pre-miRNA Information
pre-miRNA hsa-mir-4524a   
Genomic Coordinates chr17: 69099564 - 69099632
Description Homo sapiens miR-4524a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524a-5p
Sequence 6| AUAGCAGCAUGAACCUGUCUCA |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322445998 8 dbSNP
rs1350790266 13 dbSNP
rs1263495678 21 dbSNP
Putative Targets

Gene Information
Gene Symbol SEC24A   
Synonyms -
Description SEC24 homolog A, COPII coat complex component
Transcript NM_021982   
Expression
Putative miRNA Targets on SEC24A
3'UTR of SEC24A
(miRNA target sites are highlighted)
>SEC24A|NM_021982|3'UTR
   1 ATGAATGAAGAAATTTGACTTATTTTTAAGGAATGTCACGATAGTGCAGAATACCTGGAAATGTGTAATACCTTCTTTTT
  81 CTATTATGTTTGTGGACTAATGTGATGATTGAGATGTTCTCACTGTGATTTCAACAACCTATAGCAAATAAAAGACCACA
 161 GCAGAGAATCAAACATGCAACTCTGAAATACTGTATTTTTCAAATCAGAATATAGCTACGTATGATTGGATACTTTTTTC
 241 TTGCCAATTATGTTTGAGTTGTTATGGATTAAAATAAGAATATTGCAGAGGCAAAGTACATTTTGTAAAATAAAGATTTC
 321 TGTGTTCTACATGTATATTTCTCATTTTTAATTTTTCTGAATCTTTGGCTGCTACATTTAAAACCTCACAAACCTAAGTG
 401 TTGCAGGGAAGTTACAAATTGATTGGTAGTGATGTTTTTAAAATAAAAACAATGGAAAGTAAATATAATGTAGGAAAACT
 481 AGAATTCATTCCCCACACGTGTCTTTTTTTTTTCTTTGTTAAGGGAAAGGATCATGTTGACTAAAACTAAACTAATTCTA
 561 GTATAGCTTGAGAAAAATATGAAGAAACACATTCAAGCTTTAAAATCTGTCAGTATTCTTTATGCTTGAAGAACAAAGTC
 641 ACTTTGATTTGAAGTGAGAACTATCATTAGGTGGTTTTCTGATTTCCTGATGAAGAGTTGGACATACTGTCTTAATCTAT
 721 AGTGAAAAGAATTTGAGCTGTCTTCATAAACACTGGGACTAGCAATGATAATAGGGAGATAAGAAACTTTAATTATCTTG
 801 ATCCTTTAAGTGGATTTTATTTGGTGCATTTCTGCTCTGGGTATATAATAAAAGTGGGGGTTTTTGGTGAAATGAGTGAA
 881 GAAATGAAAGGTTTCTAAAGTGCTATCCAAATACATCAGTAACATTTTTCTAAGGAGTTTAATTGTTAAATTGGAAGTCA
 961 TTCATAAGAAATATTTATGCTTGAATATGAAAATCTATGAAAGCATAAATGCTGCTGTTTGATTTGGTGGATATTAAGAT
1041 TATACACATCCAACATATTAAAGTTATGAAAGAAACTTGACTTCTGAAAATCCTTAAGAGACTGCTTTCTTGATTCAGCT
1121 AGAGAAATATTATAGTCAAAACTATTGAGTGAATTTTGTTTACAAATAGGTAAATTATACATTTGTATATTTAAAGTGCT
1201 GTGACATAGTATCTTTAAGAGTTTGGCTCAGTTTTCACAGATTCATTTTGTCTTAAGAATTTCTTAAATATGTTCATGTA
1281 TAATACTTGATCAAAATATTTTTGGGTTTTTTGTTTTGTTTTAATGGGTTAGAAAATGTTTACAATCTTGGTCTTATATG
1361 ATCACCAATGGAATAGTAACTTCCAGGTTTATATCAATATGAGCTGACTTTAACTGAGTTGTTTGGGATAGGGAAGAAGC
1441 AGTCCCTCTACAGTATACAACTACTGCTTGCCAGCTGGATCAAAATAATCATGTTTTATGAAAATATCTCCCTTAAGCAG
1521 TGTTAAGGTTGGTTTGCAGTGTGTAAGTGGCACATTGAACTGGAAGTTTTCTTGAAAGCTGCTTCATCTATTAAGAAGCA
1601 ATTTTCAAATTGTAGCGAATTATATTATCCCCTCTTTTAAAGAAACAGTCGTTATATGCTGATGTTTCTTAAAATAACTA
1681 AAATGTTCCTCTTAATGTGATTTTAAATGGAGTTATTTGTAGGTCCTTTCTTAGTAGTAAAGAATCTTCTAGAGGGAAAC
1761 ATTTGTGCTTTTAGGGATAATCTTCCTTGTGCCTCACTACATCCCTAAGTGGGTATGACTCTTGTTATTACCACATGCTT
1841 TTTTAGTATATTTCACAAATTTACTTTTAAATATTATTTTAGATACGGTGTAACATGTGCAATTCAGAATAATTTTATAA
1921 CAGGTCATGAAAAACATAACTTTAGTTAGGATTCACAATATTTGTTCTCCACATAATGAGAGAATGAATGAGCCTTTGGA
2001 GATACTGATATAAGGCAATTATTTTTTGCAATGTTGAATGTGTTTTTTAGTTTGATTCTTTTTTTTTCCCCCAATAGGGC
2081 ACTACCTGCCATATCATCTTGTATTACTTTTTGATGTAAAGCGACTAATATTTACACTATGCCATATTTTTTTTAATTAT
2161 AGTTGTAAATTATGAAAGATCCTTGAATTTTCTACAGATCTACAACTACTAATGTAACAGACAAGGGCAATCTTGGTATT
2241 TAAATCTGAGCATGGCAGTTCTACCATAAAAAGTACTCTATTTTTCTAATTTCTAGGATTTTTAAAATAACATTTCTGTA
2321 AGTCTGACATACTAATAGTCACTCAAGCAGTACCATTTATTTTAGTTTGCATATATTTTCACTGTTTTTAATTTAATGTA
2401 TTGAGTCTAATAGACTGTTTTGCAATAATTAGAATAAAGATTTATTTCTTCTAATCAAAGATGCATAACAGCTATTATCT
2481 AGGGGACCACCAAATGTGATTTCAAAATTTTGTTAACTATTACAAATGTAATCCTTATATAGAAATTTTAATTTTGTAAA
2561 GTAGTGTATAATATTGTAATATTAAATTCTTGTTCTTAAATTCAAATATGTATTGATCTTCAATGTGCTGTGTTAAATCT
2641 TGCTTCTCTGAAAAGTTGGAGACAAGATTTGTCTTCCTTTTTACAGTTTGTAATTTTCACTGTTTTATTCCTGTTAAAAA
2721 AAAAAAAAAGTCATTTGTAACCCATGCAGACCATTGTTTGATCTATGCTAACTTATCAACTTGGCTATTCAATAAAGTTA
2801 ATTGAAAAGAGCTTATAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acuCUGUCCAAGUACGACGAUa 5'
             || |  ||:: ||||||| 
Target 5' tctGA-ATCTTTG-GCTGCTAc 3'
356 - 375 145.00 -8.60
2
miRNA  3' acuCUGUC-CAAGUACGACGAUa 5'
             || ||  |  ||||||||: 
Target 5' tatGAAAGCATAAATGCTGCTGt 3'
996 - 1018 139.00 -16.20
3
miRNA  3' acUCUGUCCAAGUACGAC-GAUa 5'
            :|| ||| |||||:|| ||| 
Target 5' agGGAAAGGATCATGTTGACTAa 3'
522 - 544 132.00 -19.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31534113 19 COSMIC
COSN510586 20 COSMIC
COSN29241057 167 COSMIC
COSN31538712 220 COSMIC
COSN31480265 225 COSMIC
COSN31593993 454 COSMIC
COSN31528004 488 COSMIC
COSN21427438 537 COSMIC
COSN20101824 550 COSMIC
COSN32057726 652 COSMIC
COSN30250936 854 COSMIC
COSN2071213 1323 COSMIC
COSN31588290 1362 COSMIC
COSN31490953 1417 COSMIC
COSN20777324 1501 COSMIC
COSN2071214 1589 COSMIC
COSN20828921 1589 COSMIC
COSN31572061 1887 COSMIC
COSN18000788 2022 COSMIC
COSN24301076 2026 COSMIC
COSN18002087 2043 COSMIC
COSN18004658 2059 COSMIC
COSN31611251 2068 COSMIC
COSN31561664 2069 COSMIC
COSN31579429 2073 COSMIC
COSN20891712 2088 COSMIC
COSN14789083 2102 COSMIC
COSN24877223 2155 COSMIC
COSN32058715 2155 COSMIC
COSN23240877 2198 COSMIC
COSN31529766 2590 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769184271 3 dbSNP
rs774670764 12 dbSNP
rs1423416972 24 dbSNP
rs748673398 29 dbSNP
rs1280647651 38 dbSNP
rs373289279 40 dbSNP
rs772495539 41 dbSNP
rs773723039 43 dbSNP
rs1026266799 47 dbSNP
rs760961523 52 dbSNP
rs1006629421 66 dbSNP
rs1193700241 73 dbSNP
rs1181611567 82 dbSNP
rs758890340 84 dbSNP
rs1206176866 91 dbSNP
rs1358792161 95 dbSNP
rs1289735879 100 dbSNP
rs1019817614 102 dbSNP
rs926657603 109 dbSNP
rs1357041285 110 dbSNP
rs938085608 119 dbSNP
rs534647193 120 dbSNP
rs1337347295 122 dbSNP
rs552704225 142 dbSNP
rs1404000940 146 dbSNP
rs567925242 149 dbSNP
rs1363127803 159 dbSNP
rs1165003060 167 dbSNP
rs1407560680 170 dbSNP
rs527577031 197 dbSNP
rs1158501084 213 dbSNP
rs1043004795 221 dbSNP
rs1162785158 229 dbSNP
rs1437491864 237 dbSNP
rs1490267545 240 dbSNP
rs1266850432 247 dbSNP
rs984504814 260 dbSNP
rs1034452087 262 dbSNP
rs1458957135 265 dbSNP
rs959069644 266 dbSNP
rs1288789684 273 dbSNP
rs1222514115 277 dbSNP
rs917786951 287 dbSNP
rs949190302 288 dbSNP
rs1286578262 289 dbSNP
rs535526566 291 dbSNP
rs1304594419 294 dbSNP
rs1436490033 297 dbSNP
rs901450707 299 dbSNP
rs557153229 304 dbSNP
rs977983527 306 dbSNP
rs934121527 312 dbSNP
rs1049892843 313 dbSNP
rs1399507515 316 dbSNP
rs1414647089 330 dbSNP
rs565349000 332 dbSNP
rs1480323002 335 dbSNP
rs1427383162 336 dbSNP
rs34628461 345 dbSNP
rs1193179324 366 dbSNP
rs936365236 376 dbSNP
rs1241642417 390 dbSNP
rs747709056 405 dbSNP
rs1053891670 406 dbSNP
rs150010229 411 dbSNP
rs1268508611 418 dbSNP
rs527786383 418 dbSNP
rs1037479984 430 dbSNP
rs1302902638 431 dbSNP
rs73297341 433 dbSNP
rs755797068 439 dbSNP
rs36047302 454 dbSNP
rs1267968424 475 dbSNP
rs1433513008 481 dbSNP
rs1245915184 483 dbSNP
rs1391399332 487 dbSNP
rs1316294597 499 dbSNP
rs1321816969 500 dbSNP
rs1026213471 502 dbSNP
rs1025919683 504 dbSNP
rs994297054 504 dbSNP
rs1323994114 511 dbSNP
rs1213789728 515 dbSNP
rs1418883711 519 dbSNP
rs1260201475 522 dbSNP
rs970637908 523 dbSNP
rs145165763 528 dbSNP
rs141234287 530 dbSNP
rs1033508421 531 dbSNP
rs959256458 534 dbSNP
rs201117126 546 dbSNP
rs112608734 548 dbSNP
rs200507067 548 dbSNP
rs10637666 550 dbSNP
rs200258447 551 dbSNP
rs1257592460 574 dbSNP
rs1210383244 581 dbSNP
rs958730261 583 dbSNP
rs915341979 584 dbSNP
rs967089286 585 dbSNP
rs978065370 586 dbSNP
rs1365337173 587 dbSNP
rs922822627 590 dbSNP
rs777525052 598 dbSNP
rs1050006241 602 dbSNP
rs1454006011 622 dbSNP
rs911372010 624 dbSNP
rs941568188 627 dbSNP
rs977868034 628 dbSNP
rs923786803 632 dbSNP
rs1337773385 635 dbSNP
rs936608701 646 dbSNP
rs115704486 652 dbSNP
rs749278201 657 dbSNP
rs1222564442 660 dbSNP
rs1162828434 664 dbSNP
rs898935472 668 dbSNP
rs993532984 670 dbSNP
rs1257994680 674 dbSNP
rs1182172170 681 dbSNP
rs1480188908 682 dbSNP
rs1306395701 686 dbSNP
rs1047419468 693 dbSNP
rs906236140 698 dbSNP
rs1342220000 699 dbSNP
rs748970497 700 dbSNP
rs1245883910 702 dbSNP
rs1261456952 705 dbSNP
rs1396909858 710 dbSNP
rs72800329 710 dbSNP
rs1373097538 713 dbSNP
rs1306357191 714 dbSNP
rs1202852288 720 dbSNP
rs188327885 727 dbSNP
rs959437648 738 dbSNP
rs1371210905 740 dbSNP
rs1010758363 743 dbSNP
rs1484197098 747 dbSNP
rs1165433473 752 dbSNP
rs1022761147 753 dbSNP
rs1047289850 756 dbSNP
rs371081504 758 dbSNP
rs1483219731 766 dbSNP
rs1347022334 773 dbSNP
rs978181724 780 dbSNP
rs1219552466 790 dbSNP
rs796831344 796 dbSNP
rs774083232 798 dbSNP
rs1160695711 799 dbSNP
rs1267715885 802 dbSNP
rs1246196976 804 dbSNP
rs1316674808 811 dbSNP
rs955398526 815 dbSNP
rs1426824784 820 dbSNP
rs1351277527 823 dbSNP
rs985664655 824 dbSNP
rs1034597489 825 dbSNP
rs894471528 829 dbSNP
rs778656759 841 dbSNP
rs1014187563 848 dbSNP
rs1386172765 852 dbSNP
rs911493017 854 dbSNP
rs745805111 858 dbSNP
rs1472806102 862 dbSNP
rs771952630 873 dbSNP
rs1200875312 881 dbSNP
rs1428086063 887 dbSNP
rs563224144 888 dbSNP
rs193297089 891 dbSNP
rs1434349904 892 dbSNP
rs1267501747 900 dbSNP
rs530347231 901 dbSNP
rs551882959 903 dbSNP
rs143625522 904 dbSNP
rs1374190095 920 dbSNP
rs1485865835 941 dbSNP
rs1411792099 954 dbSNP
rs745730260 959 dbSNP
rs998877922 964 dbSNP
rs1281431159 969 dbSNP
rs1282828000 999 dbSNP
rs1231397803 1006 dbSNP
rs1332871924 1010 dbSNP
rs929035776 1015 dbSNP
rs1031291279 1016 dbSNP
rs1224284279 1018 dbSNP
rs528330420 1019 dbSNP
rs1313687409 1025 dbSNP
rs1457539784 1028 dbSNP
rs1047534036 1029 dbSNP
rs1170424856 1040 dbSNP
rs906182213 1054 dbSNP
rs1202390891 1062 dbSNP
rs546506764 1068 dbSNP
rs939009443 1069 dbSNP
rs1377692814 1080 dbSNP
rs1232271825 1090 dbSNP
rs1447133869 1096 dbSNP
rs1483327585 1105 dbSNP
rs1191077520 1108 dbSNP
rs1055024153 1123 dbSNP
rs957889259 1128 dbSNP
rs989812448 1132 dbSNP
rs1198938779 1134 dbSNP
rs1183782739 1141 dbSNP
rs1256830374 1148 dbSNP
rs1226700848 1150 dbSNP
rs757076605 1190 dbSNP
rs775613033 1196 dbSNP
rs1299670715 1206 dbSNP
rs1266140610 1207 dbSNP
rs911101049 1224 dbSNP
rs1022120136 1225 dbSNP
rs1172745136 1227 dbSNP
rs1427725751 1236 dbSNP
rs568041149 1241 dbSNP
rs999547694 1251 dbSNP
rs1402389495 1254 dbSNP
rs1355680945 1263 dbSNP
rs929733070 1270 dbSNP
rs72800330 1272 dbSNP
rs1391532759 1273 dbSNP
rs879019899 1277 dbSNP
rs1301446934 1285 dbSNP
rs910073023 1298 dbSNP
rs941503036 1299 dbSNP
rs985446931 1311 dbSNP
rs1257078194 1313 dbSNP
rs1056469654 1318 dbSNP
rs1276789278 1320 dbSNP
rs1018905154 1324 dbSNP
rs1229048098 1340 dbSNP
rs1212636853 1355 dbSNP
rs1358716519 1358 dbSNP
rs1272003579 1361 dbSNP
rs963003840 1369 dbSNP
rs974766886 1377 dbSNP
rs1327737935 1416 dbSNP
rs550792336 1433 dbSNP
rs762024970 1438 dbSNP
rs983168603 1444 dbSNP
rs569248902 1447 dbSNP
rs958114455 1449 dbSNP
rs938958705 1451 dbSNP
rs1054806946 1459 dbSNP
rs1248139670 1464 dbSNP
rs1369459890 1475 dbSNP
rs1482236050 1482 dbSNP
rs894837009 1484 dbSNP
rs1474210766 1488 dbSNP
rs1451140545 1491 dbSNP
rs1186361787 1505 dbSNP
rs545454118 1515 dbSNP
rs1230005855 1517 dbSNP
rs1356747836 1518 dbSNP
rs374463438 1523 dbSNP
rs1044058857 1524 dbSNP
rs1451893833 1527 dbSNP
rs1162170025 1529 dbSNP
rs765625767 1548 dbSNP
rs1288589174 1554 dbSNP
rs1365068543 1554 dbSNP
rs963984763 1555 dbSNP
rs1347637343 1556 dbSNP
rs750807906 1570 dbSNP
rs999328660 1578 dbSNP
rs976646828 1592 dbSNP
rs1325580962 1604 dbSNP
rs1029680458 1609 dbSNP
rs891214743 1611 dbSNP
rs1391901766 1617 dbSNP
rs1471823172 1618 dbSNP
rs539922166 1621 dbSNP
rs758915730 1625 dbSNP
rs1477725866 1626 dbSNP
rs1018270162 1630 dbSNP
rs982945555 1638 dbSNP
rs558141629 1639 dbSNP
rs573287926 1651 dbSNP
rs941540804 1652 dbSNP
rs1312785536 1660 dbSNP
rs1206513318 1661 dbSNP
rs1055998344 1663 dbSNP
rs140741085 1666 dbSNP
rs570030710 1675 dbSNP
rs1364841540 1681 dbSNP
rs950343659 1686 dbSNP
rs951500870 1698 dbSNP
rs1209967572 1701 dbSNP
rs1291388339 1704 dbSNP
rs1320482514 1708 dbSNP
rs1455931131 1713 dbSNP
rs981608699 1717 dbSNP
rs1391348533 1718 dbSNP
rs1444992662 1720 dbSNP
rs1214549292 1724 dbSNP
rs1160137126 1727 dbSNP
rs1414184656 1732 dbSNP
rs1423133119 1734 dbSNP
rs1192931818 1738 dbSNP
rs927663271 1740 dbSNP
rs939074777 1742 dbSNP
rs1249059561 1752 dbSNP
rs1247293425 1753 dbSNP
rs1045954183 1756 dbSNP
rs1451673702 1760 dbSNP
rs538222253 1762 dbSNP
rs903200852 1766 dbSNP
rs1280313022 1778 dbSNP
rs1385210247 1789 dbSNP
rs565263037 1790 dbSNP
rs544472233 1801 dbSNP
rs766833720 1806 dbSNP
rs1054965597 1810 dbSNP
rs200385913 1819 dbSNP
rs1433575091 1826 dbSNP
rs1008043128 1827 dbSNP
rs1289874661 1832 dbSNP
rs946404245 1849 dbSNP
rs1357572029 1850 dbSNP
rs1178539599 1852 dbSNP
rs185370798 1860 dbSNP
rs1321413713 1871 dbSNP
rs747043874 1877 dbSNP
rs923878920 1877 dbSNP
rs1389153318 1879 dbSNP
rs755635772 1880 dbSNP
rs1018130663 1887 dbSNP
rs565398890 1888 dbSNP
rs998133649 1895 dbSNP
rs1238806602 1897 dbSNP
rs935128658 1898 dbSNP
rs1334425483 1903 dbSNP
rs1210444545 1913 dbSNP
rs1482424466 1917 dbSNP
rs1029549963 1921 dbSNP
rs1382019395 1924 dbSNP
rs1245425629 1937 dbSNP
rs1296920245 1940 dbSNP
rs188314873 1941 dbSNP
rs1304789658 1942 dbSNP
rs1377457733 1942 dbSNP
rs1347860862 1952 dbSNP
rs545894026 1955 dbSNP
rs1268413951 1958 dbSNP
rs1306323604 1969 dbSNP
rs1431720603 1971 dbSNP
rs1465956902 1974 dbSNP
rs1390644744 1978 dbSNP
rs1202232018 1987 dbSNP
rs777427363 1994 dbSNP
rs1006974892 2022 dbSNP
rs143742613 2033 dbSNP
rs1190148217 2034 dbSNP
rs1182082119 2043 dbSNP
rs748944320 2045 dbSNP
rs180731029 2049 dbSNP
rs1231279749 2052 dbSNP
rs1206589756 2059 dbSNP
rs948680797 2059 dbSNP
rs962518076 2059 dbSNP
rs1252351400 2065 dbSNP
rs979707227 2068 dbSNP
rs138908428 2073 dbSNP
rs991646820 2073 dbSNP
rs796459542 2077 dbSNP
rs1234120462 2081 dbSNP
rs909558593 2085 dbSNP
rs916113927 2092 dbSNP
rs995929398 2093 dbSNP
rs950186883 2100 dbSNP
rs148141277 2102 dbSNP
rs924843612 2103 dbSNP
rs1456388565 2108 dbSNP
rs561638210 2110 dbSNP
rs951616547 2123 dbSNP
rs112088844 2124 dbSNP
rs893107766 2132 dbSNP
rs1409257486 2136 dbSNP
rs745693977 2137 dbSNP
rs1336046749 2140 dbSNP
rs1333877172 2143 dbSNP
rs958884605 2144 dbSNP
rs1266106824 2145 dbSNP
rs1408738839 2146 dbSNP
rs1288412457 2147 dbSNP
rs577943705 2147 dbSNP
rs990571907 2155 dbSNP
rs1214634092 2156 dbSNP
rs1328945144 2160 dbSNP
rs1330850086 2163 dbSNP
rs1221232622 2169 dbSNP
rs771934786 2172 dbSNP
rs569040026 2181 dbSNP
rs1230505268 2190 dbSNP
rs1336420831 2191 dbSNP
rs1300746003 2195 dbSNP
rs967716613 2196 dbSNP
rs1369553581 2200 dbSNP
rs979512542 2206 dbSNP
rs923826898 2207 dbSNP
rs1386243166 2210 dbSNP
rs1262919796 2217 dbSNP
rs1160889200 2226 dbSNP
rs1454054677 2229 dbSNP
rs935244262 2232 dbSNP
rs997978117 2233 dbSNP
rs1051004123 2237 dbSNP
rs140167189 2245 dbSNP
rs760041762 2248 dbSNP
rs767977886 2250 dbSNP
rs1390440639 2251 dbSNP
rs1039766001 2252 dbSNP
rs1004520773 2253 dbSNP
rs6884245 2258 dbSNP
rs1246644945 2259 dbSNP
rs1210805810 2264 dbSNP
rs1351601817 2266 dbSNP
rs1255632270 2267 dbSNP
rs34981614 2268 dbSNP
rs1437738243 2274 dbSNP
rs1314041318 2279 dbSNP
rs1183065490 2286 dbSNP
rs1304036625 2294 dbSNP
rs768652458 2329 dbSNP
rs991262315 2333 dbSNP
rs184254140 2336 dbSNP
rs1382588462 2340 dbSNP
rs1022630910 2341 dbSNP
rs995485865 2343 dbSNP
rs1170480116 2347 dbSNP
rs1172387836 2354 dbSNP
rs1467088813 2354 dbSNP
rs1395212070 2358 dbSNP
rs1174809259 2363 dbSNP
rs1047085788 2372 dbSNP
rs776618145 2376 dbSNP
rs1404302732 2382 dbSNP
rs1388873433 2383 dbSNP
rs1195696035 2385 dbSNP
rs1447964724 2385 dbSNP
rs1255667138 2386 dbSNP
rs971558532 2391 dbSNP
rs776754776 2392 dbSNP
rs1198899478 2398 dbSNP
rs1376879966 2402 dbSNP
rs188783610 2414 dbSNP
rs1174085490 2416 dbSNP
rs924768144 2421 dbSNP
rs1299744009 2426 dbSNP
rs934950373 2427 dbSNP
rs1035975010 2442 dbSNP
rs555840826 2445 dbSNP
rs958873894 2465 dbSNP
rs150328223 2473 dbSNP
rs943330636 2475 dbSNP
rs1427263241 2482 dbSNP
rs538533846 2490 dbSNP
rs574522902 2492 dbSNP
rs1170167601 2497 dbSNP
rs1402737776 2499 dbSNP
rs1300121743 2504 dbSNP
rs979240534 2505 dbSNP
rs578136488 2510 dbSNP
rs1185682586 2511 dbSNP
rs1476344161 2512 dbSNP
rs923609461 2515 dbSNP
rs545466687 2517 dbSNP
rs933380150 2520 dbSNP
rs773593353 2524 dbSNP
rs1342159135 2534 dbSNP
rs1061131 2537 dbSNP
rs912495763 2539 dbSNP
rs1050939791 2540 dbSNP
rs763686620 2541 dbSNP
rs4320316 2543 dbSNP
rs116985068 2548 dbSNP
rs1004167340 2556 dbSNP
rs557257275 2562 dbSNP
rs975658992 2565 dbSNP
rs756764736 2566 dbSNP
rs1371918738 2567 dbSNP
rs1331421330 2569 dbSNP
rs575896168 2580 dbSNP
rs931386229 2583 dbSNP
rs898165280 2585 dbSNP
rs1161768613 2596 dbSNP
rs1012975267 2604 dbSNP
rs1022684749 2607 dbSNP
rs11538576 2608 dbSNP
rs577230221 2609 dbSNP
rs1448802405 2611 dbSNP
rs1234717156 2612 dbSNP
rs887094462 2629 dbSNP
rs766788328 2634 dbSNP
rs1002558667 2648 dbSNP
rs1450903174 2656 dbSNP
rs1287647835 2657 dbSNP
rs938676870 2668 dbSNP
rs1215289819 2678 dbSNP
rs1335261283 2686 dbSNP
rs1169084943 2687 dbSNP
rs1267071069 2688 dbSNP
rs1057375492 2693 dbSNP
rs1371898880 2697 dbSNP
rs1380662335 2716 dbSNP
rs1435150752 2716 dbSNP
rs747464196 2716 dbSNP
rs75553085 2716 dbSNP
rs1422261053 2717 dbSNP
rs1292417181 2721 dbSNP
rs1322185036 2728 dbSNP
rs374260672 2729 dbSNP
rs1443509331 2730 dbSNP
rs545374462 2733 dbSNP
rs1388152648 2752 dbSNP
rs1158667615 2755 dbSNP
rs1455909245 2766 dbSNP
rs894722434 2767 dbSNP
rs181224111 2777 dbSNP
rs1364851578 2802 dbSNP
rs1022204074 2803 dbSNP
rs904731349 2809 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10802.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acucuguccAAGUACGACGAUa 5'
                   ||:: ||||||| 
Target 5' -----aaucUUUG-GCUGCUAc 3'
1 - 16
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acucuguccAAGUACGACGAUa 5'
                   ||:: ||||||| 
Target 5' -----aaucUUUG-GCUGCUAc 3'
1 - 16
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000398844.2 | 3UTR | AAUCUUUGGCUGCUACAUUUAAAACCUCACAAACCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000398844.2 | 3UTR | AAUCUUUGGCUGCUACAUUUAAAACCUCACAAACCUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
180 hsa-miR-4524a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055251 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT055826 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT060573 CCND1 cyclin D1 2 2
MIRT061013 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT064694 CCND2 cyclin D2 2 4
MIRT075268 SNTB2 syntrophin beta 2 2 4
MIRT079668 NAPG NSF attachment protein gamma 2 12
MIRT081651 CCNE1 cyclin E1 2 4
MIRT082996 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083463 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT085755 RIF1 replication timing regulatory factor 1 2 2
MIRT086022 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087431 ZNRF3 zinc and ring finger 3 2 2
MIRT088786 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT089221 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT093696 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095090 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT096249 CANX calnexin 2 2
MIRT100215 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100746 VEGFA vascular endothelial growth factor A 2 12
MIRT100904 CD2AP CD2 associated protein 2 2
MIRT102647 UBN2 ubinuclein 2 2 10
MIRT103882 FOXK1 forkhead box K1 2 2
MIRT104246 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106310 ZFHX4 zinc finger homeobox 4 2 6
MIRT107696 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT114943 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117671 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT133799 SKI SKI proto-oncogene 2 2
MIRT140167 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142279 DCTN5 dynactin subunit 5 2 8
MIRT143288 N4BP1 NEDD4 binding protein 1 2 2
MIRT165939 CREBRF CREB3 regulatory factor 2 2
MIRT175251 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT186381 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT191470 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT196480 TAOK1 TAO kinase 1 2 2
MIRT201470 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204615 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204646 MOB4 MOB family member 4, phocein 2 8
MIRT204749 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206031 NUP50 nucleoporin 50 2 6
MIRT211196 FGF2 fibroblast growth factor 2 2 4
MIRT229353 ZNF449 zinc finger protein 449 2 2
MIRT247138 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT249461 ZNF691 zinc finger protein 691 2 4
MIRT256314 CDC42SE2 CDC42 small effector 2 2 2
MIRT258419 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265083 CHEK1 checkpoint kinase 1 2 2
MIRT270561 SETD1B SET domain containing 1B 2 2
MIRT274749 RAB3IP RAB3A interacting protein 2 2
MIRT277515 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT289642 CBX2 chromobox 2 2 2
MIRT301001 MTMR3 myotubularin related protein 3 2 2
MIRT307149 CTDSPL CTD small phosphatase like 2 4
MIRT309021 USP53 ubiquitin specific peptidase 53 2 2
MIRT314100 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT319338 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320619 ZNRF2 zinc and ring finger 2 2 2
MIRT324285 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT446498 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT448437 TLL1 tolloid like 1 2 2
MIRT461537 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463162 ZNF367 zinc finger protein 367 2 10
MIRT463493 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT465154 TSC22D2 TSC22 domain family member 2 2 2
MIRT466418 TFAP2A transcription factor AP-2 alpha 2 8
MIRT468278 SFT2D2 SFT2 domain containing 2 2 2
MIRT469399 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471941 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT473688 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT479618 CDC25A cell division cycle 25A 2 2
MIRT482098 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483995 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485205 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT498763 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT498961 ORC4 origin recognition complex subunit 4 2 8
MIRT499440 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500080 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500305 ZNF622 zinc finger protein 622 2 8
MIRT500410 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500789 TLK1 tousled like kinase 1 2 6
MIRT500930 SRPR SRP receptor alpha subunit 2 6
MIRT500943 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501068 SMAD7 SMAD family member 7 2 8
MIRT501711 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT502627 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502910 CDCA4 cell division cycle associated 4 2 8
MIRT502935 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504531 ZNF620 zinc finger protein 620 2 6
MIRT505106 YTHDC1 YTH domain containing 1 2 6
MIRT505337 TMEM245 transmembrane protein 245 2 6
MIRT505383 TMEM100 transmembrane protein 100 2 2
MIRT505678 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506157 PLAG1 PLAG1 zinc finger 2 8
MIRT506183 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506475 MYO5A myosin VA 2 6
MIRT506826 KIF23 kinesin family member 23 2 6
MIRT507160 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT507511 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT507845 CCNE2 cyclin E2 2 6
MIRT510403 ZNF507 zinc finger protein 507 2 2
MIRT518078 TRIM35 tripartite motif containing 35 2 2
MIRT518982 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521045 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521190 SBNO1 strawberry notch homolog 1 2 6
MIRT522088 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT524846 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT527787 TMEM44 transmembrane protein 44 2 4
MIRT537803 EFNB2 ephrin B2 2 4
MIRT540830 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541140 PISD phosphatidylserine decarboxylase 2 2
MIRT541419 CBX4 chromobox 4 2 2
MIRT543517 PRSS21 protease, serine 21 2 2
MIRT543824 GSG1 germ cell associated 1 2 2
MIRT544959 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545179 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545335 CCDC83 coiled-coil domain containing 83 2 2
MIRT545518 RSL24D1 ribosomal L24 domain containing 1 2 2
MIRT545670 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545931 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546102 USP48 ubiquitin specific peptidase 48 2 4
MIRT546598 SALL1 spalt like transcription factor 1 2 4
MIRT546626 RTN4 reticulon 4 2 2
MIRT547651 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547987 HCFC2 host cell factor C2 2 4
MIRT548717 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548931 CDK17 cyclin dependent kinase 17 2 2
MIRT549067 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549266 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT550460 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550806 FAM229B family with sequence similarity 229 member B 2 2
MIRT552024 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552334 ZNF704 zinc finger protein 704 2 2
MIRT552732 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553795 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554694 RNF149 ring finger protein 149 2 2
MIRT555133 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555264 PRDM4 PR/SET domain 4 2 2
MIRT556848 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557474 GPR27 G protein-coupled receptor 27 2 4
MIRT558018 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558498 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558579 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558610 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT558650 CNKSR3 CNKSR family member 3 2 2
MIRT558986 CA8 carbonic anhydrase 8 2 2
MIRT559141 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559327 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT562021 LANCL1 LanC like 1 2 2
MIRT562869 KIAA1456 KIAA1456 2 2
MIRT563074 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563496 DLGAP3 DLG associated protein 3 2 2
MIRT563890 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564311 CCNT1 cyclin T1 2 2
MIRT564942 XKR7 XK related 7 2 2
MIRT564979 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565423 TEF TEF, PAR bZIP transcription factor 2 2
MIRT566824 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571961 KIF5B kinesin family member 5B 2 2
MIRT575877 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT576523 Txlna taxilin alpha 2 2
MIRT614693 TRAK1 trafficking kinesin protein 1 2 2
MIRT616065 ZC3H14 zinc finger CCCH-type containing 14 2 2
MIRT618838 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT624626 ATXN2 ataxin 2 2 2
MIRT624652 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT640314 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT659248 CUL3 cullin 3 2 2
MIRT680972 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682261 RS1 retinoschisin 1 2 2
MIRT682505 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693904 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT699214 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT699373 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699451 SLC16A9 solute carrier family 16 member 9 2 2
MIRT701230 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT702849 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT706163 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT718990 UTP15 UTP15, small subunit processome component 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4524a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4524a-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission