
rs1161331331 192 dbSNP
rs1265918835 202 dbSNP
rs1218027170 203 dbSNP
rs1359409381 205 dbSNP
rs148554289 209 dbSNP
rs1230153858 214 dbSNP
rs1025503787 215 dbSNP
rs1451724827 219 dbSNP
rs377012355 222 dbSNP
rs1338168245 226 dbSNP
rs566823081 228 dbSNP
rs763630589 229 dbSNP
rs1394732509 236 dbSNP
rs993235457 237 dbSNP
rs1024397775 238 dbSNP
rs527813597 246 dbSNP
rs1166987704 247 dbSNP
rs1477025643 264 dbSNP
rs1426194479 266 dbSNP
rs1194911785 269 dbSNP
rs1490326638 273 dbSNP
rs970515590 285 dbSNP
rs577504187 287 dbSNP
rs145577723 293 dbSNP
rs1452265499 300 dbSNP
rs926130295 308 dbSNP
rs1217067824 310 dbSNP
rs1320321781 311 dbSNP
rs936139194 319 dbSNP
rs989094617 331 dbSNP
rs913482389 356 dbSNP
rs1273022059 363 dbSNP
rs1437929107 374 dbSNP
rs933673742 376 dbSNP
rs1231835921 385 dbSNP
rs570897720 387 dbSNP
rs1302362380 389 dbSNP
rs182154896 400 dbSNP
rs1051166615 408 dbSNP
rs1312522152 409 dbSNP
rs889556622 413 dbSNP
rs1258570314 420 dbSNP
rs1485298239 423 dbSNP
rs775056859 428 dbSNP
rs1193445483 442 dbSNP
rs751297208 444 dbSNP
rs1205135341 460 dbSNP
rs1249208200 462 dbSNP
rs1466603666 464 dbSNP
rs1232341489 466 dbSNP
rs147736141 467 dbSNP
rs1459245997 468 dbSNP
rs1038067732 471 dbSNP
rs898363773 477 dbSNP
rs1311415299 497 dbSNP
rs1252809923 498 dbSNP
rs993954804 506 dbSNP
rs1025557642 507 dbSNP
rs1368282142 508 dbSNP
rs1307885233 512 dbSNP
rs1434106338 517 dbSNP
rs896356255 529 dbSNP
rs1378568788 532 dbSNP
rs1362206420 541 dbSNP
rs1465809144 542 dbSNP
rs1357813360 544 dbSNP
rs1178740838 550 dbSNP
rs1415523104 556 dbSNP
rs1407966705 560 dbSNP
rs1014266540 562 dbSNP
rs1441641771 567 dbSNP
rs568754561 580 dbSNP
rs1183256982 582 dbSNP
rs1482422935 586 dbSNP
rs1254006976 596 dbSNP
rs1212049307 597 dbSNP
rs1312698894 598 dbSNP
rs9826925 608 dbSNP
rs1309472835 609 dbSNP
rs1395059447 615 dbSNP
rs1376578937 628 dbSNP
rs1390788421 636 dbSNP
rs773627370 662 dbSNP
rs970063403 663 dbSNP
rs1360386895 666 dbSNP
rs980620541 669 dbSNP
rs767190440 689 dbSNP
rs1438673575 692 dbSNP
rs1421548781 695 dbSNP
rs763332723 696 dbSNP
rs1325111829 701 dbSNP
rs1380962504 715 dbSNP
rs554374609 716 dbSNP
rs545198732 720 dbSNP
rs1258616752 723 dbSNP
rs1183317057 725 dbSNP
rs1483461096 727 dbSNP
rs957563183 735 dbSNP
rs749963946 736 dbSNP
rs988937543 738 dbSNP
rs1355812098 742 dbSNP
rs1286083586 743 dbSNP
rs6781333 747 dbSNP
rs934207874 749 dbSNP
rs545535481 751 dbSNP
rs1228499838 753 dbSNP
rs1314433177 754 dbSNP
rs557328228 756 dbSNP
rs986500812 762 dbSNP
rs1340331044 764 dbSNP
rs575586615 770 dbSNP
rs942368996 772 dbSNP
rs76582253 782 dbSNP
rs1489012194 787 dbSNP
rs1370355228 791 dbSNP
rs1165773962 794 dbSNP
rs929815455 795 dbSNP
rs1422609236 796 dbSNP
rs1191298139 816 dbSNP
rs1489222002 834 dbSNP
rs1262421866 839 dbSNP
rs1208657120 840 dbSNP
rs546505611 846 dbSNP
rs368445546 847 dbSNP
rs1316975245 855 dbSNP
rs1013899320 856 dbSNP
rs1023536921 858 dbSNP
rs1341608370 860 dbSNP
rs1414344317 867 dbSNP
rs1459926190 873 dbSNP
rs1301206114 875 dbSNP
rs1385100207 880 dbSNP
rs905891537 881 dbSNP
rs1231565302 888 dbSNP
rs1001532077 889 dbSNP
rs191782505 894 dbSNP
rs749017143 901 dbSNP
rs1372201392 902 dbSNP
rs111576255 905 dbSNP
rs955548941 907 dbSNP
rs987489167 908 dbSNP
rs754845971 920 dbSNP
rs1213835790 921 dbSNP
rs1353092845 922 dbSNP
rs1457040831 928 dbSNP
rs1255767827 932 dbSNP
rs1200853574 934 dbSNP
rs550565121 942 dbSNP
rs1255878902 944 dbSNP
rs1231666028 945 dbSNP
rs911471607 949 dbSNP
rs1232077346 965 dbSNP
rs777857040 974 dbSNP
rs540845828 978 dbSNP
rs1289805765 987 dbSNP
rs964091007 990 dbSNP
rs1255718031 1018 dbSNP
rs559619907 1019 dbSNP
rs146271889 1068 dbSNP
rs1250017134 1076 dbSNP
rs560077016 1093 dbSNP
rs1171834863 1120 dbSNP
rs117216688 1123 dbSNP
rs1379370638 1129 dbSNP
rs929700879 1130 dbSNP
rs1254242043 1131 dbSNP
rs1474270718 1134 dbSNP
rs1181296588 1136 dbSNP
rs1046900924 1147 dbSNP
rs567283358 1148 dbSNP
rs1438083650 1149 dbSNP
rs182500670 1150 dbSNP
rs1255874037 1151 dbSNP
rs1199152373 1153 dbSNP
rs1425449299 1155 dbSNP
rs1281671252 1156 dbSNP
rs917768751 1157 dbSNP
rs949237207 1158 dbSNP
rs1333259691 1163 dbSNP
rs1394076946 1170 dbSNP
rs1404197347 1172 dbSNP
rs1174211655 1177 dbSNP
rs1418520646 1182 dbSNP
rs1377909633 1183 dbSNP
rs771154966 1185 dbSNP
rs1159979687 1213 dbSNP
rs1470298832 1223 dbSNP
rs187156027 1230 dbSNP
rs1444502959 1231 dbSNP
rs1258770416 1236 dbSNP
rs905068460 1243 dbSNP
rs1430154266 1249 dbSNP
rs1001542184 1250 dbSNP
rs550174500 1260 dbSNP
rs1300867957 1261 dbSNP
rs116049896 1269 dbSNP
rs536182921 1270 dbSNP
rs1399296720 1278 dbSNP
rs547667726 1282 dbSNP
rs1230579376 1304 dbSNP
rs563741056 1310 dbSNP
rs1400787261 1316 dbSNP
rs1341979011 1328 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 285237.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 285237.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000486971.1 | 3UTR | AUAUUCUGCUAAUAUCUGCACUUUUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000486971.1 | 3UTR | AAUAUUCUGCUAAUAUCUGCACUUUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000486971.1 | 3UTR | AAUAUUCUGCUAAUAUCUGCACUUUUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000486971.1 | 3UTR | AAUAUUCUGCUAAUAUCUGCACUUUUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000486971.1 | 3UTR | AAUAUUCUGCUAAUAUCUGCACUUUUCAUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
80 hsa-miR-6074 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058706 SLC16A1 solute carrier family 16 member 1 2 2
MIRT089462 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT092698 C3ORF38 chromosome 3 open reading frame 38 2 6
MIRT096831 ZSWIM6 zinc finger SWIM-type containing 6 2 6
MIRT097124 TNPO1 transportin 1 2 2
MIRT107230 ZBTB34 zinc finger and BTB domain containing 34 2 8
MIRT166796 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 4
MIRT169322 CD2AP CD2 associated protein 2 2
MIRT179021 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT216040 IL6ST interleukin 6 signal transducer 2 10
MIRT229145 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT232247 SLC38A1 solute carrier family 38 member 1 2 6
MIRT235585 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT249602 MPP5 membrane palmitoylated protein 5 2 2
MIRT265086 CHEK1 checkpoint kinase 1 2 2
MIRT290931 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT297112 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT334773 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT344563 RPL23A ribosomal protein L23a 2 6
MIRT450908 CADM2 cell adhesion molecule 2 2 2
MIRT450941 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT456350 OLIG3 oligodendrocyte transcription factor 3 2 8
MIRT466898 STMN1 stathmin 1 2 2
MIRT470106 PTEN phosphatase and tensin homolog 2 2
MIRT471430 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT477745 EDN1 endothelin 1 2 2
MIRT478210 DDX6 DEAD-box helicase 6 2 2
MIRT481531 ARL5B ADP ribosylation factor like GTPase 5B 2 10
MIRT482888 CACNA2D3 calcium voltage-gated channel auxiliary subunit alpha2delta 3 2 2
MIRT486468 MDM2 MDM2 proto-oncogene 2 10
MIRT500286 ZNF703 zinc finger protein 703 2 8
MIRT502857 CHEK2 checkpoint kinase 2 2 6
MIRT504355 VCAM1 vascular cell adhesion molecule 1 2 8
MIRT508279 ADCYAP1 adenylate cyclase activating polypeptide 1 2 8
MIRT508529 PTCH2 patched 2 2 6
MIRT509772 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT512269 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 4
MIRT514050 AGO2 argonaute 2, RISC catalytic component 2 6
MIRT516648 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT520093 YAF2 YY1 associated factor 2 2 4
MIRT520451 TSPAN2 tetraspanin 2 2 6
MIRT521920 PHIP pleckstrin homology domain interacting protein 2 6
MIRT523959 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT526799 ZNF223 zinc finger protein 223 2 2
MIRT530972 EXO5 exonuclease 5 2 4
MIRT532117 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT532816 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT534742 RBFOX2 RNA binding protein, fox-1 homolog 2 2 4
MIRT545935 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546348 TBCEL tubulin folding cofactor E like 2 2
MIRT547260 NUMB NUMB, endocytic adaptor protein 2 2
MIRT548232 FGF2 fibroblast growth factor 2 2 4
MIRT549926 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550268 GNL3 G protein nucleolar 3 2 4
MIRT553955 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT555238 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT555699 PDZD8 PDZ domain containing 8 2 2
MIRT556135 MFSD9 major facilitator superfamily domain containing 9 2 4
MIRT556233 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT558033 EXT1 exostosin glycosyltransferase 1 2 2
MIRT561374 UBXN2B UBX domain protein 2B 2 2
MIRT563066 ZNF28 zinc finger protein 28 2 4
MIRT565175 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT567586 FCHSD2 FCH and double SH3 domains 2 2 2
MIRT568006 COMMD2 COMM domain containing 2 2 2
MIRT611487 ADCYAP1R1 ADCYAP receptor type I 2 6
MIRT614959 HOMER1 homer scaffolding protein 1 2 2
MIRT619721 FCF1 FCF1, rRNA-processing protein 2 2
MIRT643215 TYW3 tRNA-yW synthesizing protein 3 homolog 2 2
MIRT654746 PRKCB protein kinase C beta 2 2
MIRT657189 IKZF5 IKAROS family zinc finger 5 2 2
MIRT699133 SMNDC1 survival motor neuron domain containing 1 2 2
MIRT707311 KCNK1 potassium two pore domain channel subfamily K member 1 2 2
MIRT707405 VENTX VENT homeobox 2 2
MIRT707490 XKR6 XK related 6 2 2
MIRT707787 UNK unkempt family zinc finger 2 2
MIRT711246 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT718746 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT723779 ROBO4 roundabout guidance receptor 4 2 2
MIRT724949 TXNL1 thioredoxin like 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6074 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6074 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-6074 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission