pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548x |
Genomic Coordinates | chr21: 18686090 - 18686164 |
Description | Homo sapiens miR-548x stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548x-5p | |||||||||||||||
Sequence | 8| UGCAAAAGUAAUUGCAGUUUUUG |30 | |||||||||||||||
Evidence | Not_experimental | |||||||||||||||
Experiments | ||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PAICS | ||||||||||||||||||||
Synonyms | ADE2, ADE2H1, AIRC, PAIS | ||||||||||||||||||||
Description | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ||||||||||||||||||||
Transcript | NM_001079524 | ||||||||||||||||||||
Other Transcripts | NM_001079525 , NM_006452 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PAICS | |||||||||||||||||||||
3'UTR of PAICS (miRNA target sites are highlighted) |
>PAICS|NM_001079524|3'UTR 1 GAAAGAATGCCATTGAATTTTTTAGGGGAAAAACTACAAATTTCTAATTTAGCTGAAGGAAAATCAAGCAAGATGAAAAG 81 GTAATTTTAAATTAGAGAACACAAATAAAATGTATTAGTGAATAAATGCTTCTCTAGATCCATATTAATAAACATGAGCA 161 TCTAACCCCTCCTTTCTTAGGCTAGACACCAAGATATTTCAGCCAGCCTTTATCATTCCTCTTACTTTATCCTTTTTCCT 241 TAAGTATTGGTGGTCACTACTATTGAGTTTCTTCCTTAACACTGATTAAATGATCTTAACTCCCTCAGCTAAAACTGGCA 321 TTACTGACTCCCAGCTATATTTCTCCAGACTTGCATTTTTTTTTTTTTTTTTGAGACAGGGTCTCACTGTCGCCCAGGCT 401 GGAGTGCAGTGGCGTGATCTCAGTTCACTGCTGCTTTCCCTCCTGGGCTCAAGCAGTTCTCCCACCTCAGCCTCTCGACT 481 AACAGGGACTATAATCTTGCAGCACCATGCCGAGCTAATTTTATTTTTTGTAGAGATGAGCTCTCACTATGTCACCCAGG 561 TTCGTCTCAAACTCCTGAACCCTAGTAATTCTCCTATCTCAGCCTCCCAAAGTGCTAGGGTTACAGACATGAGCCACTGT 641 GCCTGTCTAGACTTGTACTTTCAACTGTCCATTTCTCCCTGTCTGTCCCATGGGCACTCATGAAAAAACAGAATGCTCCC 721 AACTTTATTCATCTTCCAAGCCTGTAGCTCTTGGTATACTCACTGTTGCAAGTCAGAAGCTTGATTTCATCATTGATGTT 801 TTTCTCACGTTTCACATCTCACTCATCACCAAGTCATGTTGGTGTTAATTTCTGATTAACCCTTGAATTTACCGTCTTCT 881 CATCCTCTGTACAAAAGCCTCAAGTGAGGGTCAAATTCAACATTATCCTGATCTAGACAGCCCCCATTCTCAATCCACCC 961 TTTTCCAAGTTGATTGCCCAAGGACTTCTAACAATAAACTCTCTTTTGCACCACAGACTTCTTTGAAAATATACATGCTG 1041 TTGACCCTCTCTGTAGAAAACCGCACACATAAAACTTACCAACAGATTTCATTGGTTCTTGGGTTCTCCCGAAGCCTATC 1121 CATGGTTTATAGATTAAGAATTGATGAGGTAGCTGGGCACAGTGGCTCACACCTACGATCACAGCACTTCGGGAGGCTGA 1201 AGCAAGCAGATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAA 1281 AAAGTAGCCAGCCGTGATGACAGGCACCTGTAATCCCAGCTACTCGGGAGGCTGAGGCATGAGAATTGCTTGAACCCGGG 1361 AGGCGGAGGTTGCAGTGAGCCTAGATCATGCCACTGCACTCCAACCTGGGCAGCAGAGCAAGACTCTGTCTCAAAAGGGG 1441 AAAAAAAAAATTGCTGATGTGACCCATGAAGGGAACTCATTTTCCTCGTAATTTTGGACTGCCACACATTGGTACCTTTA 1521 GTTCTCTGAAGGCCCACGTTTTTATCATTAAGACCTATTTGTTAGCTAGTAGAGCTTTATGTTCGCTGTCCATGAAACCT 1601 TCTGTAACCACAGTGACTACAAGTAGTTCTTTCTCTATTGAATTATTAGGTCCAGAATAGAAGATGTCATTGTACACTTT 1681 ATTTCCCTCACACTGTGTTATGCTCTGATGTGCTATGCTTAGCTATCTGTCAGAGATTAGTAAATTATAAAACTCATGTG 1761 TACTACTTAAGTTTATATCTTATGCTAGTTTATAAGAACAATTAAAAGGACTTAGAAGATTAACTTTGGTAAAAAAAAAA 1841 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 10606.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000264221.2 | 3UTR | ACUUCUAACAAUAAACUCUCUUUUGCACCACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000264221.2 | 3UTR | ACUUCUAACAAUAAACUCUCUUUUGCACCACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000264221.2 | 3UTR | ACUUCUAACAAUAAACUCUCUUUUGCACCACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
249 hsa-miR-548x-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT057505 | CEP55 | centrosomal protein 55 | 2 | 4 | ||||||||
MIRT060830 | CEP350 | centrosomal protein 350 | 2 | 4 | ||||||||
MIRT062721 | MLEC | malectin | 2 | 4 | ||||||||
MIRT064767 | CCND2 | cyclin D2 | 2 | 8 | ||||||||
MIRT075338 | SF3B3 | splicing factor 3b subunit 3 | 2 | 2 | ||||||||
MIRT080209 | PRKACB | protein kinase cAMP-activated catalytic subunit beta | 2 | 2 | ||||||||
MIRT080238 | SMAD4 | SMAD family member 4 | 2 | 6 | ||||||||
MIRT087397 | AGFG1 | ArfGAP with FG repeats 1 | 2 | 4 | ||||||||
MIRT088230 | GRAMD4 | GRAM domain containing 4 | 2 | 2 | ||||||||
MIRT089495 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | 2 | 6 | ||||||||
MIRT091224 | USP13 | ubiquitin specific peptidase 13 | 2 | 2 | ||||||||
MIRT092960 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 | 2 | 4 | ||||||||
MIRT094093 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | 2 | 4 | ||||||||
MIRT097470 | PAPD4 | poly(A) RNA polymerase D4, non-canonical | 2 | 2 | ||||||||
MIRT102253 | HBP1 | HMG-box transcription factor 1 | 2 | 4 | ||||||||
MIRT105441 | ATP6V1B2 | ATPase H+ transporting V1 subunit B2 | 2 | 10 | ||||||||
MIRT107289 | FAM73B | mitoguardin 2 | 2 | 2 | ||||||||
MIRT113586 | ZDHHC18 | zinc finger DHHC-type containing 18 | 2 | 2 | ||||||||
MIRT113887 | KPNA6 | karyopherin subunit alpha 6 | 2 | 6 | ||||||||
MIRT126459 | ARL5B | ADP ribosylation factor like GTPase 5B | 2 | 2 | ||||||||
MIRT135026 | ADSS | adenylosuccinate synthase | 2 | 6 | ||||||||
MIRT139893 | BTF3L4 | basic transcription factor 3 like 4 | 2 | 6 | ||||||||
MIRT149712 | LDLR | low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT163234 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | 2 | 2 | ||||||||
MIRT165202 | GRAMD3 | GRAM domain containing 2B | 2 | 2 | ||||||||
MIRT172173 | FZD6 | frizzled class receptor 6 | 2 | 8 | ||||||||
MIRT177397 | ZMYND11 | zinc finger MYND-type containing 11 | 2 | 2 | ||||||||
MIRT179430 | TBRG1 | transforming growth factor beta regulator 1 | 2 | 6 | ||||||||
MIRT195619 | FAM195A | MAPK regulated corepressor interacting protein 2 | 2 | 6 | ||||||||
MIRT208729 | MED12L | mediator complex subunit 12 like | 2 | 6 | ||||||||
MIRT211511 | ELMOD2 | ELMO domain containing 2 | 2 | 2 | ||||||||
MIRT213435 | MOB1B | MOB kinase activator 1B | 2 | 6 | ||||||||
MIRT240123 | NDRG1 | N-myc downstream regulated 1 | 2 | 2 | ||||||||
MIRT243103 | LCLAT1 | lysocardiolipin acyltransferase 1 | 2 | 4 | ||||||||
MIRT247389 | HCFC2 | host cell factor C2 | 2 | 4 | ||||||||
MIRT248058 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT249459 | ZNF691 | zinc finger protein 691 | 2 | 4 | ||||||||
MIRT253422 | EVI5L | ecotropic viral integration site 5 like | 2 | 2 | ||||||||
MIRT254149 | ETS2 | ETS proto-oncogene 2, transcription factor | 2 | 2 | ||||||||
MIRT258908 | LAPTM4B | lysosomal protein transmembrane 4 beta | 2 | 4 | ||||||||
MIRT259394 | SLC6A8 | solute carrier family 6 member 8 | 2 | 4 | ||||||||
MIRT266973 | LRRC55 | leucine rich repeat containing 55 | 2 | 4 | ||||||||
MIRT279002 | GMFB | glia maturation factor beta | 2 | 10 | ||||||||
MIRT288803 | KCNJ2 | potassium voltage-gated channel subfamily J member 2 | 2 | 2 | ||||||||
MIRT325680 | ZNF367 | zinc finger protein 367 | 2 | 2 | ||||||||
MIRT330544 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | 2 | 4 | ||||||||
MIRT334273 | RCC2 | regulator of chromosome condensation 2 | 2 | 2 | ||||||||
MIRT350226 | PRNP | prion protein | 2 | 2 | ||||||||
MIRT400513 | SKIL | SKI like proto-oncogene | 2 | 10 | ||||||||
MIRT405640 | WBP4 | WW domain binding protein 4 | 2 | 4 | ||||||||
MIRT408652 | QKI | QKI, KH domain containing RNA binding | 2 | 2 | ||||||||
MIRT444160 | ZNF701 | zinc finger protein 701 | 2 | 2 | ||||||||
MIRT444508 | ZNF525 | zinc finger protein 525 | 2 | 2 | ||||||||
MIRT445208 | CRYBG3 | crystallin beta-gamma domain containing 3 | 2 | 2 | ||||||||
MIRT446843 | FOXP1 | forkhead box P1 | 2 | 2 | ||||||||
MIRT449025 | ADRB1 | adrenoceptor beta 1 | 2 | 2 | ||||||||
MIRT450745 | POLI | DNA polymerase iota | 2 | 4 | ||||||||
MIRT450792 | OTUD7A | OTU deubiquitinase 7A | 2 | 2 | ||||||||
MIRT454915 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | 2 | 12 | ||||||||
MIRT455265 | DDX39B | DExD-box helicase 39B | 2 | 10 | ||||||||
MIRT455714 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | 2 | 2 | ||||||||
MIRT456097 | MB21D1 | Mab-21 domain containing 1 | 2 | 6 | ||||||||
MIRT463634 | YY1 | YY1 transcription factor | 2 | 8 | ||||||||
MIRT463890 | WNT7B | Wnt family member 7B | 2 | 2 | ||||||||
MIRT466261 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | 2 | 4 | ||||||||
MIRT466819 | STX6 | syntaxin 6 | 2 | 6 | ||||||||
MIRT466878 | STX16 | syntaxin 16 | 2 | 2 | ||||||||
MIRT467523 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | 2 | 6 | ||||||||
MIRT468198 | SGK1 | serum/glucocorticoid regulated kinase 1 | 2 | 2 | ||||||||
MIRT468632 | SELT | selenoprotein T | 2 | 2 | ||||||||
MIRT470366 | PPP2R5E | protein phosphatase 2 regulatory subunit B'epsilon | 2 | 2 | ||||||||
MIRT470997 | PITPNA | phosphatidylinositol transfer protein alpha | 2 | 2 | ||||||||
MIRT471558 | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | 2 | 6 | ||||||||
MIRT472276 | NFIB | nuclear factor I B | 2 | 4 | ||||||||
MIRT472757 | MTMR6 | myotubularin related protein 6 | 2 | 8 | ||||||||
MIRT474718 | KIF13A | kinesin family member 13A | 2 | 6 | ||||||||
MIRT475868 | H3F3C | H3 histone family member 3C | 2 | 10 | ||||||||
MIRT475902 | H3F3B | H3 histone family member 3B | 2 | 8 | ||||||||
MIRT477349 | EOGT | EGF domain specific O-linked N-acetylglucosamine transferase | 2 | 4 | ||||||||
MIRT477485 | ELL2 | elongation factor for RNA polymerase II 2 | 2 | 2 | ||||||||
MIRT478095 | DLG5 | discs large MAGUK scaffold protein 5 | 2 | 6 | ||||||||
MIRT479804 | CCNA2 | cyclin A2 | 2 | 6 | ||||||||
MIRT480812 | BLCAP | bladder cancer associated protein | 2 | 10 | ||||||||
MIRT481946 | ANKRD11 | ankyrin repeat domain 11 | 2 | 2 | ||||||||
MIRT483059 | EXT2 | exostosin glycosyltransferase 2 | 2 | 6 | ||||||||
MIRT484142 | LRRC45 | leucine rich repeat containing 45 | 2 | 4 | ||||||||
MIRT484903 | ZFYVE26 | zinc finger FYVE-type containing 26 | 2 | 4 | ||||||||
MIRT485079 | SOX4 | SRY-box 4 | 2 | 10 | ||||||||
MIRT485638 | DICER1 | dicer 1, ribonuclease III | 2 | 4 | ||||||||
MIRT485797 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 2 | ||||||||
MIRT486270 | SEC23A | Sec23 homolog A, coat complex II component | 2 | 2 | ||||||||
MIRT486739 | CNOT4 | CCR4-NOT transcription complex subunit 4 | 2 | 6 | ||||||||
MIRT487166 | LFNG | LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase | 2 | 2 | ||||||||
MIRT491641 | PDRG1 | p53 and DNA damage regulated 1 | 2 | 10 | ||||||||
MIRT491933 | WDR45B | WD repeat domain 45B | 2 | 8 | ||||||||
MIRT492231 | SLC48A1 | solute carrier family 48 member 1 | 2 | 2 | ||||||||
MIRT493088 | MMGT1 | membrane magnesium transporter 1 | 2 | 12 | ||||||||
MIRT494478 | BRWD3 | bromodomain and WD repeat domain containing 3 | 2 | 2 | ||||||||
MIRT494985 | ROCK1 | Rho associated coiled-coil containing protein kinase 1 | 2 | 2 | ||||||||
MIRT495670 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT498466 | PTBP2 | polypyrimidine tract binding protein 2 | 2 | 10 | ||||||||
MIRT499267 | NBPF11 | NBPF member 11 | 2 | 2 | ||||||||
MIRT499853 | SVOP | SV2 related protein | 2 | 12 | ||||||||
MIRT500306 | ZNF622 | zinc finger protein 622 | 2 | 8 | ||||||||
MIRT500639 | TUBB2A | tubulin beta 2A class IIa | 2 | 8 | ||||||||
MIRT501221 | SEMA4C | semaphorin 4C | 2 | 6 | ||||||||
MIRT501525 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | 2 | 8 | ||||||||
MIRT501568 | PLEKHF2 | pleckstrin homology and FYVE domain containing 2 | 2 | 4 | ||||||||
MIRT502429 | G3BP2 | G3BP stress granule assembly factor 2 | 2 | 10 | ||||||||
MIRT502966 | CCNL1 | cyclin L1 | 2 | 8 | ||||||||
MIRT503469 | ZNF154 | zinc finger protein 154 | 2 | 6 | ||||||||
MIRT504571 | ERCC4 | ERCC excision repair 4, endonuclease catalytic subunit | 2 | 4 | ||||||||
MIRT504955 | ZNRF2 | zinc and ring finger 2 | 2 | 6 | ||||||||
MIRT505205 | UBN2 | ubinuclein 2 | 2 | 8 | ||||||||
MIRT505237 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | 2 | 2 | ||||||||
MIRT507569 | DEK | DEK proto-oncogene | 2 | 2 | ||||||||
MIRT509411 | MCM7 | minichromosome maintenance complex component 7 | 2 | 6 | ||||||||
MIRT510714 | SPG20 | spartin | 2 | 6 | ||||||||
MIRT510858 | RAN | RAN, member RAS oncogene family | 2 | 8 | ||||||||
MIRT510913 | PSMA2 | proteasome subunit alpha 2 | 2 | 4 | ||||||||
MIRT510943 | PPTC7 | PTC7 protein phosphatase homolog | 2 | 8 | ||||||||
MIRT511071 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | 2 | 4 | ||||||||
MIRT511212 | LNPEP | leucyl and cystinyl aminopeptidase | 2 | 4 | ||||||||
MIRT511958 | ELOVL5 | ELOVL fatty acid elongase 5 | 2 | 6 | ||||||||
MIRT512122 | CREBL2 | cAMP responsive element binding protein like 2 | 2 | 8 | ||||||||
MIRT513685 | RNF111 | ring finger protein 111 | 2 | 2 | ||||||||
MIRT513895 | GRB10 | growth factor receptor bound protein 10 | 2 | 6 | ||||||||
MIRT516304 | F8A2 | coagulation factor VIII associated 2 | 2 | 2 | ||||||||
MIRT516330 | F8A3 | coagulation factor VIII associated 3 | 2 | 2 | ||||||||
MIRT517520 | ITM2C | integral membrane protein 2C | 2 | 6 | ||||||||
MIRT517929 | IMPA1 | inositol monophosphatase 1 | 2 | 2 | ||||||||
MIRT521367 | RNF11 | ring finger protein 11 | 2 | 6 | ||||||||
MIRT525191 | ZNF93 | zinc finger protein 93 | 2 | 2 | ||||||||
MIRT527215 | CCNL2 | cyclin L2 | 2 | 2 | ||||||||
MIRT527834 | NUPL1 | nucleoporin 58 | 2 | 2 | ||||||||
MIRT529432 | MALT1 | MALT1 paracaspase | 2 | 2 | ||||||||
MIRT530165 | C11orf44 | chromosome 11 open reading frame 44 | 2 | 4 | ||||||||
MIRT530514 | C4orf32 | family with sequence similarity 241 member A | 2 | 4 | ||||||||
MIRT532371 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT533854 | TEAD1 | TEA domain transcription factor 1 | 2 | 2 | ||||||||
MIRT534749 | RAVER2 | ribonucleoprotein, PTB binding 2 | 2 | 4 | ||||||||
MIRT534794 | RAB8B | RAB8B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT538601 | CDK19 | cyclin dependent kinase 19 | 2 | 2 | ||||||||
MIRT539246 | ANKRD50 | ankyrin repeat domain 50 | 2 | 2 | ||||||||
MIRT539466 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | 2 | 2 | ||||||||
MIRT543099 | TNFRSF11A | TNF receptor superfamily member 11a | 2 | 2 | ||||||||
MIRT543896 | ESYT1 | extended synaptotagmin 1 | 2 | 2 | ||||||||
MIRT544979 | MFF | mitochondrial fission factor | 2 | 4 | ||||||||
MIRT545793 | ZNF772 | zinc finger protein 772 | 2 | 4 | ||||||||
MIRT546008 | WDR26 | WD repeat domain 26 | 2 | 4 | ||||||||
MIRT546377 | STOX2 | storkhead box 2 | 2 | 4 | ||||||||
MIRT546680 | RORA | RAR related orphan receptor A | 2 | 4 | ||||||||
MIRT546946 | SFTPA1 | surfactant protein A1 | 2 | 2 | ||||||||
MIRT547033 | POGZ | pogo transposable element derived with ZNF domain | 2 | 2 | ||||||||
MIRT547396 | MKX | mohawk homeobox | 2 | 2 | ||||||||
MIRT547469 | MBNL3 | muscleblind like splicing regulator 3 | 2 | 4 | ||||||||
MIRT547500 | MBNL1 | muscleblind like splicing regulator 1 | 2 | 4 | ||||||||
MIRT548076 | GIGYF1 | GRB10 interacting GYF protein 1 | 2 | 2 | ||||||||
MIRT548499 | E2F8 | E2F transcription factor 8 | 2 | 2 | ||||||||
MIRT548882 | CHEK2 | checkpoint kinase 2 | 2 | 4 | ||||||||
MIRT549062 | CALM1 | calmodulin 1 | 2 | 2 | ||||||||
MIRT549165 | BMP3 | bone morphogenetic protein 3 | 2 | 2 | ||||||||
MIRT549309 | ARHGAP12 | Rho GTPase activating protein 12 | 2 | 4 | ||||||||
MIRT549344 | ARC | activity regulated cytoskeleton associated protein | 2 | 2 | ||||||||
MIRT549474 | ACBD5 | acyl-CoA binding domain containing 5 | 2 | 2 | ||||||||
MIRT549677 | ZNF598 | zinc finger protein 598 | 2 | 2 | ||||||||
MIRT550208 | MAVS | mitochondrial antiviral signaling protein | 2 | 4 | ||||||||
MIRT550355 | INCENP | inner centromere protein | 2 | 4 | ||||||||
MIRT550530 | MYZAP | myocardial zonula adherens protein | 2 | 2 | ||||||||
MIRT551155 | ZNF678 | zinc finger protein 678 | 2 | 2 | ||||||||
MIRT552310 | ZXDA | zinc finger, X-linked, duplicated A | 2 | 4 | ||||||||
MIRT552879 | WASL | Wiskott-Aldrich syndrome like | 2 | 4 | ||||||||
MIRT553382 | TRIM33 | tripartite motif containing 33 | 2 | 2 | ||||||||
MIRT554452 | SAMD8 | sterile alpha motif domain containing 8 | 2 | 2 | ||||||||
MIRT554867 | RCAN2 | regulator of calcineurin 2 | 2 | 2 | ||||||||
MIRT556021 | MYBL1 | MYB proto-oncogene like 1 | 2 | 2 | ||||||||
MIRT556174 | MCC | mutated in colorectal cancers | 2 | 2 | ||||||||
MIRT556237 | MARCKS | myristoylated alanine rich protein kinase C substrate | 2 | 2 | ||||||||
MIRT556877 | ITGA2 | integrin subunit alpha 2 | 2 | 2 | ||||||||
MIRT557574 | GNPTAB | N-acetylglucosamine-1-phosphate transferase alpha and beta subunits | 2 | 2 | ||||||||
MIRT557689 | GATA6 | GATA binding protein 6 | 2 | 2 | ||||||||
MIRT557905 | FBXO8 | F-box protein 8 | 2 | 2 | ||||||||
MIRT558131 | ENPP4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) | 2 | 2 | ||||||||
MIRT558480 | DBN1 | drebrin 1 | 2 | 2 | ||||||||
MIRT558743 | CHIC1 | cysteine rich hydrophobic domain 1 | 2 | 2 | ||||||||
MIRT558759 | CFL2 | cofilin 2 | 2 | 2 | ||||||||
MIRT559121 | C11orf57 | chromosome 11 open reading frame 57 | 2 | 2 | ||||||||
MIRT559405 | GDNF | glial cell derived neurotrophic factor | 2 | 4 | ||||||||
MIRT559475 | ARL8A | ADP ribosylation factor like GTPase 8A | 2 | 2 | ||||||||
MIRT559676 | AGO3 | argonaute 3, RISC catalytic component | 2 | 2 | ||||||||
MIRT560048 | ZNF680 | zinc finger protein 680 | 2 | 2 | ||||||||
MIRT560644 | ZNF107 | zinc finger protein 107 | 2 | 2 | ||||||||
MIRT562580 | CBX3 | chromobox 3 | 2 | 2 | ||||||||
MIRT564187 | CLVS2 | clavesin 2 | 2 | 2 | ||||||||
MIRT564529 | SNRPD3 | small nuclear ribonucleoprotein D3 polypeptide | 2 | 2 | ||||||||
MIRT564539 | CCDC80 | coiled-coil domain containing 80 | 2 | 2 | ||||||||
MIRT565288 | TMPPE | transmembrane protein with metallophosphoesterase domain | 2 | 2 | ||||||||
MIRT565314 | TMEM41A | transmembrane protein 41A | 2 | 2 | ||||||||
MIRT565949 | RRAGD | Ras related GTP binding D | 2 | 2 | ||||||||
MIRT566632 | NFYA | nuclear transcription factor Y subunit alpha | 2 | 4 | ||||||||
MIRT566817 | MAPK8 | mitogen-activated protein kinase 8 | 2 | 2 | ||||||||
MIRT567528 | FGFR1OP | FGFR1 oncogene partner | 2 | 2 | ||||||||
MIRT568630 | ACVR2A | activin A receptor type 2A | 2 | 2 | ||||||||
MIRT572140 | DESI1 | desumoylating isopeptidase 1 | 2 | 2 | ||||||||
MIRT616028 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | 2 | 4 | ||||||||
MIRT620047 | ODF4 | outer dense fiber of sperm tails 4 | 2 | 2 | ||||||||
MIRT620530 | AVPR1A | arginine vasopressin receptor 1A | 2 | 2 | ||||||||
MIRT621877 | TAOK3 | TAO kinase 3 | 2 | 2 | ||||||||
MIRT623241 | MLLT6 | MLLT6, PHD finger containing | 2 | 2 | ||||||||
MIRT623993 | FAM104A | family with sequence similarity 104 member A | 2 | 2 | ||||||||
MIRT624300 | COL12A1 | collagen type XII alpha 1 chain | 2 | 2 | ||||||||
MIRT626282 | PEX26 | peroxisomal biogenesis factor 26 | 2 | 2 | ||||||||
MIRT627770 | RAB30 | RAB30, member RAS oncogene family | 2 | 2 | ||||||||
MIRT641138 | ZBTB33 | zinc finger and BTB domain containing 33 | 2 | 2 | ||||||||
MIRT644586 | SPOP | speckle type BTB/POZ protein | 2 | 2 | ||||||||
MIRT644819 | DNAJC21 | DnaJ heat shock protein family (Hsp40) member C21 | 2 | 2 | ||||||||
MIRT645970 | NHLRC2 | NHL repeat containing 2 | 2 | 2 | ||||||||
MIRT646170 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT646495 | ZNF429 | zinc finger protein 429 | 2 | 2 | ||||||||
MIRT647833 | RAB23 | RAB23, member RAS oncogene family | 2 | 2 | ||||||||
MIRT648462 | CCDC127 | coiled-coil domain containing 127 | 2 | 2 | ||||||||
MIRT657280 | HRK | harakiri, BCL2 interacting protein | 2 | 2 | ||||||||
MIRT658643 | ENAH | ENAH, actin regulator | 2 | 2 | ||||||||
MIRT658676 | EMP2 | epithelial membrane protein 2 | 2 | 2 | ||||||||
MIRT665228 | ZZZ3 | zinc finger ZZ-type containing 3 | 2 | 2 | ||||||||
MIRT669276 | C19orf44 | chromosome 19 open reading frame 44 | 2 | 2 | ||||||||
MIRT676047 | AUTS8 | Autism, susceptibility to, 8 | 2 | 2 | ||||||||
MIRT681483 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT681554 | UBXN2A | UBX domain protein 2A | 2 | 2 | ||||||||
MIRT683142 | MTHFD1 | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | 2 | 2 | ||||||||
MIRT688534 | DCAF7 | DDB1 and CUL4 associated factor 7 | 2 | 2 | ||||||||
MIRT689428 | CYB561 | cytochrome b561 | 2 | 2 | ||||||||
MIRT689534 | KIAA0513 | KIAA0513 | 2 | 2 | ||||||||
MIRT689894 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT695989 | SNX19 | sorting nexin 19 | 2 | 2 | ||||||||
MIRT697780 | UBXN7 | UBX domain protein 7 | 2 | 2 | ||||||||
MIRT702914 | CRAMP1L | cramped chromatin regulator homolog 1 | 2 | 2 | ||||||||
MIRT703144 | GPR137C | G protein-coupled receptor 137C | 2 | 2 | ||||||||
MIRT703524 | FKBP15 | FK506 binding protein 15 | 2 | 2 | ||||||||
MIRT704536 | CNEP1R1 | CTD nuclear envelope phosphatase 1 regulatory subunit 1 | 2 | 2 | ||||||||
MIRT704997 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | 2 | 2 | ||||||||
MIRT705721 | AMMECR1L | AMMECR1 like | 2 | 2 | ||||||||
MIRT707120 | NWD1 | NACHT and WD repeat domain containing 1 | 2 | 2 | ||||||||
MIRT707451 | PPFIBP1 | PPFIA binding protein 1 | 2 | 2 | ||||||||
MIRT707775 | WNK3 | WNK lysine deficient protein kinase 3 | 2 | 2 | ||||||||
MIRT707888 | SLC30A7 | solute carrier family 30 member 7 | 2 | 2 | ||||||||
MIRT720531 | CHERP | calcium homeostasis endoplasmic reticulum protein | 2 | 2 | ||||||||
MIRT723859 | CD209 | CD209 molecule | 2 | 2 | ||||||||
MIRT725349 | MUC21 | mucin 21, cell surface associated | 2 | 2 |