miRTarBase - #MIRT095248


—
pre-miRNA Information
pre-miRNA hsa-mir-19a   
Genomic Coordinates chr13: 91350891 - 91350972
Synonyms MIRN19A, hsa-mir-19a, miR-19a, miRNA19A, MIR19A
Description Homo sapiens miR-19a stem-loop
Comment This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-19a-5p
Sequence 14| AGUUUUGCAUAGUUGCACUACA |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs756288295 2 dbSNP
rs1051963210 6 dbSNP
rs780315531 8 dbSNP
rs1162564162 9 dbSNP
rs1170543143 13 dbSNP
rs1388542964 15 dbSNP
rs1442807536 18 dbSNP
rs1403138754 20 dbSNP
rs764765453 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BST0O9 miR-19a Predictive Biomarker (PRD) Clinical/Experimental Data Expression Decrease Tumor tissue Quantitative real-time PCR
Gene Information
Gene Symbol FAM13B   
Synonyms ARHGAP49, C5orf5, FAM13B1, KHCHP, N61
Description family with sequence similarity 13 member B
Transcript NM_001101800   
Other Transcripts NM_001101801 , NM_016603   
Expression
Putative miRNA Targets on FAM13B
3'UTR of FAM13B
(miRNA target sites are highlighted)		 
>FAM13B|NM_001101800|3'UTR
   1 GATACGTTCCTTGAAAATTCATATCATAAAGTCAGTTGTATTCCTTGAAGCTATCATCGTGTGTACTTGGCTGGTACTTA
  81 AATTCGTTTTGTCAGGCACTCAGAGAATCTCATTTTGTACTTGGTTGTGGTGCCACTAAACAAAACAAATGATGGGAGAG
 161 TAAGTAGGCCCTCTCAAGGGAGCGTAAGTGATGTTCCATATTAACCACAGACTGTCCTCTCCACCTTTAGCAAACATATG
 241 GTTTACTTCATTGTTTTGTACTACAGATACATCCTTTTAGCAAAAGACTGGAATTTTATCCTTTCAACTTCAAGAACTTT
 321 GGAAATGCAAGCTTTTTGTTATTACCAACTTTTTGTTTCTCATTACTGAAGAAAATTGGAGGAAAATCTTCATACTGAAT
 401 TCTTCTGTTGCCTTTTTCTTACAGAATGACTGAAAATTTGAAAGAAAAGCCTATAAAAGTGCACATACGCAACTGTGTTC
 481 TCTGTTTTCCTAGAAAACCAAAATCAAACTGAGATTTCAAGTCGTACTATGGAACACCTTTCTGTTTAATTCCCAAAGTG
 561 ACATCTTCTCACAGGTAGTATGTTAGTAAAATTTTGCAATTCGCTGGTCACACAGCTCCCGGATGAAGATAACAGTTGGT
 641 AGACCAAAAGGTGACCTCGCTTAGTATATTGAAAACACACACCACACATCACACACAGAACTGAATCATACCACATGCTG
 721 CCTATGGGACTTCAGTTACTGTTTCCTGAGTTACTGTTTATCCGCTGGCAATGGTGTGATTTGTCTGGATCAGATCCGCG
 801 CTATTCCCCAACCCACCTCCAGATAATGTGAGAAAATAGCCATGTCAGTATGTAGGAACTCTGATGGTGCTCAGATTTGT
 881 GTGTTCAATCAATGGGCTTAAATCAGCAAAATATTATGCCTAAAGTAAATCTGTTCTTAACAAGGGCTCTACCACTGCAT
 961 TTTCACATGTACCTTCAGGGGGTTATCTTTTTTTTTTTCCCCTCCTATTTTAATCAGCAAAATCCATACCAAAACAACGA
1041 CAACAACGCCCTCTTAAGGGACCACCCTTTGGTCAATCATAACATGCTGTTTAAAGCAGCTGTTTACAGGATGTGTAGTG
1121 GTATGCCCCTTGTCATATACTCTTAGCATATCTTTTTTTCCTTTGGCTTTGCATGGCTTTTCTTCAGGTACTGTCTCGGT
1201 ATCATTCTGCTAATCATTGTTACAGAATGGTGACTTCATTTGTGCTAACAGTACAACAGCAGATTTGGGTCAGGCTTAAT
1281 CTAAGTGTTAACTTTTTTTTCTGGTGCTTTTTTGGATTGATGACTGTCTCACTTTGACTATACCCATGTTTTGCATGCAA
1361 TGACTCATGCATGGTTTTCTTAACTAGCTAATATTAACAATTTATTCCATATAAAAATGGAATTTTGCAACATCCTTTAA
1441 TAAGGTGAGGGAAGCATGAACCTCAGACTTCTGGCACTATTACATAGTAAGCACATGAAGTAGTTTGATAATAAATAGCA
1521 GTTCTAGTACTTCACATTTCACCCGTGTGTGCAATGCCTTTTTCTGGGGGGTGGGGGGTGAGGGAAAACCTGGTAGTGAA
1601 TGTGTAGTTGGGGAATAAAGAAAAGCACTAAATCCTGCCCTTTTTGTGTGGTTTCCTTTTGATACAACTAGGTTATTCAT
1681 AATGTATACCTAGAAAAGTGAAATTGAAAATACCAAAAGATGTATCATTTTTATTTGAATCCATCATGCAGTGTACATTT
1761 CAGATAATTTCCTTCAGTCTCCAGATAGGAGTGTATCCAAACATCTAATTTTATGTGCACTGTGTATCTTATATGAATGT
1841 TTTATTTTATATACCACATGCAAAAATGTCCATATGCACTATTTAAATGTTTTAAATAATATATTCCTTCTTTATAATGC
1921 TAAATCTATATGAGTACCATATTTTTATAAGTCAGTGGTCTGACTGGTTTCATTTTAGAATTAACAGCTGCTTCAATATG
2001 TTATTCAATGTTAATGTTTGGCTGTGAGTAGAATATGTAAAAGTGGCATGGCAGCACTTATGCTCTGTGACAGTATTGTG
2081 TGTCATAGTTGAGCAGTAGCTGGTAGAATTAGGCAGTTGGTGATAGTTTTACTTTGGTACAAATAAAAACTGTATATCTA
2161 TATACAAATAATATATAGATATATATGTCCACCAGTATAATGGCATTGCTGTGTCTGGCACTTCATTGTACAGACTTTTA
2241 TAATAAAAGAACTTGAAAGTTCTAAGTCATTGTAAATGTATGTTTGTTTTTCCACTGGGCTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acAUCACGUUGAUACGUUUUGa 5'
            |:|||| ||||  |||||| 
Target 5' tgTGGTGCCACTAAACAAAACa 3'
 126 - 147 148.00 -17.20
2 
miRNA  3' acAUCACGUUGAUACGUUUUga 5'
            || | | || ||||||||  
Target 5' taTA-TACCAC-ATGCAAAAat 3'
 1848 - 1867 138.00 -7.00
3 
miRNA  3' acAUCACG--UUGAUACGUUUUGa 5'
            |:| ||  || |  ||||||: 
Target 5' aaTGG-GCTTAAATCAGCAAAATa 3'
 891 - 913 133.00 -5.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8491904 6 COSMIC
COSN30174325 33 COSMIC
COSN26975697 50 COSMIC
COSN30149979 53 COSMIC
COSN30504378 59 COSMIC
COSN31590845 64 COSMIC
COSM481976 85 COSMIC
COSM5938130 85 COSMIC
COSM5702804 87 COSMIC
COSM4819185 93 COSMIC
COSM7122512 101 COSMIC
COSM8050400 103 COSMIC
COSM6241613 132 COSMIC
COSN30493087 168 COSMIC
COSN30502088 178 COSMIC
COSN30093005 180 COSMIC
COSN30477347 205 COSMIC
COSN30109155 251 COSMIC
COSN9926699 311 COSMIC
COSN31527480 524 COSMIC
COSN26586917 602 COSMIC
COSN31959958 643 COSMIC
COSN26602028 793 COSMIC
COSN14769834 799 COSMIC
COSN27358707 988 COSMIC
COSN32056427 998 COSMIC
COSN31523030 1031 COSMIC
COSN29345980 1250 COSMIC
COSN31578869 1879 COSMIC
COSN31595753 1925 COSMIC
COSN28754299 2054 COSMIC
COSN19192234 2218 COSMIC
COSN7876786 2249 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1358930160 2 dbSNP
rs755992514 4 dbSNP
rs750386837 5 dbSNP
rs369454923 6 dbSNP
rs751795696 9 dbSNP
rs1420510779 10 dbSNP
rs1223114973 19 dbSNP
rs1324481359 30 dbSNP
rs1489004827 32 dbSNP
rs376178626 40 dbSNP
rs1225045020 42 dbSNP
rs764292104 53 dbSNP
rs373247757 56 dbSNP
rs1035120958 58 dbSNP
rs370070551 59 dbSNP
rs1162241282 61 dbSNP
rs373818342 62 dbSNP
rs1045080646 63 dbSNP
rs370407926 68 dbSNP
rs1468988069 70 dbSNP
rs373460054 74 dbSNP
rs1179051286 76 dbSNP
rs761294707 82 dbSNP
rs1373079387 84 dbSNP
rs200078301 85 dbSNP
rs1315083471 87 dbSNP
rs748991660 88 dbSNP
rs376480186 89 dbSNP
rs1258740314 94 dbSNP
rs1203074424 98 dbSNP
rs1266807055 101 dbSNP
rs144685038 105 dbSNP
rs745744896 108 dbSNP
rs1209901201 120 dbSNP
rs1248169310 121 dbSNP
rs781162016 122 dbSNP
rs371782450 123 dbSNP
rs1269564455 132 dbSNP
rs1228036808 136 dbSNP
rs751634370 137 dbSNP
rs1328077334 139 dbSNP
rs778038213 142 dbSNP
rs758505215 145 dbSNP
rs202233545 150 dbSNP
rs763124340 150 dbSNP
rs1338290323 153 dbSNP
rs1408613904 154 dbSNP
rs1396201574 156 dbSNP
rs940541368 158 dbSNP
rs1181112545 159 dbSNP
rs1221804323 164 dbSNP
rs373571725 169 dbSNP
rs765631397 170 dbSNP
rs1183073478 171 dbSNP
rs1445300266 173 dbSNP
rs1458823210 178 dbSNP
rs759994293 182 dbSNP
rs1347503440 183 dbSNP
rs371273291 184 dbSNP
rs1435913518 186 dbSNP
rs1476656254 198 dbSNP
rs183581373 206 dbSNP
rs931753617 212 dbSNP
rs921584617 217 dbSNP
rs1380099201 222 dbSNP
rs977840899 226 dbSNP
rs1286917487 231 dbSNP
rs978447634 239 dbSNP
rs966757137 240 dbSNP
rs1487022508 241 dbSNP
rs917605907 245 dbSNP
rs992464788 247 dbSNP
rs968267800 258 dbSNP
rs111747998 264 dbSNP
rs1257404628 270 dbSNP
rs529474865 273 dbSNP
rs1265133824 274 dbSNP
rs1249424735 280 dbSNP
rs1473439424 286 dbSNP
rs1182862516 287 dbSNP
rs1424328990 289 dbSNP
rs1216842177 311 dbSNP
rs1431533619 320 dbSNP
rs1178254990 324 dbSNP
rs1307203686 341 dbSNP
rs1359809220 341 dbSNP
rs1429414825 342 dbSNP
rs567853011 348 dbSNP
rs191748428 349 dbSNP
rs1214945845 362 dbSNP
rs956898847 376 dbSNP
rs1410776155 377 dbSNP
rs1363767349 379 dbSNP
rs761932584 386 dbSNP
rs1366030058 393 dbSNP
rs1216970351 402 dbSNP
rs546678274 406 dbSNP
rs1302862201 409 dbSNP
rs1347961743 411 dbSNP
rs1204066388 412 dbSNP
rs1282378389 417 dbSNP
rs372478250 419 dbSNP
rs1483932545 421 dbSNP
rs1005973683 423 dbSNP
rs951883982 424 dbSNP
rs1406685849 428 dbSNP
rs1338207279 432 dbSNP
rs564114888 433 dbSNP
rs1448906900 461 dbSNP
rs994276885 465 dbSNP
rs1023565552 467 dbSNP
rs994809870 468 dbSNP
rs1430815081 469 dbSNP
rs1170629736 470 dbSNP
rs1323227195 472 dbSNP
rs1348499959 473 dbSNP
rs899041552 475 dbSNP
rs1294612731 480 dbSNP
rs1430701441 481 dbSNP
rs545898880 484 dbSNP
rs1226979837 490 dbSNP
rs1041075917 491 dbSNP
rs531280171 496 dbSNP
rs187412806 499 dbSNP
rs890076936 511 dbSNP
rs1449632667 519 dbSNP
rs866374269 523 dbSNP
rs56124297 524 dbSNP
rs1464516920 529 dbSNP
rs1245509444 560 dbSNP
rs925461629 562 dbSNP
rs1450392928 565 dbSNP
rs1162880330 576 dbSNP
rs1042504673 578 dbSNP
rs1407405757 580 dbSNP
rs1480310969 592 dbSNP
rs1166152667 599 dbSNP
rs755554402 602 dbSNP
rs931701394 603 dbSNP
rs1366725188 604 dbSNP
rs1431073802 619 dbSNP
rs900271878 620 dbSNP
rs945177289 621 dbSNP
rs917569108 627 dbSNP
rs551828739 630 dbSNP
rs1328304844 632 dbSNP
rs1206733804 647 dbSNP
rs1289369919 650 dbSNP
rs7711607 656 dbSNP
rs947081384 658 dbSNP
rs959304605 659 dbSNP
rs915442062 664 dbSNP
rs544347055 666 dbSNP
rs139187964 673 dbSNP
rs1316999292 680 dbSNP
rs926501408 683 dbSNP
rs555642739 685 dbSNP
rs1240396071 695 dbSNP
rs1371936159 696 dbSNP
rs145927578 698 dbSNP
rs1463250195 700 dbSNP
rs143662048 707 dbSNP
rs1333120565 713 dbSNP
rs1141538 715 dbSNP
rs1425676779 717 dbSNP
rs1349632907 722 dbSNP
rs961524272 724 dbSNP
rs1290109447 736 dbSNP
rs1351537461 750 dbSNP
rs1199897206 756 dbSNP
rs1177269824 760 dbSNP
rs969414171 763 dbSNP
rs1023681657 764 dbSNP
rs1211864067 769 dbSNP
rs973335904 771 dbSNP
rs1251396669 772 dbSNP
rs914979592 778 dbSNP
rs1471796049 792 dbSNP
rs539080029 797 dbSNP
rs569495800 798 dbSNP
rs3777118 799 dbSNP
rs890391790 803 dbSNP
rs1001131950 811 dbSNP
rs1415875986 813 dbSNP
rs1313090495 814 dbSNP
rs1221480393 816 dbSNP
rs1407727105 823 dbSNP
rs1290165853 842 dbSNP
rs182224747 846 dbSNP
rs546994832 847 dbSNP
rs904012292 850 dbSNP
rs1347201886 852 dbSNP
rs1042598175 854 dbSNP
rs1359807369 861 dbSNP
rs1293902637 863 dbSNP
rs1207667302 868 dbSNP
rs945110556 870 dbSNP
rs568297439 881 dbSNP
rs546815173 887 dbSNP
rs1316251133 888 dbSNP
rs896201307 889 dbSNP
rs115109738 892 dbSNP
rs1173915079 907 dbSNP
rs1389121884 909 dbSNP
rs778489092 916 dbSNP
rs947166550 922 dbSNP
rs1386199204 933 dbSNP
rs1321486340 944 dbSNP
rs1441663613 947 dbSNP
rs570627432 967 dbSNP
rs1366393067 968 dbSNP
rs1230875103 972 dbSNP
rs1252314362 973 dbSNP
rs1356060342 978 dbSNP
rs1208624671 982 dbSNP
rs1270048871 988 dbSNP
rs891455501 998 dbSNP
rs1247038181 999 dbSNP
rs1447356722 999 dbSNP
rs930585714 999 dbSNP
rs1172075196 1001 dbSNP
rs1302080466 1003 dbSNP
rs1373482091 1003 dbSNP
rs1417882252 1003 dbSNP
rs1405965985 1004 dbSNP
rs1053229188 1005 dbSNP
rs1396522793 1007 dbSNP
rs3209743 1011 dbSNP
rs1441738099 1025 dbSNP
rs1320048505 1036 dbSNP
rs935571253 1038 dbSNP
rs1437605421 1039 dbSNP
rs971956756 1039 dbSNP
rs114637319 1046 dbSNP
rs748836713 1047 dbSNP
rs982209763 1048 dbSNP
rs1208645647 1060 dbSNP
rs545062568 1061 dbSNP
rs188296688 1072 dbSNP
rs1187941695 1076 dbSNP
rs1261936038 1082 dbSNP
rs1028359006 1105 dbSNP
rs916785791 1108 dbSNP
rs973504046 1110 dbSNP
rs531839685 1111 dbSNP
rs1461945920 1112 dbSNP
rs1158303416 1117 dbSNP
rs1386592584 1126 dbSNP
rs751278393 1136 dbSNP
rs544171311 1138 dbSNP
rs1455377971 1140 dbSNP
rs1001100927 1147 dbSNP
rs1401700430 1148 dbSNP
rs1014908201 1167 dbSNP
rs904136430 1173 dbSNP
rs1356490258 1175 dbSNP
rs1021631233 1177 dbSNP
rs756062841 1188 dbSNP
rs1286968440 1190 dbSNP
rs1326484381 1193 dbSNP
rs529239548 1197 dbSNP
rs563084070 1198 dbSNP
rs896664449 1199 dbSNP
rs561843547 1201 dbSNP
rs1030262488 1212 dbSNP
rs995972282 1215 dbSNP
rs752672068 1216 dbSNP
rs1056187317 1222 dbSNP
rs1203132209 1223 dbSNP
rs1475393876 1228 dbSNP
rs1181400567 1230 dbSNP
rs185197640 1232 dbSNP
rs1420973626 1234 dbSNP
rs1011314285 1242 dbSNP
rs1261228984 1245 dbSNP
rs1159842817 1246 dbSNP
rs1358652131 1247 dbSNP
rs1464785550 1249 dbSNP
rs754739984 1254 dbSNP
rs1314981342 1255 dbSNP
rs1376487238 1256 dbSNP
rs1409559461 1257 dbSNP
rs1306730866 1259 dbSNP
rs891565577 1265 dbSNP
rs1224823399 1271 dbSNP
rs1052756102 1274 dbSNP
rs1002958757 1280 dbSNP
rs1320718033 1282 dbSNP
rs1282266278 1289 dbSNP
rs906753141 1295 dbSNP
rs1048754844 1300 dbSNP
rs1223798550 1301 dbSNP
rs1281970554 1303 dbSNP
rs766260748 1304 dbSNP
rs919148130 1307 dbSNP
rs1177699233 1319 dbSNP
rs1424610388 1323 dbSNP
rs1381992971 1330 dbSNP
rs972395312 1338 dbSNP
rs1386328971 1345 dbSNP
rs572943788 1353 dbSNP
rs557580040 1358 dbSNP
rs1167175735 1360 dbSNP
rs181324666 1363 dbSNP
rs1428628603 1364 dbSNP
rs76629102 1368 dbSNP
rs1177220761 1373 dbSNP
rs1293422153 1374 dbSNP
rs1366324560 1399 dbSNP
rs1438015421 1401 dbSNP
rs954136067 1404 dbSNP
rs1348075670 1407 dbSNP
rs370275680 1409 dbSNP
rs1038299519 1413 dbSNP
rs1270699800 1419 dbSNP
rs979391657 1420 dbSNP
rs968041373 1422 dbSNP
rs575119790 1428 dbSNP
rs1427644565 1434 dbSNP
rs188803722 1444 dbSNP
rs1195503138 1456 dbSNP
rs1253697958 1472 dbSNP
rs1449154772 1473 dbSNP
rs1166919687 1476 dbSNP
rs1422140946 1479 dbSNP
rs1410838422 1481 dbSNP
rs1010246016 1484 dbSNP
rs907965246 1485 dbSNP
rs1348592447 1486 dbSNP
rs750764342 1489 dbSNP
rs983438422 1491 dbSNP
rs1327416253 1492 dbSNP
rs954696537 1495 dbSNP
rs1371080429 1501 dbSNP
rs1459906491 1503 dbSNP
rs1268014533 1506 dbSNP
rs960891243 1518 dbSNP
rs763069047 1519 dbSNP
rs923307693 1528 dbSNP
rs1332668740 1533 dbSNP
rs1215467913 1537 dbSNP
rs556948653 1544 dbSNP
rs1035620783 1545 dbSNP
rs1267982464 1548 dbSNP
rs1191339834 1550 dbSNP
rs184076564 1554 dbSNP
rs1181574364 1565 dbSNP
rs904985394 1566 dbSNP
rs1476508527 1568 dbSNP
rs964655010 1570 dbSNP
rs1166262960 1571 dbSNP
rs28603001 1572 dbSNP
rs1048805694 1573 dbSNP
rs192990294 1575 dbSNP
rs1021452301 1577 dbSNP
rs1011836024 1578 dbSNP
rs897503573 1579 dbSNP
rs955779895 1580 dbSNP
rs867317020 1581 dbSNP
rs1269098003 1590 dbSNP
rs1031839518 1595 dbSNP
rs911712274 1602 dbSNP
rs1050292433 1615 dbSNP
rs931809029 1621 dbSNP
rs1203404482 1623 dbSNP
rs1337553676 1628 dbSNP
rs779464543 1636 dbSNP
rs921308146 1639 dbSNP
rs762108592 1643 dbSNP
rs906869227 1646 dbSNP
rs867133692 1658 dbSNP
rs1486840295 1665 dbSNP
rs1189311133 1666 dbSNP
rs1044069285 1682 dbSNP
rs1474979623 1684 dbSNP
rs574812426 1686 dbSNP
rs1012434232 1688 dbSNP
rs78673694 1694 dbSNP
rs1156371950 1696 dbSNP
rs3777119 1697 dbSNP
rs190193993 1702 dbSNP
rs185601888 1705 dbSNP
rs1333059452 1713 dbSNP
rs1373425574 1714 dbSNP
rs1037844986 1718 dbSNP
rs879859366 1719 dbSNP
rs1242434810 1720 dbSNP
rs1349722311 1721 dbSNP
rs1183680167 1722 dbSNP
rs1462212883 1723 dbSNP
rs1281407474 1737 dbSNP
rs907915226 1740 dbSNP
rs754032099 1748 dbSNP
rs764232461 1749 dbSNP
rs1486872917 1761 dbSNP
rs1253494695 1779 dbSNP
rs1211976455 1781 dbSNP
rs770148753 1787 dbSNP
rs552385920 1791 dbSNP
rs923255548 1801 dbSNP
rs1436633311 1805 dbSNP
rs1244236684 1807 dbSNP
rs1234150649 1817 dbSNP
rs1382776350 1819 dbSNP
rs1316277876 1822 dbSNP
rs1172651826 1826 dbSNP
rs1392813177 1832 dbSNP
rs1436357698 1851 dbSNP
rs1369703444 1854 dbSNP
rs1454654683 1854 dbSNP
rs1389653448 1857 dbSNP
rs1334018737 1858 dbSNP
rs1330774690 1877 dbSNP
rs1328241436 1878 dbSNP
rs73790094 1883 dbSNP
rs1301545859 1884 dbSNP
rs1350244787 1888 dbSNP
rs569936919 1909 dbSNP
rs943246121 1917 dbSNP
rs1205267798 1931 dbSNP
rs1398901607 1933 dbSNP
rs914479231 1939 dbSNP
rs193210302 1947 dbSNP
rs1212182645 1958 dbSNP
rs1198108092 1960 dbSNP
rs754457222 1984 dbSNP
rs776007728 1985 dbSNP
rs1031535827 1988 dbSNP
rs1274264727 1991 dbSNP
rs969531660 1998 dbSNP
rs1192387774 2001 dbSNP
rs1250590686 2003 dbSNP
rs1384536332 2014 dbSNP
rs1193856657 2015 dbSNP
rs764266644 2015 dbSNP
rs529031580 2027 dbSNP
rs1372329521 2031 dbSNP
rs1460241443 2038 dbSNP
rs1169605115 2040 dbSNP
rs1397057066 2040 dbSNP
rs1027337625 2054 dbSNP
rs981142755 2061 dbSNP
rs1373257037 2065 dbSNP
rs994560198 2068 dbSNP
rs1297086426 2076 dbSNP
rs897478565 2077 dbSNP
rs971143191 2079 dbSNP
rs1022562583 2080 dbSNP
rs1229999466 2083 dbSNP
rs1230729105 2087 dbSNP
rs1036463620 2089 dbSNP
rs1008814659 2096 dbSNP
rs367804506 2103 dbSNP
rs1353439415 2111 dbSNP
rs1270781498 2116 dbSNP
rs890404902 2122 dbSNP
rs1012550125 2130 dbSNP
rs529174384 2131 dbSNP
rs73790093 2135 dbSNP
rs150368807 2136 dbSNP
rs528300795 2138 dbSNP
rs1043819100 2140 dbSNP
rs1162660740 2150 dbSNP
rs886600395 2152 dbSNP
rs1248747029 2154 dbSNP
rs1254802267 2154 dbSNP
rs1382980859 2157 dbSNP
rs1384129318 2158 dbSNP
rs772347079 2159 dbSNP
rs1340227589 2160 dbSNP
rs761947221 2161 dbSNP
rs1279105756 2163 dbSNP
rs1232044798 2164 dbSNP
rs1295610882 2164 dbSNP
rs913900601 2165 dbSNP
rs933375330 2167 dbSNP
rs1337767699 2168 dbSNP
rs1484729332 2171 dbSNP
rs1206516754 2173 dbSNP
rs1301450751 2175 dbSNP
rs1334674280 2179 dbSNP
rs564354919 2182 dbSNP
rs1185736607 2190 dbSNP
rs1402902203 2191 dbSNP
rs1475579471 2195 dbSNP
rs928181087 2196 dbSNP
rs1364675629 2225 dbSNP
rs759906192 2230 dbSNP
rs981008725 2239 dbSNP
rs1039016992 2242 dbSNP
rs1407055743 2245 dbSNP
rs1027808660 2262 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000033079.3 | 3UTR | AACAAAUGAUGGGAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.521 4.5e-3 0.487 7.9e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.687 4.7e-3 0.758 1.3e-3 13 Click to see details
GSE19350 CNS germ cell tumors -0.699 5.7e-3 0.154 3.2e-1 12 Click to see details
GSE17498 Multiple myeloma 0.222 8.4e-2 0.199 1.1e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.275 1.0e-1 -0.259 1.2e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.223 1.4e-1 0.348 4.4e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.148 2.1e-1 0.134 2.3e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.159 2.5e-1 -0.313 9.0e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.129 2.7e-1 0.279 8.8e-2 25 Click to see details
GSE38226 Liver fibrosis -0.069 3.8e-1 -0.044 4.2e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.055 4.0e-1 -0.126 2.8e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.068 4.7e-1 0.000 5.0e-1 4 Click to see details
GSE21687 Ependynoma primary tumors 0.009 4.7e-1 -0.016 4.5e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC -0.992 0.04 -1.000 0.5 3 Click to see details
LIHC 0.884 0.06 0.800 0.1 4 Click to see details
LIHC 0.884 0.06 0.800 0.1 4 Click to see details
LIHC 0.884 0.06 0.800 0.1 4 Click to see details
LIHC 0.884 0.06 0.800 0.1 4 Click to see details
LIHC 0.884 0.06 0.800 0.1 4 Click to see details
92 hsa-miR-19a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038980 WDR96 cilia and flagella associated protein 43 1 1
MIRT063864 RASSF8 Ras association domain family member 8 2 6
MIRT077656 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT078461 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT095248 FAM13B family with sequence similarity 13 member B 2 2
MIRT109490 KLHL15 kelch like family member 15 2 6
MIRT155378 CCNT2 cyclin T2 2 2
MIRT163208 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT188326 ARID1A AT-rich interaction domain 1A 2 2
MIRT204723 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT236399 HMGXB4 HMG-box containing 4 2 2
MIRT237114 P2RY1 purinergic receptor P2Y1 2 5
MIRT286942 SOCS7 suppressor of cytokine signaling 7 2 2
MIRT442523 MOB3B MOB kinase activator 3B 2 2
MIRT473428 MDM4 MDM4, p53 regulator 2 2
MIRT476783 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT476942 FAM83G family with sequence similarity 83 member G 2 2
MIRT480184 CALM2 calmodulin 2 2 6
MIRT489620 ZNF384 zinc finger protein 384 2 2
MIRT492246 SLC39A9 solute carrier family 39 member 9 2 2
MIRT492422 RGL2 ral guanine nucleotide dissociation stimulator like 2 2 2
MIRT494860 ZNF99 zinc finger protein 99 2 2
MIRT497001 SNAP25 synaptosome associated protein 25 2 2
MIRT501973 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT504917 CD38 CD38 molecule 2 4
MIRT507019 HMGA2 high mobility group AT-hook 2 2 6
MIRT510820 SBNO1 strawberry notch homolog 1 2 4
MIRT514166 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT514328 PSMG2 proteasome assembly chaperone 2 2 4
MIRT514429 SLC38A7 solute carrier family 38 member 7 2 2
MIRT514537 ESR2 estrogen receptor 2 2 2
MIRT516117 SRPX2 sushi repeat containing protein, X-linked 2 2 4
MIRT517759 ZNF366 zinc finger protein 366 2 4
MIRT518495 FAM161B family with sequence similarity 161 member B 2 4
MIRT518512 CASP10 caspase 10 2 2
MIRT518561 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT518641 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT518729 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT523565 GGCX gamma-glutamyl carboxylase 2 4
MIRT526523 YIPF6 Yip1 domain family member 6 2 2
MIRT530254 ZNF620 zinc finger protein 620 2 2
MIRT531658 ZFP14 ZFP14 zinc finger protein 2 2
MIRT532699 TCN2 transcobalamin 2 2 4
MIRT534019 STXBP4 syntaxin binding protein 4 2 2
MIRT535748 MYO10 myosin X 2 4
MIRT544509 GTF2E2 general transcription factor IIE subunit 2 2 2
MIRT546758 RLIM ring finger protein, LIM domain interacting 2 2
MIRT547929 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT550130 ZNF138 zinc finger protein 138 2 2
MIRT551763 MED21 mediator complex subunit 21 2 2
MIRT557727 FYCO1 FYVE and coiled-coil domain containing 1 2 2
MIRT558924 CBX1 chromobox 1 2 2
MIRT562466 CORO1C coronin 1C 2 2
MIRT562759 ZNF846 zinc finger protein 846 2 2
MIRT563061 ZNF28 zinc finger protein 28 2 2
MIRT563336 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT569170 DMD dystrophin 2 2
MIRT573256 TNFAIP6 TNF alpha induced protein 6 2 2
MIRT575057 P2ry1 purinergic receptor P2Y, G-protein coupled 1 2 4
MIRT575360 Zxda zinc finger, X-linked, duplicated A 2 2
MIRT613233 CCDC39 coiled-coil domain containing 39 2 2
MIRT613347 ADRBK2 G protein-coupled receptor kinase 3 2 6
MIRT613952 TMEM59 transmembrane protein 59 2 2
MIRT615488 EDN1 endothelin 1 2 2
MIRT618710 ESD esterase D 2 2
MIRT630609 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT630619 CXCR6 C-X-C motif chemokine receptor 6 2 2
MIRT630631 IMPAD1 inositol monophosphatase domain containing 1 2 2
MIRT630674 KLF7 Kruppel like factor 7 2 2
MIRT630746 COG6 component of oligomeric golgi complex 6 2 2
MIRT636853 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT638642 GPATCH8 G-patch domain containing 8 2 2
MIRT639106 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT639422 PKP1 plakophilin 1 2 2
MIRT640187 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT641757 SF3A1 splicing factor 3a subunit 1 2 2
MIRT666577 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT672166 FANCF Fanconi anemia complementation group F 2 2
MIRT688345 ETS1 ETS proto-oncogene 1, transcription factor 2 2
MIRT690120 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT696939 CERK ceramide kinase 2 2
MIRT701361 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT703288 GID4 GID complex subunit 4 homolog 2 2
MIRT709146 ZNF799 zinc finger protein 799 2 2
MIRT710848 FAM210A family with sequence similarity 210 member A 2 2
MIRT712621 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT714591 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT716909 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT721165 FAM200B family with sequence similarity 200 member B 2 2
MIRT722404 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT722517 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT724599 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-19a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-19a 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miR-19a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-19a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-19a 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-19a Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-19a Histone deacetylase inhibitor ITF2357 NULL 9804992 Quantitative real-time PCR multiple myeloma 19713220 2009 down-regulated
miR-19a Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-19a Arsenic trioxide approved 14888 Quantitative real-time PCR bladder cancer cell line T24 20857258 2011 down-regulated
miR-19a Ibandronate approved 60852 Quantitative real-time PCR Periodontal ligament stem cells (PDLSCs) 21108928 2011 down-regulated
miR-19a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-19a 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR chronic myeloid leukemia (CML)K562 cell line 21176349 2011 down-regulated
miR-19a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-19a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-19a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 down-regulated
miR-19a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 down-regulated
miR-19a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-19a Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-19a Dexamethasone approved 5743 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 down-regulated
miR-19a Arsenic trioxide approved 14888 Microarray bladder cancer cell line T24 20857258 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-19a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-19a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-19a-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-8)
hsa-miR-19a-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-19a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-19a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-19a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-19a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-19a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-19a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission