miRTarBase - #MIRT093395


—
pre-miRNA Information
pre-miRNA hsa-mir-3942   
Genomic Coordinates chr15: 35372256 - 35372364
Description Homo sapiens miR-3942 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3942-3p
Sequence 65| UUUCAGAUAACAGUAUUACAU |85
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 15 - 35372296 29233923 MiREDiBase
A-to-I 10 15 - 35372291 23291724, 29233923 MiREDiBase
A-to-I 18 15 - 35372283 23291724, 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN1674243 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1043666670 6 dbSNP
rs1264147291 18 dbSNP
rs1223363654 20 dbSNP
Putative Targets

Gene Information
Gene Symbol TMA16   
Synonyms C4orf43
Description translation machinery associated 16 homolog
Transcript NM_018352   
Expression
Putative miRNA Targets on TMA16
3'UTR of TMA16
(miRNA target sites are highlighted)		 
>TMA16|NM_018352|3'UTR
   1 TTGTCTTCACTTGAATTGAAAATAAATAATTTGAGAGCTTCAAATTATATTCATTGATTATGGTACCTAATTGTCATGAT
  81 ACAAAAATTTGATACTGACATTCTCTTATATGATGAGAGTTTCATTTGCGTTTCAAAAATGGTGTTATGATACTTATTTT
 161 AAAATGAAGATTGCTTTTCATTTCCATTAAGTTGCTAAAATAGATAGATGTGATCTGCAGAAGTTGTTTAGTCTTCATCT
 241 GAATTTCAGGCTGGGAGGGAGCAATATAACTAAGGACAAAAAATGTTTTGTTTTTCTTGTGTATTTATGATCACCTAATT
 321 TCACGTTTTGTGAAATGGACAGTAACCTGTTTCCTGAAAGATTCCTGTGGGTACTTTTTGAGCTGTGATAATAGCAAAAT
 401 TGTTTTTCGGTAATAATATCACACTAATGCTTCTTTTAAACATTAAACCTATTTTCCTTTTTTACAGAATAAGGGAAAAT
 481 GTGATAAGAAGTTTGTATACATTTCTGGATTATAGATTATTATTTATCTTTTGAACCAGAGCTAAATGGTAAAAGAAAAA
 561 AAATCAGTGATGATTGTTATGTTGATCTCCCACAATTAATTTATCTTTTGACAAAGGGGATAAAGAGTTTCAGTTTAGCT
 641 CCTTTTGATTGTATATTATTTTTTGCTTTTTTATTGTGAAAAGAGGTAGGTTTTATTTGTGGAGAGAGAGTTGAAGATTA
 721 GGGAACCAGTGATTTTAATTATGCTACTTTTTCTTCTAAGAGATAAATTGATATATCATTCAGTGTCATGAAAAACATGA
 801 ATGTTGTACAATTTTCTTCCTCAAAAAACTTTTTAAATGTAAGTATCCTTATTTTTTTTTTAAAAGAGCACAATGTAGGT
 881 GTATTTGAGTATTTTCAAGAAAAGAATAAAAACATTAATGCAGTATTAGGTTAACTGGATATCAACTAAGCCTTGTTAAC
 961 AGTTAAAGTATTATAACTTTTTTTACTTCTGAAAATTAAAAATAAAATTTATTTCTGCAATTTCAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacAUUAUGACAAUAGACUUu 5'
             ||:| || | ||||||| 
Target 5' gttTAGT-CT-TCATCTGAAt 3'
 226 - 244 152.00 -5.70
2 
miRNA  3' uacAU-UAU-GACAAUAGACUUu 5'
             || |||  ||| ||||| | 
Target 5' aaaTAGATAGATGTGATCTGCAg 3'
 198 - 220 126.00 -6.52
3 
miRNA  3' uacAUU-AUGACAAU--AGACUUu 5'
             ||| | :| |||  |||||| 
Target 5' ttaTAACTTTTTTTACTTCTGAAa 3'
 971 - 994 122.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31608881 29 COSMIC
COSN31572956 33 COSMIC
COSN30123824 44 COSMIC
COSN31584034 97 COSMIC
COSN27146429 148 COSMIC
COSN6810653 184 COSMIC
COSN26460511 393 COSMIC
COSN6810654 450 COSMIC
COSN26210263 459 COSMIC
COSN20100729 862 COSMIC
COSN2003881 863 COSMIC
COSN4915468 972 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1485830828 9 dbSNP
rs746967151 10 dbSNP
rs369755272 11 dbSNP
rs768368931 11 dbSNP
rs1402771620 14 dbSNP
rs1465399412 25 dbSNP
rs776672468 26 dbSNP
rs1462050349 34 dbSNP
rs747961194 36 dbSNP
rs769655985 39 dbSNP
rs199909781 41 dbSNP
rs762667012 47 dbSNP
rs559318138 48 dbSNP
rs1431585964 49 dbSNP
rs1197333358 50 dbSNP
rs757363550 53 dbSNP
rs1264092650 58 dbSNP
rs1216256577 63 dbSNP
rs1211357704 65 dbSNP
rs879200457 67 dbSNP
rs1281884388 72 dbSNP
rs368418232 76 dbSNP
rs4362779 78 dbSNP
rs911585530 85 dbSNP
rs151331446 103 dbSNP
rs1200172432 106 dbSNP
rs115409207 110 dbSNP
rs1289027030 116 dbSNP
rs1432443487 120 dbSNP
rs1469478356 123 dbSNP
rs534549224 124 dbSNP
rs368249025 128 dbSNP
rs747946255 130 dbSNP
rs771928409 131 dbSNP
rs1480119847 135 dbSNP
rs1164057697 140 dbSNP
rs935810784 143 dbSNP
rs1054256420 151 dbSNP
rs550800991 159 dbSNP
rs552690414 167 dbSNP
rs1264856365 189 dbSNP
rs1201243559 200 dbSNP
rs1322291961 200 dbSNP
rs1295667002 216 dbSNP
rs1331176187 219 dbSNP
rs1359394957 219 dbSNP
rs948668028 233 dbSNP
rs1453778676 238 dbSNP
rs1045689769 240 dbSNP
rs1055241 262 dbSNP
rs1442014250 263 dbSNP
rs1285155807 265 dbSNP
rs1381715571 268 dbSNP
rs567332467 271 dbSNP
rs536346116 273 dbSNP
rs1293166802 275 dbSNP
rs1318046590 276 dbSNP
rs1219906761 278 dbSNP
rs1469738047 282 dbSNP
rs761095012 286 dbSNP
rs367671594 309 dbSNP
rs1355232213 318 dbSNP
rs1172593654 325 dbSNP
rs1270514062 326 dbSNP
rs1419027261 335 dbSNP
rs1185719644 344 dbSNP
rs1436857334 349 dbSNP
rs907177422 350 dbSNP
rs1210300199 368 dbSNP
rs189333627 369 dbSNP
rs1181749020 372 dbSNP
rs1239000156 380 dbSNP
rs529214294 381 dbSNP
rs1205942997 382 dbSNP
rs1004633556 398 dbSNP
rs1271767287 403 dbSNP
rs572776228 409 dbSNP
rs1037082732 410 dbSNP
rs1287028949 420 dbSNP
rs77305246 423 dbSNP
rs1386580889 425 dbSNP
rs898575405 426 dbSNP
rs1435166474 430 dbSNP
rs1354180347 432 dbSNP
rs1164509590 437 dbSNP
rs1335438587 443 dbSNP
rs1380167420 448 dbSNP
rs1386904168 451 dbSNP
rs538292250 452 dbSNP
rs868703645 457 dbSNP
rs1247637448 458 dbSNP
rs758926659 459 dbSNP
rs1313902375 467 dbSNP
rs1316685352 468 dbSNP
rs1237613096 476 dbSNP
rs1262985027 482 dbSNP
rs778645434 486 dbSNP
rs1028527350 489 dbSNP
rs1203138022 494 dbSNP
rs1241309646 497 dbSNP
rs954261591 500 dbSNP
rs1008462445 501 dbSNP
rs1222828705 502 dbSNP
rs1361128245 513 dbSNP
rs1182603786 515 dbSNP
rs1256664280 516 dbSNP
rs768014131 521 dbSNP
rs1309717063 526 dbSNP
rs1019892970 529 dbSNP
rs965707570 538 dbSNP
rs558397148 540 dbSNP
rs566502120 543 dbSNP
rs1403199031 547 dbSNP
rs538719453 556 dbSNP
rs1449854189 559 dbSNP
rs1303062257 561 dbSNP
rs989927800 565 dbSNP
rs753140588 568 dbSNP
rs1417206718 569 dbSNP
rs775141004 572 dbSNP
rs149775334 574 dbSNP
rs1199452623 575 dbSNP
rs1330461025 578 dbSNP
rs915768531 580 dbSNP
rs193212177 581 dbSNP
rs371652619 582 dbSNP
rs948573508 585 dbSNP
rs1222236037 586 dbSNP
rs1486432395 591 dbSNP
rs1045594087 596 dbSNP
rs1237574466 597 dbSNP
rs543567236 602 dbSNP
rs1219469731 605 dbSNP
rs563529979 620 dbSNP
rs372451224 640 dbSNP
rs1282817532 650 dbSNP
rs1345520419 660 dbSNP
rs1037477615 676 dbSNP
rs1385455785 679 dbSNP
rs542688434 687 dbSNP
rs995616244 688 dbSNP
rs1209861526 690 dbSNP
rs1049859711 691 dbSNP
rs1176526505 695 dbSNP
rs746958128 702 dbSNP
rs1426576799 703 dbSNP
rs889931397 704 dbSNP
rs1008408523 713 dbSNP
rs1264355244 726 dbSNP
rs560866032 729 dbSNP
rs116797878 742 dbSNP
rs1464862321 743 dbSNP
rs967404372 744 dbSNP
rs1205659925 766 dbSNP
rs185524387 774 dbSNP
rs1282694713 786 dbSNP
rs1475098878 798 dbSNP
rs1228497511 800 dbSNP
rs1031782024 802 dbSNP
rs547274680 805 dbSNP
rs1397092185 807 dbSNP
rs776188226 811 dbSNP
rs1337377767 812 dbSNP
rs1470914907 813 dbSNP
rs1403315431 818 dbSNP
rs1171459196 822 dbSNP
rs1462197975 823 dbSNP
rs1374396051 824 dbSNP
rs957125885 829 dbSNP
rs1449178119 830 dbSNP
rs989834315 839 dbSNP
rs1186011125 840 dbSNP
rs1173397530 848 dbSNP
rs760054911 849 dbSNP
rs1278039197 851 dbSNP
rs1249778996 852 dbSNP
rs142867699 852 dbSNP
rs80347859 852 dbSNP
rs759211717 854 dbSNP
rs1315432963 862 dbSNP
rs969828645 862 dbSNP
rs3207213 863 dbSNP
rs1380423761 866 dbSNP
rs1332961690 869 dbSNP
rs1391397151 870 dbSNP
rs1234040270 872 dbSNP
rs530726359 874 dbSNP
rs775891457 876 dbSNP
rs1428697843 880 dbSNP
rs928564257 887 dbSNP
rs1165810572 891 dbSNP
rs939964325 893 dbSNP
rs1237344356 898 dbSNP
rs1182643821 899 dbSNP
rs1316794575 900 dbSNP
rs1325379314 902 dbSNP
rs1037018673 909 dbSNP
rs73866776 915 dbSNP
rs368035377 920 dbSNP
rs1292252875 924 dbSNP
rs1247841958 942 dbSNP
rs1305241247 944 dbSNP
rs931316770 946 dbSNP
rs1049808678 952 dbSNP
rs544077592 956 dbSNP
rs140428660 961 dbSNP
rs34556037 963 dbSNP
rs1337082376 973 dbSNP
rs1041644038 977 dbSNP
rs1233378764 978 dbSNP
rs1286483525 979 dbSNP
rs1355518187 981 dbSNP
rs1423071408 983 dbSNP
rs1203344274 987 dbSNP
rs546703418 996 dbSNP
rs1413515072 1011 dbSNP
rs1159723180 1021 dbSNP
rs1471425928 1025 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55319.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000358572.5 | 3UTR | AAUUUCAGGCUGGGAGGGAGCAAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000358572.5 | 3UTR | UGAAUUUCAGGCUGGGAGGGAGCAAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
116 hsa-miR-3942-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT093395 TMA16 translation machinery associated 16 homolog 2 2
MIRT134018 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT194942 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT265807 NOTCH2 notch 2 2 2
MIRT287615 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT444196 SESN3 sestrin 3 2 2
MIRT444480 UBN2 ubinuclein 2 2 2
MIRT446589 FBXO40 F-box protein 40 2 2
MIRT450501 ALPK3 alpha kinase 3 2 2
MIRT455182 AGTRAP angiotensin II receptor associated protein 2 2
MIRT455446 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT456385 KLHL12 kelch like family member 12 2 2
MIRT460303 FLCN folliculin 2 2
MIRT461247 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 6
MIRT467948 SLC16A1 solute carrier family 16 member 1 2 2
MIRT468007 SIX4 SIX homeobox 4 2 2
MIRT468211 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT470635 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT471785 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT473557 MATR3 matrin 3 2 2
MIRT475415 ICK intestinal cell kinase 2 2
MIRT476265 GNAL G protein subunit alpha L 2 6
MIRT477135 FAM107B family with sequence similarity 107 member B 2 6
MIRT478433 DAZAP2 DAZ associated protein 2 2 2
MIRT479050 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT480872 BDNF-AS BDNF antisense RNA 2 2
MIRT484229 CLDN1 claudin 1 2 2
MIRT485055 SUCO SUN domain containing ossification factor 2 2
MIRT489871 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT492411 SCARB2 scavenger receptor class B member 2 2 2
MIRT499682 KCTD2 potassium channel tetramerization domain containing 2 2 4
MIRT505969 RAB11FIP1 RAB11 family interacting protein 1 2 4
MIRT507708 CNIH cornichon family AMPA receptor auxiliary protein 1 2 4
MIRT511878 GID4 GID complex subunit 4 homolog 2 6
MIRT513411 RTP4 receptor transporter protein 4 2 2
MIRT519873 ZFP30 ZFP30 zinc finger protein 2 4
MIRT520703 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT522890 KCNN3 potassium calcium-activated channel subfamily N member 3 2 6
MIRT523781 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT523950 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT526894 ATP6V0E2 ATPase H+ transporting V0 subunit e2 2 2
MIRT529167 CCDC25 coiled-coil domain containing 25 2 2
MIRT529703 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT530359 PCSK1 proprotein convertase subtilisin/kexin type 1 2 2
MIRT530595 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT531528 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT531992 BARD1 BRCA1 associated RING domain 1 2 2
MIRT539547 AAK1 AP2 associated kinase 1 2 2
MIRT547757 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT549059 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT549836 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT552698 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT554318 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT556358 MAF MAF bZIP transcription factor 2 2
MIRT557772 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT558795 CHEK2 checkpoint kinase 2 2 2
MIRT561367 UBXN2B UBX domain protein 2B 2 2
MIRT561673 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT567898 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT568456 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT568838 NBPF12 NBPF member 12 2 2
MIRT568846 VPS53 VPS53, GARP complex subunit 2 2
MIRT568856 NBPF1 NBPF member 1 2 2
MIRT568888 NBPF15 NBPF member 15 2 2
MIRT569331 CDC5L cell division cycle 5 like 2 2
MIRT569388 NBPF11 NBPF member 11 2 2
MIRT569398 NBPF14 NBPF member 14 2 2
MIRT569644 NBPF10 NBPF member 10 2 2
MIRT571582 TROVE2 TROVE domain family member 2 2 2
MIRT573027 NBPF3 NBPF member 3 2 2
MIRT573293 UFM1 ubiquitin fold modifier 1 2 2
MIRT608814 SEPT6 septin 6 2 6
MIRT609046 BACH2 BTB domain and CNC homolog 2 2 6
MIRT609517 RAB3IP RAB3A interacting protein 2 2
MIRT611861 SRRM4 serine/arginine repetitive matrix 4 2 2
MIRT612174 EMC3 ER membrane protein complex subunit 3 2 2
MIRT612714 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT613305 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 4
MIRT616357 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT632424 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT636005 SAMD15 sterile alpha motif domain containing 15 2 2
MIRT636534 FAM126B family with sequence similarity 126 member B 2 2
MIRT637275 FGFR1OP FGFR1 oncogene partner 2 2
MIRT639131 ZNF726 zinc finger protein 726 2 2
MIRT641257 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT642930 KRTAP5-9 keratin associated protein 5-9 2 2
MIRT644018 NUCB1 nucleobindin 1 2 2
MIRT645021 MAGEB4 MAGE family member B4 2 2
MIRT646790 EVC2 EvC ciliary complex subunit 2 2 2
MIRT647338 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT647975 PDE12 phosphodiesterase 12 2 2
MIRT650610 NEK4 NIMA related kinase 4 2 2
MIRT651052 ZNF579 zinc finger protein 579 2 2
MIRT651593 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652785 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT656450 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT660086 BTD biotinidase 2 2
MIRT661398 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT661759 MICA MHC class I polypeptide-related sequence A 2 2
MIRT666402 SH3D19 SH3 domain containing 19 2 2
MIRT668362 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT668895 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT669329 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT672369 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT686261 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT695571 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT701959 MINK1 misshapen like kinase 1 2 2
MIRT702322 KMT2A lysine methyltransferase 2A 2 2
MIRT705209 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT713949 KCTD6 potassium channel tetramerization domain containing 6 2 2
MIRT717082 EBF4 early B-cell factor 4 2 2
MIRT717896 COPS8 COP9 signalosome subunit 8 2 2
MIRT721043 TRIM67 tripartite motif containing 67 2 2
MIRT722194 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT722782 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT725412 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3942-3p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-3942-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3942-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission