miRTarBase - #MIRT093696


—
pre-miRNA Information
pre-miRNA hsa-mir-4524a   
Genomic Coordinates chr17: 69099564 - 69099632
Description Homo sapiens miR-4524a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524a-5p
Sequence 6| AUAGCAGCAUGAACCUGUCUCA |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322445998 8 dbSNP
rs1350790266 13 dbSNP
rs1263495678 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PI4K2B   
Synonyms PI4KIIB, PIK42B
Description phosphatidylinositol 4-kinase type 2 beta
Transcript NM_018323   
Expression
Putative miRNA Targets on PI4K2B
3'UTR of PI4K2B
(miRNA target sites are highlighted)		 
>PI4K2B|NM_018323|3'UTR
   1 TAAATGTCAGAGTAAGAGAAACAAACTGTTTAGAATTATCATGTTTTTAAAACATCATAGTAATATAAATCTGCTGTTAG
  81 GAGCTCCAGTTGCTAAAACCTCAATTTAAGTCTTTAAAAGGTTGTATTTTGAATGTAACCAAAAGTTTACAGTTTTTTGT
 161 CCAAATATTAAATTTCTATTTCAGGGAAGAAGTGCTATATCTCCTATATTGTATTTTTGTAGAAAATTTGTATTTTATGT
 241 TGTTGTTAGTTTAAAAGGTAATTTTACACATGCTGGAATGACTGTAATTACTCTAGAATTCCAAGTAGAATACAATAACT
 321 TTTAATATTGAGAAGAATGTTCATGCTAATTCTTCTTACATTACAAAAGGCCTTTGAGGATGCCTACGTCTGAAATTGCT
 401 CTTACGAACTTTAATAAAATAGTTAGCTAATAGAAAAACAGGTAAGAATAAAGCAATGTTGCCTTAATTTCAAAAGCTGC
 481 TATTTTAGAATTTGAATAAGTACTCCTAAAGTGACCATTATTAGGGACCAGAAAATTATATCTTGGCTAAGTAATAGAGG
 561 ACCATTTTGGTTTTTGTACTTGAGAATATTTTTGGTGAATTACTTTGTTGTAGTGAGGAAAAAACCTAAGAAATTTCCCC
 641 TTTTTTTAAAAAATGGAAATATTCAATTGAGACTTGAGGGGAATAATAGAAAATTAAGGTAGATCCCCAATATTTTGGAA
 721 TACCAAAATTGCCTTAAAAATTCCCTTCTGTTTCTTACATGGGATCAAATACTTGAGATTAGTACTTCAGAGTACTGGCC
 801 TTGTTCAATTTAGTACTTCAATTAGTATTAAACTTCACTAAAAAGTAAACCATACTCCAAATTGTATATTGGATTGCATT
 881 TTGGGGTCCTAGGTCATACGTTCTTCAAAATTATTATGATTGTACTATTGTACTTGAAATTACAGATGTTATTATAATTA
 961 CAGTCAAATGTAGACTATCAGGCCAAATTAAAGGGGAGCATGGCAGATAACCATAAAGTCATTTATATTTGATTTTGAAA
1041 TGTATTTTTGTACTTTATTTTGAATATCATCCATATGTCTGACATTATTGGAATTTGTAACATTGTTAATGCACTAAGTG
1121 ATTTAAATTCAATTGATGAAGATGTGATTTTACAGAAGCAGAAGTTTCATTTTCTTGAGGCTTAAAACCAATGTCACCAC
1201 TTGGGCTTAACTGGGTAATTTGTGGTCTAGGCCTTTTGTTTTCTAAGCTTACTATCTTGTGTTTGTTTATTTGCTTTTAA
1281 TGAAGTATTTTGTGTAGAAGGTTAAATTAGGATGCAAAACAGATCTGCCATTCCTTTTTCCCTTATATCTTCCTTTTGGT
1361 CTTCATGGACGAGATGAATGAGGATTCTGCTGCCCTGAGGGAGTTCATTGGAAACCTGCGTTCTCCTACCTCTTCCAACC
1441 CTCCATTAGCTCAATTTTGAGATAATGGAAAATTGACTGGAAATTCAAAACTCAAACTACTATCTTTAGATATAAACACT
1521 AGTAATTAAAATGTGCCTTTTGAAGATGTTTTCTAAGAGAAAGGAAATACGTTGCAGTGATGTGGGTACTGCTTTCATAA
1601 AACAGTTTTTTCAGTATTTTGAGAATTGCCATATTAATTTTTATAATGGAAAACTTAATAAATTGCTACTGTTTTATATC
1681 ATAAAATTAAAATACCATGGTAATATTTGCAAAAGGTCTGGCCATACCAGAAAAGTACAGTTGAGATAGTTAAGATATAA
1761 CCACAAGTCAGAGTACATTGGTTGTATTTTGTAAACTTTCATGAACTGAATTCTTATTTAAATAGTATGGTTTTTTTTCA
1841 ATAAGTATATTTATAGTGACAAATGTGGTAGACTAAAGGTAATAAAAATCATTGTCTTAAGATTATGTTCTTCTGTATGT
1921 ACGTGTTTGGAATATTTAGAATGTTTATGAACACATTTACTATAAATGATGCCAAACTATCATTTTCTTCATATATTAAA
2001 GGTATAGTTTAATTCTTTTTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acucuguccAAG--UACGACGAUa 5'
                   |||  | ||||||| 
Target 5' tgccttaatTTCAAAAGCTGCTAt 3'
 460 - 483 147.00 -10.20
2 
miRNA  3' acUCUGUCCAAGUACGACGAUa 5'
            ||: || | || |:||||| 
Target 5' ttAGG-AGCTCCA-GTTGCTAa 3'
 77 - 96 138.00 -9.70
3 
miRNA  3' acucugUCCAAGUACGACGaua 5'
                ||| |: ||||||   
Target 5' tgaatgAGGATTCTGCTGCcct 3'
 1375 - 1396 120.00 -13.32
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30114771 16 COSMIC
COSN31533469 36 COSMIC
COSN30517983 49 COSMIC
COSN26562451 121 COSMIC
COSN31529192 162 COSMIC
COSN26640758 196 COSMIC
COSN27011328 257 COSMIC
COSN28198105 262 COSMIC
COSN26767066 348 COSMIC
COSN23716930 388 COSMIC
COSN31534613 388 COSMIC
COSN22578106 874 COSMIC
COSN22446121 886 COSMIC
COSN23835862 1136 COSMIC
COSN31569443 1371 COSMIC
COSN30174646 1374 COSMIC
COSN26553401 1510 COSMIC
COSN26641878 1587 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1262299251 2 dbSNP
rs1436030592 4 dbSNP
rs1272152399 5 dbSNP
rs1476817538 6 dbSNP
rs763600397 7 dbSNP
rs751033047 8 dbSNP
rs1404362615 14 dbSNP
rs573391093 15 dbSNP
rs756854988 20 dbSNP
rs780805899 22 dbSNP
rs1430752441 42 dbSNP
rs372355734 43 dbSNP
rs1367049032 44 dbSNP
rs1294168698 45 dbSNP
rs1339042094 52 dbSNP
rs780426073 53 dbSNP
rs1353303328 58 dbSNP
rs1244417907 60 dbSNP
rs1331190846 65 dbSNP
rs765626737 67 dbSNP
rs571384331 69 dbSNP
rs1466486413 74 dbSNP
rs936519384 75 dbSNP
rs1426223327 77 dbSNP
rs1054101509 88 dbSNP
rs961300739 97 dbSNP
rs11544125 103 dbSNP
rs916527713 105 dbSNP
rs947710072 106 dbSNP
rs993804566 113 dbSNP
rs1192458566 121 dbSNP
rs1046100249 124 dbSNP
rs1468096076 127 dbSNP
rs368648682 129 dbSNP
rs906208090 132 dbSNP
rs112267369 140 dbSNP
rs927069863 161 dbSNP
rs1361735115 169 dbSNP
rs1302199620 177 dbSNP
rs960221696 179 dbSNP
rs3796780 180 dbSNP
rs562069089 187 dbSNP
rs1309255853 192 dbSNP
rs888587962 198 dbSNP
rs1005746594 201 dbSNP
rs946316520 210 dbSNP
rs1018939782 211 dbSNP
rs758848410 212 dbSNP
rs765854471 214 dbSNP
rs533661536 224 dbSNP
rs751029224 246 dbSNP
rs998851233 252 dbSNP
rs1177712994 258 dbSNP
rs1029622560 259 dbSNP
rs967368824 267 dbSNP
rs1485509471 268 dbSNP
rs1184638264 271 dbSNP
rs1441445564 276 dbSNP
rs1241146526 286 dbSNP
rs1181102813 294 dbSNP
rs1043004215 302 dbSNP
rs925961263 312 dbSNP
rs574319087 314 dbSNP
rs977445706 316 dbSNP
rs1351646840 319 dbSNP
rs1285366654 327 dbSNP
rs1240901620 348 dbSNP
rs932016351 350 dbSNP
rs1182646008 360 dbSNP
rs926065993 362 dbSNP
rs1382969818 367 dbSNP
rs890557128 370 dbSNP
rs1380333497 375 dbSNP
rs1304295211 380 dbSNP
rs1426120565 387 dbSNP
rs943860930 388 dbSNP
rs957850850 389 dbSNP
rs989371276 396 dbSNP
rs1040910494 399 dbSNP
rs1420947158 400 dbSNP
rs1344028371 403 dbSNP
rs916477609 406 dbSNP
rs1291135877 407 dbSNP
rs947964038 441 dbSNP
rs1452335308 457 dbSNP
rs770729407 459 dbSNP
rs927591388 461 dbSNP
rs1183862944 466 dbSNP
rs888105358 483 dbSNP
rs1246911848 486 dbSNP
rs929641464 497 dbSNP
rs1487441271 504 dbSNP
rs1283654602 509 dbSNP
rs6834255 512 dbSNP
rs1355871168 528 dbSNP
rs888236343 535 dbSNP
rs1244693401 537 dbSNP
rs1213625511 541 dbSNP
rs1034084214 545 dbSNP
rs1398490020 555 dbSNP
rs1339480525 558 dbSNP
rs551911749 579 dbSNP
rs1401325351 580 dbSNP
rs1363158628 589 dbSNP
rs148578222 594 dbSNP
rs900000867 604 dbSNP
rs998423309 611 dbSNP
rs1168093623 619 dbSNP
rs367850418 626 dbSNP
rs967336115 638 dbSNP
rs1194638587 640 dbSNP
rs11544127 648 dbSNP
rs536732405 649 dbSNP
rs1209820277 654 dbSNP
rs957487702 659 dbSNP
rs550698343 677 dbSNP
rs747846183 682 dbSNP
rs11544126 700 dbSNP
rs916377750 701 dbSNP
rs1416773255 704 dbSNP
rs926235198 705 dbSNP
rs116143155 711 dbSNP
rs982022901 718 dbSNP
rs1386803757 721 dbSNP
rs1469697291 728 dbSNP
rs1296319550 731 dbSNP
rs553018174 744 dbSNP
rs927895480 750 dbSNP
rs573144838 754 dbSNP
rs538960053 755 dbSNP
rs749194316 759 dbSNP
rs770779329 760 dbSNP
rs941080022 764 dbSNP
rs1039875940 769 dbSNP
rs1197292099 771 dbSNP
rs1371341978 778 dbSNP
rs774413143 785 dbSNP
rs1259079380 793 dbSNP
rs1200855442 803 dbSNP
rs896988119 817 dbSNP
rs1218858375 834 dbSNP
rs1273808002 842 dbSNP
rs929828165 846 dbSNP
rs1233355165 851 dbSNP
rs111270005 852 dbSNP
rs1307078787 853 dbSNP
rs1445915033 861 dbSNP
rs1048329859 873 dbSNP
rs747044733 877 dbSNP
rs1001186874 887 dbSNP
rs1172155939 892 dbSNP
rs11726422 894 dbSNP
rs1379444397 897 dbSNP
rs1177362136 898 dbSNP
rs142982898 901 dbSNP
rs1261098624 917 dbSNP
rs903486808 918 dbSNP
rs1440989570 923 dbSNP
rs1203964817 934 dbSNP
rs532274938 943 dbSNP
rs1032942237 944 dbSNP
rs1283236203 947 dbSNP
rs1346557349 947 dbSNP
rs1238729662 954 dbSNP
rs1377596523 955 dbSNP
rs1479431319 957 dbSNP
rs1178454574 960 dbSNP
rs893130676 963 dbSNP
rs1408004884 966 dbSNP
rs1012979867 970 dbSNP
rs1333838929 977 dbSNP
rs1396799007 978 dbSNP
rs1174896830 981 dbSNP
rs1431975446 986 dbSNP
rs1023485659 998 dbSNP
rs1020033424 1004 dbSNP
rs1381486869 1005 dbSNP
rs1160955983 1019 dbSNP
rs570483249 1021 dbSNP
rs147753779 1037 dbSNP
rs574847422 1054 dbSNP
rs1443808984 1059 dbSNP
rs1353005175 1066 dbSNP
rs1033198000 1068 dbSNP
rs953770382 1074 dbSNP
rs986113083 1076 dbSNP
rs1215296162 1077 dbSNP
rs1298829477 1084 dbSNP
rs1344964605 1089 dbSNP
rs1288133652 1103 dbSNP
rs551965930 1115 dbSNP
rs911883457 1119 dbSNP
rs1034927444 1137 dbSNP
rs1222892031 1145 dbSNP
rs188789928 1170 dbSNP
rs1355459647 1178 dbSNP
rs1284552281 1183 dbSNP
rs1246635854 1189 dbSNP
rs951242620 1192 dbSNP
rs982697765 1199 dbSNP
rs909523777 1206 dbSNP
rs191669054 1213 dbSNP
rs1296533494 1216 dbSNP
rs1399532562 1220 dbSNP
rs367965064 1224 dbSNP
rs773577450 1226 dbSNP
rs1320931692 1227 dbSNP
rs552486801 1231 dbSNP
rs562739700 1232 dbSNP
rs921035199 1246 dbSNP
rs934171137 1249 dbSNP
rs1051240860 1250 dbSNP
rs903371037 1254 dbSNP
rs531885730 1257 dbSNP
rs934876379 1260 dbSNP
rs182855077 1281 dbSNP
rs113279148 1283 dbSNP
rs1054654637 1289 dbSNP
rs1435732329 1292 dbSNP
rs115581657 1295 dbSNP
rs547926567 1296 dbSNP
rs1290461406 1297 dbSNP
rs1023031434 1317 dbSNP
rs752160694 1326 dbSNP
rs907314556 1333 dbSNP
rs929777383 1334 dbSNP
rs1002965845 1338 dbSNP
rs1034811248 1343 dbSNP
rs1276590494 1347 dbSNP
rs1218245207 1348 dbSNP
rs951211350 1359 dbSNP
rs1048276719 1360 dbSNP
rs982665151 1368 dbSNP
rs1017292678 1371 dbSNP
rs1349840707 1372 dbSNP
rs1434312577 1372 dbSNP
rs546595268 1385 dbSNP
rs754419930 1386 dbSNP
rs1398514853 1389 dbSNP
rs1169600431 1393 dbSNP
rs1417739997 1398 dbSNP
rs1188952507 1400 dbSNP
rs867252454 1402 dbSNP
rs1055426704 1408 dbSNP
rs1171382154 1409 dbSNP
rs895471062 1410 dbSNP
rs1456329618 1417 dbSNP
rs34801343 1419 dbSNP
rs1013911653 1420 dbSNP
rs142512743 1421 dbSNP
rs538923371 1424 dbSNP
rs777289807 1428 dbSNP
rs558942043 1435 dbSNP
rs955266688 1439 dbSNP
rs1304995825 1449 dbSNP
rs769164592 1455 dbSNP
rs144869579 1458 dbSNP
rs986518330 1465 dbSNP
rs1437040186 1466 dbSNP
rs1269385782 1467 dbSNP
rs1337195795 1472 dbSNP
rs1443741764 1475 dbSNP
rs187527524 1491 dbSNP
rs372391257 1503 dbSNP
rs953616089 1505 dbSNP
rs1274880101 1513 dbSNP
rs115034455 1519 dbSNP
rs1413454782 1530 dbSNP
rs1425258646 1534 dbSNP
rs1046023 1537 dbSNP
rs1437765343 1539 dbSNP
rs1237422154 1547 dbSNP
rs766926302 1555 dbSNP
rs1481464737 1556 dbSNP
rs1054622959 1571 dbSNP
rs1234862365 1571 dbSNP
rs147586909 1572 dbSNP
rs914833465 1575 dbSNP
rs1236510360 1591 dbSNP
rs1352150298 1594 dbSNP
rs948747072 1600 dbSNP
rs1240781036 1602 dbSNP
rs879915796 1602 dbSNP
rs1044755799 1603 dbSNP
rs919318969 1604 dbSNP
rs537803678 1607 dbSNP
rs1187371268 1608 dbSNP
rs907203561 1615 dbSNP
rs752349934 1618 dbSNP
rs13457 1629 dbSNP
rs1300788322 1644 dbSNP
rs952121924 1647 dbSNP
rs1359322120 1648 dbSNP
rs1384880079 1657 dbSNP
rs1417277650 1659 dbSNP
rs1047855851 1671 dbSNP
rs576867675 1677 dbSNP
rs1159157440 1680 dbSNP
rs886925250 1696 dbSNP
rs983921649 1698 dbSNP
rs1422927448 1699 dbSNP
rs1004070425 1703 dbSNP
rs1253809071 1712 dbSNP
rs1180394008 1717 dbSNP
rs191585008 1721 dbSNP
rs909711960 1723 dbSNP
rs1366203057 1730 dbSNP
rs937231221 1739 dbSNP
rs1056111448 1740 dbSNP
rs1240387884 1744 dbSNP
rs184108056 1747 dbSNP
rs754481977 1762 dbSNP
rs563155405 1768 dbSNP
rs1228041673 1770 dbSNP
rs755846548 1777 dbSNP
rs1314279427 1780 dbSNP
rs1397647671 1782 dbSNP
rs531926147 1788 dbSNP
rs1028370070 1792 dbSNP
rs1455270509 1802 dbSNP
rs902904939 1804 dbSNP
rs1163810026 1808 dbSNP
rs1421793023 1814 dbSNP
rs955062082 1826 dbSNP
rs553128413 1831 dbSNP
rs986485476 1831 dbSNP
rs1381613769 1832 dbSNP
rs1243247372 1837 dbSNP
rs1054249655 1842 dbSNP
rs1262554657 1848 dbSNP
rs148766420 1848 dbSNP
rs59635105 1848 dbSNP
rs187734793 1863 dbSNP
rs1264165142 1869 dbSNP
rs924393165 1878 dbSNP
rs1221325247 1883 dbSNP
rs1205112138 1885 dbSNP
rs956190912 1886 dbSNP
rs990764216 1889 dbSNP
rs1294788241 1892 dbSNP
rs1282733689 1900 dbSNP
rs1339349968 1911 dbSNP
rs914753154 1914 dbSNP
rs1019596124 1916 dbSNP
rs11731839 1919 dbSNP
rs1388526724 1923 dbSNP
rs753569194 1924 dbSNP
rs1026327513 1930 dbSNP
rs562171307 1937 dbSNP
rs1167448691 1944 dbSNP
rs1209777588 1945 dbSNP
rs1423103433 1956 dbSNP
rs560087925 1957 dbSNP
rs1430333765 1970 dbSNP
rs1443018580 1971 dbSNP
rs1265943507 1976 dbSNP
rs952070762 1978 dbSNP
rs1469242880 1980 dbSNP
rs1275424030 1983 dbSNP
rs1185653324 1996 dbSNP
rs1369184220 2000 dbSNP
rs140783628 2002 dbSNP
rs1316924250 2009 dbSNP
rs1157964151 2013 dbSNP
rs1228997139 2015 dbSNP
rs1382732744 2015 dbSNP
rs11346220 2016 dbSNP
rs1168689030 2016 dbSNP
rs1366753120 2016 dbSNP
rs1375993626 2016 dbSNP
rs1399869283 2016 dbSNP
rs1463628219 2016 dbSNP
rs34717960 2016 dbSNP
rs796815135 2016 dbSNP
rs879212210 2016 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acucuguccAAG--UACGACGAUa 5'
                   |||  | ||||||| 
Target 5' --ccuuaauUUCAAAAGCUGCUAu 3'
 		1 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55300.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acucuguccAAG--UACGACGAUa 5'
                   |||  | ||||||| 
Target 5' --ccuuaauUUCAAAAGCUGCUAu 3'
 		1 - 22
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55300.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000264864.6 | 3UTR | CCUUAAUUUCAAAAGCUGCUAUUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000264864.6 | 3UTR | CCUUAAUUUCAAAAGCUGCUAUUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000264864.6 | 3UTR | CCUUAAUUUCAAAAGCUGCUAUUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
180 hsa-miR-4524a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055251 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT055826 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT060573 CCND1 cyclin D1 2 2
MIRT061013 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT064694 CCND2 cyclin D2 2 4
MIRT075268 SNTB2 syntrophin beta 2 2 4
MIRT079668 NAPG NSF attachment protein gamma 2 12
MIRT081651 CCNE1 cyclin E1 2 4
MIRT082996 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083463 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT085755 RIF1 replication timing regulatory factor 1 2 2
MIRT086022 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087431 ZNRF3 zinc and ring finger 3 2 2
MIRT088786 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT089221 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT093696 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095090 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT096249 CANX calnexin 2 2
MIRT100215 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100746 VEGFA vascular endothelial growth factor A 2 12
MIRT100904 CD2AP CD2 associated protein 2 2
MIRT102647 UBN2 ubinuclein 2 2 10
MIRT103882 FOXK1 forkhead box K1 2 2
MIRT104246 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106310 ZFHX4 zinc finger homeobox 4 2 6
MIRT107696 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT114943 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117671 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT133799 SKI SKI proto-oncogene 2 2
MIRT140167 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142279 DCTN5 dynactin subunit 5 2 8
MIRT143288 N4BP1 NEDD4 binding protein 1 2 2
MIRT165939 CREBRF CREB3 regulatory factor 2 2
MIRT175251 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT186381 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT191470 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT196480 TAOK1 TAO kinase 1 2 2
MIRT201470 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204615 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204646 MOB4 MOB family member 4, phocein 2 8
MIRT204749 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206031 NUP50 nucleoporin 50 2 6
MIRT211196 FGF2 fibroblast growth factor 2 2 4
MIRT229353 ZNF449 zinc finger protein 449 2 2
MIRT247138 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT249461 ZNF691 zinc finger protein 691 2 4
MIRT256314 CDC42SE2 CDC42 small effector 2 2 2
MIRT258419 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265083 CHEK1 checkpoint kinase 1 2 2
MIRT270561 SETD1B SET domain containing 1B 2 2
MIRT274749 RAB3IP RAB3A interacting protein 2 2
MIRT277515 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT289642 CBX2 chromobox 2 2 2
MIRT301001 MTMR3 myotubularin related protein 3 2 2
MIRT307149 CTDSPL CTD small phosphatase like 2 4
MIRT309021 USP53 ubiquitin specific peptidase 53 2 2
MIRT314100 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT319338 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320619 ZNRF2 zinc and ring finger 2 2 2
MIRT324285 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT446498 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT448437 TLL1 tolloid like 1 2 2
MIRT461537 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463162 ZNF367 zinc finger protein 367 2 10
MIRT463493 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT465154 TSC22D2 TSC22 domain family member 2 2 2
MIRT466418 TFAP2A transcription factor AP-2 alpha 2 8
MIRT468278 SFT2D2 SFT2 domain containing 2 2 2
MIRT469399 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471941 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT473688 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT479618 CDC25A cell division cycle 25A 2 2
MIRT482098 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483995 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485205 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT498763 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT498961 ORC4 origin recognition complex subunit 4 2 8
MIRT499440 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500080 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500305 ZNF622 zinc finger protein 622 2 8
MIRT500410 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500789 TLK1 tousled like kinase 1 2 6
MIRT500930 SRPR SRP receptor alpha subunit 2 6
MIRT500943 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501068 SMAD7 SMAD family member 7 2 8
MIRT501711 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT502627 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502910 CDCA4 cell division cycle associated 4 2 8
MIRT502935 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504531 ZNF620 zinc finger protein 620 2 6
MIRT505106 YTHDC1 YTH domain containing 1 2 6
MIRT505337 TMEM245 transmembrane protein 245 2 6
MIRT505383 TMEM100 transmembrane protein 100 2 2
MIRT505678 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506157 PLAG1 PLAG1 zinc finger 2 8
MIRT506183 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506475 MYO5A myosin VA 2 6
MIRT506826 KIF23 kinesin family member 23 2 6
MIRT507160 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT507511 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT507845 CCNE2 cyclin E2 2 6
MIRT510403 ZNF507 zinc finger protein 507 2 2
MIRT518078 TRIM35 tripartite motif containing 35 2 2
MIRT518982 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521045 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521190 SBNO1 strawberry notch homolog 1 2 6
MIRT522088 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT524846 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT527787 TMEM44 transmembrane protein 44 2 4
MIRT537803 EFNB2 ephrin B2 2 4
MIRT540830 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541140 PISD phosphatidylserine decarboxylase 2 2
MIRT541419 CBX4 chromobox 4 2 2
MIRT543517 PRSS21 protease, serine 21 2 2
MIRT543824 GSG1 germ cell associated 1 2 2
MIRT544959 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545179 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545335 CCDC83 coiled-coil domain containing 83 2 2
MIRT545518 RSL24D1 ribosomal L24 domain containing 1 2 2
MIRT545670 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545931 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546102 USP48 ubiquitin specific peptidase 48 2 4
MIRT546598 SALL1 spalt like transcription factor 1 2 4
MIRT546626 RTN4 reticulon 4 2 2
MIRT547651 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547987 HCFC2 host cell factor C2 2 4
MIRT548717 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548931 CDK17 cyclin dependent kinase 17 2 2
MIRT549067 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549266 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT550460 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550806 FAM229B family with sequence similarity 229 member B 2 2
MIRT552024 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552334 ZNF704 zinc finger protein 704 2 2
MIRT552732 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553795 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554694 RNF149 ring finger protein 149 2 2
MIRT555133 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555264 PRDM4 PR/SET domain 4 2 2
MIRT556848 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557474 GPR27 G protein-coupled receptor 27 2 4
MIRT558018 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558498 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558579 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558610 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT558650 CNKSR3 CNKSR family member 3 2 2
MIRT558986 CA8 carbonic anhydrase 8 2 2
MIRT559141 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559327 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT562021 LANCL1 LanC like 1 2 2
MIRT562869 KIAA1456 KIAA1456 2 2
MIRT563074 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563496 DLGAP3 DLG associated protein 3 2 2
MIRT563890 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564311 CCNT1 cyclin T1 2 2
MIRT564942 XKR7 XK related 7 2 2
MIRT564979 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565423 TEF TEF, PAR bZIP transcription factor 2 2
MIRT566824 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571961 KIF5B kinesin family member 5B 2 2
MIRT575877 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT576523 Txlna taxilin alpha 2 2
MIRT614693 TRAK1 trafficking kinesin protein 1 2 2
MIRT616065 ZC3H14 zinc finger CCCH-type containing 14 2 2
MIRT618838 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT624626 ATXN2 ataxin 2 2 2
MIRT624652 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT640314 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT659248 CUL3 cullin 3 2 2
MIRT680972 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682261 RS1 retinoschisin 1 2 2
MIRT682505 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693904 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT699214 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT699373 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699451 SLC16A9 solute carrier family 16 member 9 2 2
MIRT701230 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT702849 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT706163 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT718990 UTP15 UTP15, small subunit processome component 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4524a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4524a-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission