pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1245b |
Genomic Coordinates | chr2: 188978093 - 188978161 |
Description | Homo sapiens miR-1245b stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1245b-3p | ||||||||||||||||||
Sequence | 42| UCAGAUGAUCUAAAGGCCUAUA |63 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TMA16 | ||||||||||||||||||||
Synonyms | C4orf43 | ||||||||||||||||||||
Description | translation machinery associated 16 homolog | ||||||||||||||||||||
Transcript | NM_018352 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TMA16 | |||||||||||||||||||||
3'UTR of TMA16 (miRNA target sites are highlighted) |
>TMA16|NM_018352|3'UTR 1 TTGTCTTCACTTGAATTGAAAATAAATAATTTGAGAGCTTCAAATTATATTCATTGATTATGGTACCTAATTGTCATGAT 81 ACAAAAATTTGATACTGACATTCTCTTATATGATGAGAGTTTCATTTGCGTTTCAAAAATGGTGTTATGATACTTATTTT 161 AAAATGAAGATTGCTTTTCATTTCCATTAAGTTGCTAAAATAGATAGATGTGATCTGCAGAAGTTGTTTAGTCTTCATCT 241 GAATTTCAGGCTGGGAGGGAGCAATATAACTAAGGACAAAAAATGTTTTGTTTTTCTTGTGTATTTATGATCACCTAATT 321 TCACGTTTTGTGAAATGGACAGTAACCTGTTTCCTGAAAGATTCCTGTGGGTACTTTTTGAGCTGTGATAATAGCAAAAT 401 TGTTTTTCGGTAATAATATCACACTAATGCTTCTTTTAAACATTAAACCTATTTTCCTTTTTTACAGAATAAGGGAAAAT 481 GTGATAAGAAGTTTGTATACATTTCTGGATTATAGATTATTATTTATCTTTTGAACCAGAGCTAAATGGTAAAAGAAAAA 561 AAATCAGTGATGATTGTTATGTTGATCTCCCACAATTAATTTATCTTTTGACAAAGGGGATAAAGAGTTTCAGTTTAGCT 641 CCTTTTGATTGTATATTATTTTTTGCTTTTTTATTGTGAAAAGAGGTAGGTTTTATTTGTGGAGAGAGAGTTGAAGATTA 721 GGGAACCAGTGATTTTAATTATGCTACTTTTTCTTCTAAGAGATAAATTGATATATCATTCAGTGTCATGAAAAACATGA 801 ATGTTGTACAATTTTCTTCCTCAAAAAACTTTTTAAATGTAAGTATCCTTATTTTTTTTTTAAAAGAGCACAATGTAGGT 881 GTATTTGAGTATTTTCAAGAAAAGAATAAAAACATTAATGCAGTATTAGGTTAACTGGATATCAACTAAGCCTTGTTAAC 961 AGTTAAAGTATTATAACTTTTTTTACTTCTGAAAATTAAAAATAAAATTTATTTCTGCAATTTCAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 55319.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714646 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repA |
Location of target site | ENST00000358572.5 | 3UTR | AAUUUCAGGCUGGGAGGGAGCAAUAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714647 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repB |
Location of target site | ENST00000358572.5 | 3UTR | UGAAUUUCAGGCUGGGAGGGAGCAAUAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
62 hsa-miR-1245b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT087132 | CRKL | CRK like proto-oncogene, adaptor protein | 2 | 2 | ||||||||
MIRT093398 | TMA16 | translation machinery associated 16 homolog | 2 | 2 | ||||||||
MIRT096092 | SFXN1 | sideroflexin 1 | 2 | 2 | ||||||||
MIRT097106 | TNPO1 | transportin 1 | 2 | 4 | ||||||||
MIRT241837 | SLC38A2 | solute carrier family 38 member 2 | 2 | 2 | ||||||||
MIRT271432 | ETNK1 | ethanolamine kinase 1 | 2 | 2 | ||||||||
MIRT329517 | E2F3 | E2F transcription factor 3 | 2 | 4 | ||||||||
MIRT444201 | SESN3 | sestrin 3 | 2 | 2 | ||||||||
MIRT445920 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | 2 | 2 | ||||||||
MIRT450210 | PAIP1 | poly(A) binding protein interacting protein 1 | 2 | 2 | ||||||||
MIRT455192 | AGTRAP | angiotensin II receptor associated protein | 2 | 2 | ||||||||
MIRT455458 | EPB41L4B | erythrocyte membrane protein band 4.1 like 4B | 2 | 2 | ||||||||
MIRT459016 | UQCRH | ubiquinol-cytochrome c reductase hinge protein | 2 | 2 | ||||||||
MIRT461492 | KIAA1009 | centrosomal protein 162 | 1 | 1 | ||||||||
MIRT466306 | TIMM22 | translocase of inner mitochondrial membrane 22 | 2 | 2 | ||||||||
MIRT471143 | PHF19 | PHD finger protein 19 | 2 | 2 | ||||||||
MIRT473481 | MCFD2 | multiple coagulation factor deficiency 2 | 2 | 2 | ||||||||
MIRT473564 | MATR3 | matrin 3 | 2 | 2 | ||||||||
MIRT474013 | LRRC20 | leucine rich repeat containing 20 | 2 | 2 | ||||||||
MIRT475982 | GTPBP2 | GTP binding protein 2 | 2 | 2 | ||||||||
MIRT478926 | CPNE3 | copine 3 | 2 | 2 | ||||||||
MIRT479896 | CCDC117 | coiled-coil domain containing 117 | 2 | 2 | ||||||||
MIRT480115 | CALR | calreticulin | 2 | 2 | ||||||||
MIRT483127 | ONECUT3 | one cut homeobox 3 | 2 | 2 | ||||||||
MIRT484236 | IER2 | immediate early response 2 | 2 | 2 | ||||||||
MIRT492237 | SLC48A1 | solute carrier family 48 member 1 | 2 | 2 | ||||||||
MIRT496934 | CAMK4 | calcium/calmodulin dependent protein kinase IV | 2 | 2 | ||||||||
MIRT500438 | ZMAT3 | zinc finger matrin-type 3 | 2 | 2 | ||||||||
MIRT506263 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | 2 | 2 | ||||||||
MIRT525649 | NHSL2 | NHS like 2 | 2 | 2 | ||||||||
MIRT526691 | BAK1 | BCL2 antagonist/killer 1 | 2 | 2 | ||||||||
MIRT529667 | SLC28A1 | solute carrier family 28 member 1 | 2 | 2 | ||||||||
MIRT531152 | CYGB | cytoglobin | 2 | 2 | ||||||||
MIRT537002 | GTPBP10 | GTP binding protein 10 | 2 | 2 | ||||||||
MIRT537325 | FOXN3 | forkhead box N3 | 2 | 2 | ||||||||
MIRT537586 | ESYT2 | extended synaptotagmin 2 | 2 | 2 | ||||||||
MIRT538786 | C6orf89 | chromosome 6 open reading frame 89 | 2 | 2 | ||||||||
MIRT540286 | RGR | retinal G protein coupled receptor | 2 | 4 | ||||||||
MIRT552700 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | 2 | 2 | ||||||||
MIRT555670 | PGAM4 | phosphoglycerate mutase family member 4 | 2 | 2 | ||||||||
MIRT556823 | KDELR2 | KDEL endoplasmic reticulum protein retention receptor 2 | 2 | 2 | ||||||||
MIRT568686 | TOMM40 | translocase of outer mitochondrial membrane 40 | 2 | 2 | ||||||||
MIRT568851 | VPS53 | VPS53, GARP complex subunit | 2 | 2 | ||||||||
MIRT571973 | KIF21A | kinesin family member 21A | 2 | 2 | ||||||||
MIRT573973 | DDX21 | DExD-box helicase 21 | 2 | 2 | ||||||||
MIRT574260 | DOCK7 | dedicator of cytokinesis 7 | 2 | 2 | ||||||||
MIRT612180 | EMC3 | ER membrane protein complex subunit 3 | 2 | 2 | ||||||||
MIRT619387 | KLHL12 | kelch like family member 12 | 2 | 2 | ||||||||
MIRT625708 | SHROOM1 | shroom family member 1 | 2 | 2 | ||||||||
MIRT646803 | EVC2 | EvC ciliary complex subunit 2 | 2 | 2 | ||||||||
MIRT656992 | KCNN3 | potassium calcium-activated channel subfamily N member 3 | 2 | 2 | ||||||||
MIRT676250 | PARP2 | poly(ADP-ribose) polymerase 2 | 2 | 2 | ||||||||
MIRT682591 | CPA4 | carboxypeptidase A4 | 2 | 2 | ||||||||
MIRT687779 | KHSRP | KH-type splicing regulatory protein | 2 | 2 | ||||||||
MIRT690292 | ZNF154 | zinc finger protein 154 | 2 | 2 | ||||||||
MIRT692718 | MEAF6 | MYST/Esa1 associated factor 6 | 2 | 2 | ||||||||
MIRT700284 | RAN | RAN, member RAS oncogene family | 2 | 2 | ||||||||
MIRT708293 | ZNF24 | zinc finger protein 24 | 2 | 2 | ||||||||
MIRT709767 | GPR183 | G protein-coupled receptor 183 | 2 | 2 | ||||||||
MIRT720689 | LY6K | lymphocyte antigen 6 family member K | 2 | 2 | ||||||||
MIRT722784 | ACADSB | acyl-CoA dehydrogenase, short/branched chain | 2 | 2 | ||||||||
MIRT725414 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|