miRTarBase - #MIRT095781


—
pre-miRNA Information
pre-miRNA hsa-mir-4500   
Genomic Coordinates chr13: 87618665 - 87618740
Description Homo sapiens miR-4500 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4500
Sequence 54| UGAGGUAGUAGUUUCUU |70
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322800324 2 dbSNP
rs1401270256 3 dbSNP
rs1382127193 7 dbSNP
rs1156555764 9 dbSNP
rs1438864054 10 dbSNP
rs1379842540 13 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GRPEL2   
Synonyms Mt-GrpE#2
Description GrpE like 2, mitochondrial
Transcript NM_152407   
Expression
Putative miRNA Targets on GRPEL2
3'UTR of GRPEL2
(miRNA target sites are highlighted)		 
>GRPEL2|NM_152407|3'UTR
   1 AGAGGCCATCAGGAACTGGATGTTCTCCCAGAGCGCAGTCACCTATGTTTCTTTTATTTATTAAACTAGGTTTGTATTGT
  81 ACATGAGGTACTTCATGTGATATGTTTTGGATTTAGTCATATTGGCTTTATTTCTAAGATATTCTATTGATTTAATGTGA
 161 CCTGTTTGGTCTCATCAGAAGTCTTACCATTGGGCATTTGAACAGTGTGACAGGTGTTCCAATGGCCTTTATCAAAACAT
 241 GTTTAGGAAAATTGGTACTGTGATAAATTTGAATCCAAAATCCTTTTAACTATGGGTTTTCAACTACATGTTTCTTCCTA
 321 GCGGTCTCTATAACAGGAATTGTGTAGTATCTTGTATTTTGTGGAAAAAGGAGATGGTAGGGATTGGTTCAACATTTGGG
 401 TACTTAGAGGATAAAGCTTCGTGGTCGTATAAATTTAGATCATTTGGATTGATTTTTATACACATAGATTTTCAGGACTT
 481 TACCTTTTGTTTTGTTTTTTTCCTTTTAGCCATCTTTTGTTCTTGTAATCCCAACTAGATAGGCTTTATGCTCACATCAT
 561 TGTCCCATACCCACCCCTTTCTCATCCCCATTTGCAGGGGCTAAAGGTCTAGATGAGACTTGGAAGGCAAGGAGCATCGA
 641 AATTTGAGATACCCAGGACCCTTTCAAGCAAGAATGGCCAAAAAGCCTTGTGCTGTCTTTGCTCTTCAAATTATTTTCAG
 721 CCTCCTTGTCATATAATCATTTCAGGCAAACTGAGGCAACACTAACAGCTAATGACCCAGATGGCTCTATTTGGGTAATT
 801 TACCTACAACTTATTCCACCAGCCTTTACTCCTCTGCCCTTTTGTCAATTTTACCTTATAATCCTTTATTAAATGATGGG
 881 AGGTGGTGATCAGGACAAAAGTGTTAGGTTCCCATGATTTCTCATTTCATTTATTAATAGTTAATGCTGAATTTTTTTTT
 961 AAGTTTCCTCTGGCTCTATTTATGTTACTTTTTGCGATAAGAACACTTAACATAAGTATTCTCTCCTCTTGGCAATTTTT
1041 TTTTTTTTTCCTGTGTTGCCCAGGCTGACCTCCAACTCCTGGGCCCAAGCAATCCTGCCTCAGCCTGCCAAGTAGCTAGG
1121 ACTACAGGCGTTCACCACTGCGCCCGCAAAGTTTTTTTGTTGTTTTTTTTTTTAAGTTGGTACTCACAAATCACTACCTC
1201 TGTTATATTGACAAGCTCTATTTCCTATTCTTTGTATCTGTTAAGTCACATCTGTGTAAACATTGAGCTCACCTTTTATA
1281 TATTAACCTCTAGAATTAATGGGCCTATGTGGTTTTTTTTCAGTCTTATAGCTGGTGTTCTGTAAAAGATTTGTCCAATA
1361 AACGACTTAATGAATGATACATCAGTCAGATTTTAGGAAGGCAGTCAATTATGGATATTTTAATGTTGGAAGAGGCCTTA
1441 ATGATCAAATCTCACCCTTTCTGCTTCTGAAGTATGAAAATCTAGTCTTTTTAGGACTGGACACAAGGAAAATAATCTCT
1521 AAACTATTGACTAAATTCCAGTGAGAGTATGAATGAAGAACAACTAGATATTAATGTCAATCATTTAAGATTAATGGGCA
1601 TGCAATTAAGTCTCCATTTAAGATTAATGGGCATGCAATGAAGTCTCCAGCAGACAATCAGATGTTGTTGGATGTCTAGA
1681 TTATATAGGTTTAGGTTGAAGTTATAAAATAAAATAAAATTCATTTTCCACTGGAACTCTATGACATTCAGTGGAGTGGT
1761 GGAAAGTTAACCTCTTATACATTATAGATAATTCTAAGACAGCACACAAACTTATCAATAAAGCCATCTCCTTGTGGGCC
1841 TTACCATCTTCATCAGATTTAGACCCTTAAAAAACAAGTAAATATGCACTTTTAAAATGCAATCAAAAGACTGGTGGTTA
1921 AGCTTGTAAAACCAGAACATCTTTTGGCATTCCACTAAGTATATATTGTAAATTTAATGAACAATCAAGGTTCACAATAG
2001 GAAGTTGTCTTTTTTTGCCTTCCATTCTGTGAGATTTGACAGATGGTGACAATAAGAAAATGAGCTGATTGTAATTACTC
2081 TCTGTGTGTTTTTTTATTGCTAGCTATCATTACCAGTTAGAATTAACATTAATTACAATTAACAATAATTTTAGGTATGG
2161 AATGTTATGATTACCTAAAGAGATGTCTCTACCTAATGAGCTCAAGTGATCCTCCCACCTCAGCCTACCAAGTAGCCAGG
2241 ACCACAGGCAAGTGCACCACCATGACTGGCTAGTTTTGTTTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTTTTTTTTTG
2321 GTTGGTTGGTTGTTTTTTACAGGCGGGGTCTCACTATATTGTCCAGGCTAGAAGAATTTTCTAATGGTCTATTACACCTC
2401 CCGTTTTGGCAAGTAAATTCAGAATAATTTTAGGTTCTTTTGTTATTCAGTAGTTTTGCAGACTTAAAAGTGTAAATTTA
2481 GAATTAGAAGATGAAGCTATAGTAGTAAGAATCTCAAGCTGAAGGGCTTTGGGGAGCCAAAGCAGCATATTAGAGCATAG
2561 GCTTGAACTTAAATCTCAGCTCAGTCACCTGCAGGACTTTAGGCACCAGTGATTTCACCCTTCTGAGCCTGTTTCTTTAT
2641 TCGTAAAATGATTATAATAATTCTTTCACAGCGTTGTGAGGATTAAGTGAAATGTGTTAAATGCCTACTACAGTAGGTGC
2721 TCAGATATTTATTTTTATTTTTTTATTATGCACATTGTTTTTCCTGCCTTTTTATGGCTGTCTAAAGTCTAGGGAAAAGG
2801 GAAGACTGGTTAATGATGAGTAGAAAAAACTTGTAAGCTAATCATTCACTGACTTATTTTCCTTCCATTTTCTGGTTTTT
2881 AAAATTAGCCACACCACAGGAAACCCACATTTTTAGATGGAAAGAGCAAGAAAATTGTGTCAGTGCTCTTAGTTATTTTC
2961 ATCTTAATGGTATAGTGAAAAGACATTGACTTGAGATGATACTAAGGAAGCTTTGGCTCACTCTCACTTGAAGAGGGGAT
3041 CTTGGTGTTGTAGTACTTGGACTGTACAAATGTTTTACTGACTTTTCTTACTGCTGTAAAGGAATCAGGCAGTTGGGTAT
3121 TGATATGTTATTTGGTGCTCTCATTCATGGCAAAGGATTTGATAAATAAAAGTTCTTTAAACACTAAAGCAAAATCAAAT
3201 GAGCAAAACTAAGGATGAAATGTAATATTCATCAGAACAAGGATCACTGAGAAAAAATATTCAGAAACAACTTTAATAAA
3281 ACCTGAATTGAAATAACTGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uucUUUGAUGAUGGAGu 5'
             |||: |||||||| 
Target 5' cacAAATCACTACCTCt 3'
 1185 - 1201 158.00 -11.80
2 
miRNA  3' uucUUUG--AUGAUGGAGu 5'
             ||:|  | ||:|||| 
Target 5' cccAAGCAATCCTGCCTCa 3'
 1084 - 1102 132.00 -11.10
3 
miRNA  3' uuCUUU---GAUGAUGGAgu 5'
            ||:|   || ||||||  
Target 5' aaGAGATGTCT-CTACCTaa 3'
 2178 - 2196 126.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5746491 1 COSMIC
COSN26978178 6 COSMIC
COSN31587096 7 COSMIC
COSN8492059 32 COSMIC
COSN26553431 36 COSMIC
COSN30509503 41 COSMIC
COSN31593230 42 COSMIC
COSN30521448 53 COSMIC
COSN30470862 63 COSMIC
COSN6867427 77 COSMIC
COSN31610305 134 COSMIC
COSN23266700 158 COSMIC
COSN28198219 319 COSMIC
COSN25030709 390 COSMIC
COSN29875747 422 COSMIC
COSN9411078 442 COSMIC
COSN29318470 835 COSMIC
COSN20102035 1174 COSMIC
COSN32063383 1239 COSMIC
COSN16130464 1683 COSMIC
COSN19664353 1791 COSMIC
COSN31585003 1871 COSMIC
COSN26644589 1876 COSMIC
COSN31585867 1975 COSMIC
COSN19390539 2141 COSMIC
COSN27311332 2320 COSMIC
COSN6867428 2342 COSMIC
COSN27905154 2854 COSMIC
COSN23425796 3046 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755997296 5 dbSNP
rs778576589 6 dbSNP
rs1257838800 12 dbSNP
rs1412719754 14 dbSNP
rs777339259 18 dbSNP
rs1212503643 24 dbSNP
rs753227310 24 dbSNP
rs756955013 25 dbSNP
rs1429149941 26 dbSNP
rs778495465 29 dbSNP
rs745489024 32 dbSNP
rs200331421 35 dbSNP
rs780384770 36 dbSNP
rs1366365363 41 dbSNP
rs779794013 43 dbSNP
rs1299321486 44 dbSNP
rs546964513 46 dbSNP
rs1189183865 47 dbSNP
rs1055232403 48 dbSNP
rs571253937 48 dbSNP
rs1194758264 49 dbSNP
rs1396878077 53 dbSNP
rs747704267 53 dbSNP
rs896140567 62 dbSNP
rs1171925474 63 dbSNP
rs1431691268 71 dbSNP
rs1390973886 80 dbSNP
rs1432986005 88 dbSNP
rs375529106 88 dbSNP
rs538639295 92 dbSNP
rs1474320429 94 dbSNP
rs1238934642 101 dbSNP
rs1036798388 106 dbSNP
rs1287102754 119 dbSNP
rs143986195 147 dbSNP
rs1027787880 166 dbSNP
rs1396393131 175 dbSNP
rs188254387 182 dbSNP
rs1332248700 186 dbSNP
rs182035095 191 dbSNP
rs1268338992 192 dbSNP
rs773784789 195 dbSNP
rs1330687596 196 dbSNP
rs1018052760 202 dbSNP
rs1355125673 208 dbSNP
rs966053711 217 dbSNP
rs1242059430 224 dbSNP
rs976032694 226 dbSNP
rs748088194 233 dbSNP
rs1483826793 240 dbSNP
rs1415870550 242 dbSNP
rs184828053 245 dbSNP
rs1163685803 261 dbSNP
rs1021009484 263 dbSNP
rs966725783 268 dbSNP
rs1254451617 284 dbSNP
rs1183845846 292 dbSNP
rs1472646836 296 dbSNP
rs1231862045 299 dbSNP
rs540520017 305 dbSNP
rs1436644161 306 dbSNP
rs1475066997 314 dbSNP
rs1160265465 322 dbSNP
rs1292629960 323 dbSNP
rs771970855 324 dbSNP
rs565274471 331 dbSNP
rs917801373 343 dbSNP
rs189160051 350 dbSNP
rs1374297772 351 dbSNP
rs1279110202 357 dbSNP
rs1440099223 360 dbSNP
rs1455723320 362 dbSNP
rs1158389081 365 dbSNP
rs1324056057 368 dbSNP
rs783777 374 dbSNP
rs1466439642 400 dbSNP
rs1036664368 401 dbSNP
rs139889678 404 dbSNP
rs1353374529 408 dbSNP
rs1413941111 413 dbSNP
rs1478691517 418 dbSNP
rs1288657215 421 dbSNP
rs143254560 422 dbSNP
rs1468333396 427 dbSNP
rs1049730385 428 dbSNP
rs1210935007 437 dbSNP
rs1317811345 448 dbSNP
rs766168650 462 dbSNP
rs376085554 466 dbSNP
rs1212908221 467 dbSNP
rs1304099543 468 dbSNP
rs1440144388 472 dbSNP
rs1254760791 485 dbSNP
rs1322373669 495 dbSNP
rs548730958 498 dbSNP
rs561061130 508 dbSNP
rs902075768 518 dbSNP
rs997481891 519 dbSNP
rs146191751 525 dbSNP
rs1471708280 535 dbSNP
rs966799891 540 dbSNP
rs1251669511 545 dbSNP
rs62378142 546 dbSNP
rs1032614083 547 dbSNP
rs1486361981 548 dbSNP
rs571568615 553 dbSNP
rs959251458 554 dbSNP
rs1314143324 556 dbSNP
rs1178234820 560 dbSNP
rs1373548627 563 dbSNP
rs35269240 568 dbSNP
rs1433887436 569 dbSNP
rs1299654772 575 dbSNP
rs1382575376 581 dbSNP
rs1360963229 584 dbSNP
rs1286773727 585 dbSNP
rs139120668 601 dbSNP
rs1308337255 603 dbSNP
rs1449835378 613 dbSNP
rs759696729 620 dbSNP
rs1372056596 622 dbSNP
rs1172546265 627 dbSNP
rs1432264621 635 dbSNP
rs1393817334 637 dbSNP
rs1439510367 639 dbSNP
rs991030582 643 dbSNP
rs1429509202 658 dbSNP
rs1419312811 671 dbSNP
rs1185111338 682 dbSNP
rs765333065 685 dbSNP
rs917847825 686 dbSNP
rs1258470389 689 dbSNP
rs1210270347 691 dbSNP
rs1367774110 703 dbSNP
rs970592264 710 dbSNP
rs1276729207 721 dbSNP
rs972434594 735 dbSNP
rs73795987 736 dbSNP
rs1229813885 748 dbSNP
rs1347709128 761 dbSNP
rs1355714992 768 dbSNP
rs752755364 772 dbSNP
rs1311830661 777 dbSNP
rs1412422275 798 dbSNP
rs758939113 800 dbSNP
rs1048127867 805 dbSNP
rs910938523 808 dbSNP
rs1354462274 810 dbSNP
rs1168853434 811 dbSNP
rs762854491 815 dbSNP
rs1187444077 824 dbSNP
rs902142675 825 dbSNP
rs1206349726 831 dbSNP
rs576389475 834 dbSNP
rs997715382 838 dbSNP
rs1480305102 840 dbSNP
rs1204137021 849 dbSNP
rs1247508903 855 dbSNP
rs1223504218 857 dbSNP
rs1335196192 865 dbSNP
rs1479083549 870 dbSNP
rs142492416 877 dbSNP
rs757627516 886 dbSNP
rs536320725 895 dbSNP
rs1453682720 925 dbSNP
rs879557089 929 dbSNP
rs1169013274 934 dbSNP
rs1307172711 938 dbSNP
rs1390300987 941 dbSNP
rs1396431355 943 dbSNP
rs1001248314 952 dbSNP
rs1032438452 952 dbSNP
rs1395609853 968 dbSNP
rs1164627063 981 dbSNP
rs1460106645 984 dbSNP
rs959686051 993 dbSNP
rs1407995040 996 dbSNP
rs1182692412 997 dbSNP
rs900344542 1006 dbSNP
rs1012082806 1008 dbSNP
rs370336945 1013 dbSNP
rs970669055 1020 dbSNP
rs972634035 1035 dbSNP
rs1189271753 1036 dbSNP
rs1330845526 1036 dbSNP
rs368880850 1036 dbSNP
rs1237705565 1050 dbSNP
rs1437992315 1051 dbSNP
rs918282444 1053 dbSNP
rs1370933189 1054 dbSNP
rs1229844561 1056 dbSNP
rs1300403755 1059 dbSNP
rs75701657 1062 dbSNP
rs878867392 1063 dbSNP
rs1439138672 1070 dbSNP
rs1387429721 1073 dbSNP
rs1159328284 1081 dbSNP
rs1453177363 1089 dbSNP
rs1214340883 1093 dbSNP
rs1362188273 1096 dbSNP
rs984164566 1105 dbSNP
rs1290881555 1108 dbSNP
rs1454709082 1109 dbSNP
rs1453479834 1110 dbSNP
rs910983276 1110 dbSNP
rs1448450794 1113 dbSNP
rs754626574 1130 dbSNP
rs566710798 1131 dbSNP
rs1348068140 1137 dbSNP
rs1257287857 1138 dbSNP
rs1211937131 1139 dbSNP
rs534131844 1142 dbSNP
rs1465386221 1143 dbSNP
rs151119231 1146 dbSNP
rs865849056 1147 dbSNP
rs933598146 1158 dbSNP
rs1381905534 1160 dbSNP
rs1383072817 1162 dbSNP
rs1373477409 1163 dbSNP
rs1394411609 1163 dbSNP
rs1476281608 1163 dbSNP
rs34012190 1163 dbSNP
rs397883206 1163 dbSNP
rs879127099 1163 dbSNP
rs1042637525 1164 dbSNP
rs1259161139 1166 dbSNP
rs1210994410 1175 dbSNP
rs1167038202 1181 dbSNP
rs1280269604 1184 dbSNP
rs1426148649 1187 dbSNP
rs1414106825 1188 dbSNP
rs1271206434 1198 dbSNP
rs902742701 1201 dbSNP
rs1162314207 1207 dbSNP
rs577484634 1209 dbSNP
rs1415512117 1217 dbSNP
rs1374873594 1220 dbSNP
rs181668726 1222 dbSNP
rs1411625747 1224 dbSNP
rs1397120139 1228 dbSNP
rs1167169081 1235 dbSNP
rs1474270326 1237 dbSNP
rs1419575799 1246 dbSNP
rs1054155817 1259 dbSNP
rs1414753742 1263 dbSNP
rs1474664421 1271 dbSNP
rs556501078 1279 dbSNP
rs1323210405 1283 dbSNP
rs1206002648 1287 dbSNP
rs1440117890 1288 dbSNP
rs895269676 1293 dbSNP
rs778482092 1303 dbSNP
rs1316408363 1304 dbSNP
rs1325142310 1308 dbSNP
rs1012738956 1313 dbSNP
rs201141949 1313 dbSNP
rs562816126 1313 dbSNP
rs1355022881 1314 dbSNP
rs1024844851 1319 dbSNP
rs1444447198 1325 dbSNP
rs761251805 1329 dbSNP
rs1336291017 1330 dbSNP
rs1430473559 1332 dbSNP
rs114111616 1338 dbSNP
rs993981097 1341 dbSNP
rs1025580884 1344 dbSNP
rs952704810 1344 dbSNP
rs1358768193 1359 dbSNP
rs542335769 1362 dbSNP
rs1415193039 1364 dbSNP
rs560578214 1365 dbSNP
rs1272750361 1368 dbSNP
rs1234001909 1369 dbSNP
rs1181662529 1381 dbSNP
rs1018348423 1387 dbSNP
rs773069903 1409 dbSNP
rs541423366 1413 dbSNP
rs1334512339 1419 dbSNP
rs1263767318 1420 dbSNP
rs963856697 1436 dbSNP
rs1351441224 1437 dbSNP
rs141073430 1444 dbSNP
rs559591418 1457 dbSNP
rs62378143 1462 dbSNP
rs531837689 1473 dbSNP
rs532419162 1476 dbSNP
rs1439823273 1483 dbSNP
rs1391849073 1486 dbSNP
rs1160794341 1488 dbSNP
rs1185434067 1501 dbSNP
rs1400807551 1508 dbSNP
rs1416702922 1509 dbSNP
rs544626252 1516 dbSNP
rs550628851 1516 dbSNP
rs1156270035 1517 dbSNP
rs1160657121 1527 dbSNP
rs924197120 1540 dbSNP
rs1194667687 1543 dbSNP
rs1468265502 1548 dbSNP
rs1383482966 1550 dbSNP
rs568830242 1552 dbSNP
rs1245231887 1554 dbSNP
rs1218151929 1556 dbSNP
rs936915171 1559 dbSNP
rs1283736086 1565 dbSNP
rs1053826678 1581 dbSNP
rs1303985743 1597 dbSNP
rs529695355 1599 dbSNP
rs1233337734 1600 dbSNP
rs547838334 1629 dbSNP
rs566230766 1633 dbSNP
rs895126497 1638 dbSNP
rs1342678955 1639 dbSNP
rs551547611 1641 dbSNP
rs1344230104 1643 dbSNP
rs1295867412 1649 dbSNP
rs569883590 1656 dbSNP
rs1435975424 1660 dbSNP
rs1292918332 1662 dbSNP
rs1046537939 1675 dbSNP
rs1454124135 1683 dbSNP
rs1351267790 1689 dbSNP
rs906587028 1695 dbSNP
rs1241686582 1697 dbSNP
rs139144586 1704 dbSNP
rs367795505 1704 dbSNP
rs533508892 1704 dbSNP
rs1025445059 1705 dbSNP
rs1210142071 1706 dbSNP
rs1258988484 1712 dbSNP
rs1310333482 1716 dbSNP
rs1297537644 1735 dbSNP
rs1350012089 1740 dbSNP
rs776933518 1742 dbSNP
rs888410953 1746 dbSNP
rs1416121944 1759 dbSNP
rs1005868355 1760 dbSNP
rs1017962330 1775 dbSNP
rs1311721209 1775 dbSNP
rs1357915913 1779 dbSNP
rs1173006550 1782 dbSNP
rs1486561469 1786 dbSNP
rs776456867 1789 dbSNP
rs1191721618 1797 dbSNP
rs976359434 1806 dbSNP
rs1029372799 1808 dbSNP
rs1187300976 1810 dbSNP
rs1472693433 1812 dbSNP
rs1482267682 1819 dbSNP
rs967059333 1821 dbSNP
rs3210763 1831 dbSNP
rs978267869 1833 dbSNP
rs534095136 1835 dbSNP
rs186391722 1840 dbSNP
rs1234800694 1846 dbSNP
rs924095430 1852 dbSNP
rs1292201327 1853 dbSNP
rs1173745236 1861 dbSNP
rs1377735919 1866 dbSNP
rs1393733902 1881 dbSNP
rs149837990 1886 dbSNP
rs1300379072 1901 dbSNP
rs1312609897 1903 dbSNP
rs990123110 1904 dbSNP
rs1168948701 1905 dbSNP
rs1007942038 1915 dbSNP
rs1019468030 1917 dbSNP
rs759769100 1925 dbSNP
rs1411955662 1926 dbSNP
rs780555296 1943 dbSNP
rs963845254 1956 dbSNP
rs1186944192 1957 dbSNP
rs764471194 1957 dbSNP
rs1422059428 1958 dbSNP
rs916817354 1960 dbSNP
rs1177663072 1962 dbSNP
rs1335315571 1976 dbSNP
rs996785920 1984 dbSNP
rs948065375 1987 dbSNP
rs1215321104 1990 dbSNP
rs1021568399 1992 dbSNP
rs538529742 1994 dbSNP
rs1272072994 1999 dbSNP
rs1234036364 2000 dbSNP
rs928038049 2006 dbSNP
rs1275383661 2010 dbSNP
rs1307065983 2017 dbSNP
rs1392523087 2028 dbSNP
rs755655234 2032 dbSNP
rs556626495 2037 dbSNP
rs574736974 2040 dbSNP
rs930043799 2043 dbSNP
rs1443487680 2047 dbSNP
rs1451153674 2052 dbSNP
rs1046966516 2056 dbSNP
rs1162845747 2061 dbSNP
rs923895946 2063 dbSNP
rs1365657274 2066 dbSNP
rs754307890 2070 dbSNP
rs1439073345 2077 dbSNP
rs1195271792 2078 dbSNP
rs1378345805 2078 dbSNP
rs1468719834 2081 dbSNP
rs779229379 2083 dbSNP
rs956794161 2085 dbSNP
rs191245991 2091 dbSNP
rs1260876915 2097 dbSNP
rs1029280606 2098 dbSNP
rs1353635577 2109 dbSNP
rs554279148 2115 dbSNP
rs1247974791 2117 dbSNP
rs1436782352 2119 dbSNP
rs1198868646 2133 dbSNP
rs948246136 2136 dbSNP
rs1323282668 2143 dbSNP
rs981334727 2158 dbSNP
rs1385349149 2159 dbSNP
rs1031194036 2163 dbSNP
rs1397461101 2164 dbSNP
rs1289538568 2169 dbSNP
rs1419104068 2177 dbSNP
rs920222800 2199 dbSNP
rs1453065039 2201 dbSNP
rs931554979 2202 dbSNP
rs181273523 2204 dbSNP
rs1046730341 2214 dbSNP
rs1376902286 2217 dbSNP
rs989635894 2230 dbSNP
rs1429996401 2234 dbSNP
rs1261921330 2237 dbSNP
rs886742131 2246 dbSNP
rs546353929 2247 dbSNP
rs1486997674 2248 dbSNP
rs1284528426 2259 dbSNP
rs1040794496 2267 dbSNP
rs565068837 2270 dbSNP
rs1296721869 2274 dbSNP
rs1231452067 2278 dbSNP
rs1296518044 2280 dbSNP
rs1328431416 2280 dbSNP
rs375919640 2280 dbSNP
rs546763534 2280 dbSNP
rs560324722 2280 dbSNP
rs996722917 2281 dbSNP
rs1314799753 2286 dbSNP
rs1021872093 2287 dbSNP
rs904440481 2294 dbSNP
rs924417332 2294 dbSNP
rs1387434561 2295 dbSNP
rs1463266673 2295 dbSNP
rs1325567862 2299 dbSNP
rs369606584 2299 dbSNP
rs999142310 2300 dbSNP
rs1031013307 2301 dbSNP
rs560411640 2301 dbSNP
rs1232054606 2302 dbSNP
rs1302554542 2304 dbSNP
rs1259051898 2305 dbSNP
rs375328285 2306 dbSNP
rs927944817 2306 dbSNP
rs1229326295 2307 dbSNP
rs6875079 2307 dbSNP
rs529101108 2308 dbSNP
rs6875080 2308 dbSNP
rs748382745 2308 dbSNP
rs548736231 2309 dbSNP
rs992101790 2309 dbSNP
rs930067035 2310 dbSNP
rs1047196083 2318 dbSNP
rs1218298647 2329 dbSNP
rs909937876 2329 dbSNP
rs1209932079 2334 dbSNP
rs769973358 2335 dbSNP
rs1415418240 2341 dbSNP
rs1339805766 2345 dbSNP
rs969437169 2346 dbSNP
rs532251014 2348 dbSNP
rs1397003922 2349 dbSNP
rs920049725 2354 dbSNP
rs1463794765 2356 dbSNP
rs185199119 2357 dbSNP
rs899786840 2363 dbSNP
rs1472155431 2370 dbSNP
rs1237436883 2374 dbSNP
rs998049380 2375 dbSNP
rs1186111108 2379 dbSNP
rs983411217 2392 dbSNP
rs1239243675 2403 dbSNP
rs1323413072 2404 dbSNP
rs1316315158 2411 dbSNP
rs189622801 2422 dbSNP
rs1228989817 2426 dbSNP
rs1355667434 2437 dbSNP
rs1282475161 2438 dbSNP
rs1444339812 2451 dbSNP
rs902839370 2460 dbSNP
rs1209861193 2467 dbSNP
rs1168698561 2493 dbSNP
rs1326107964 2499 dbSNP
rs1372753142 2500 dbSNP
rs1404374235 2501 dbSNP
rs374460558 2506 dbSNP
rs168463 2520 dbSNP
rs1040722308 2549 dbSNP
rs1381416893 2552 dbSNP
rs374020105 2562 dbSNP
rs372003023 2563 dbSNP
rs1255146666 2570 dbSNP
rs1222646528 2574 dbSNP
rs1167344999 2577 dbSNP
rs1451218860 2593 dbSNP
rs1392430463 2595 dbSNP
rs1225526643 2606 dbSNP
rs957109728 2610 dbSNP
rs1308357388 2613 dbSNP
rs1237718950 2621 dbSNP
rs1372978177 2628 dbSNP
rs568823285 2632 dbSNP
rs932351297 2644 dbSNP
rs1042900346 2652 dbSNP
rs1325209828 2658 dbSNP
rs982349338 2658 dbSNP
rs904324812 2667 dbSNP
rs951372296 2671 dbSNP
rs1438356843 2674 dbSNP
rs998799698 2677 dbSNP
rs547800593 2679 dbSNP
rs1397312729 2688 dbSNP
rs1192134643 2691 dbSNP
rs531571017 2692 dbSNP
rs1477854981 2695 dbSNP
rs183348529 2702 dbSNP
rs895722710 2717 dbSNP
rs1488630537 2719 dbSNP
rs1293113210 2728 dbSNP
rs1325613607 2729 dbSNP
rs1245111990 2737 dbSNP
rs1274658167 2738 dbSNP
rs772046522 2750 dbSNP
rs1332104751 2755 dbSNP
rs1218371248 2756 dbSNP
rs1212458914 2761 dbSNP
rs975685209 2764 dbSNP
rs567958761 2768 dbSNP
rs1400099193 2769 dbSNP
rs1185166986 2777 dbSNP
rs921082131 2779 dbSNP
rs1261532740 2785 dbSNP
rs762460040 2788 dbSNP
rs1024928700 2789 dbSNP
rs969502714 2795 dbSNP
rs981230339 2796 dbSNP
rs1177261738 2799 dbSNP
rs1027168770 2800 dbSNP
rs35528284 2804 dbSNP
rs982954611 2817 dbSNP
rs908825070 2825 dbSNP
rs1262655454 2834 dbSNP
rs1191584197 2835 dbSNP
rs1486620871 2838 dbSNP
rs1256450798 2840 dbSNP
rs965614168 2841 dbSNP
rs750822018 2859 dbSNP
rs892918883 2866 dbSNP
rs1274828260 2877 dbSNP
rs1218901665 2882 dbSNP
rs1415942011 2890 dbSNP
rs1316915335 2900 dbSNP
rs1012663114 2906 dbSNP
rs1461002417 2910 dbSNP
rs552036179 2922 dbSNP
rs920894751 2925 dbSNP
rs1381975335 2948 dbSNP
rs1024254123 2949 dbSNP
rs571015978 2950 dbSNP
rs1357827707 2951 dbSNP
rs1455323464 2961 dbSNP
rs778375098 2963 dbSNP
rs553776184 2994 dbSNP
rs1466391244 2995 dbSNP
rs538064719 2997 dbSNP
rs1476206814 3024 dbSNP
rs1361095209 3038 dbSNP
rs1415155629 3039 dbSNP
rs1256810645 3041 dbSNP
rs1035277155 3045 dbSNP
rs1479159750 3051 dbSNP
rs951567587 3053 dbSNP
rs1353107072 3065 dbSNP
rs550404639 3068 dbSNP
rs1232186476 3071 dbSNP
rs925705418 3076 dbSNP
rs983228112 3077 dbSNP
rs1316933679 3080 dbSNP
rs1016928116 3082 dbSNP
rs1234627358 3083 dbSNP
rs550756143 3088 dbSNP
rs147927292 3095 dbSNP
rs1260652292 3102 dbSNP
rs1377607827 3111 dbSNP
rs963147344 3111 dbSNP
rs752401823 3116 dbSNP
rs1447899298 3124 dbSNP
rs1399883792 3127 dbSNP
rs975503530 3130 dbSNP
rs1459616928 3132 dbSNP
rs1369164010 3136 dbSNP
rs1422042766 3138 dbSNP
rs141681853 3148 dbSNP
rs1179025846 3154 dbSNP
rs1255678454 3176 dbSNP
rs895776733 3178 dbSNP
rs1474974152 3198 dbSNP
rs1236004659 3216 dbSNP
rs1215219580 3232 dbSNP
rs933839959 3237 dbSNP
rs565615870 3241 dbSNP
rs1183134863 3244 dbSNP
rs1014086198 3263 dbSNP
rs1320450510 3265 dbSNP
rs1312052248 3272 dbSNP
rs986563939 3283 dbSNP
rs539572025 3285 dbSNP
rs934595017 3298 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uucUUUGAUGAUGGAGu 5'
             |||: |||||||| 
Target 5' cacAAAUCACUACCUCu 3'
 		5 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 134266.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 134266.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9 PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6 PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10 PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6 PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_152407 | 3UTR | UAAGUUGGUACUCACAAAUCACUACCUCUGUUAUAUUGACAAGCUCUAUUUCCUAUUCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_152407 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAUUGACAAGCUCUAUUUCCUAUUCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_152407 | 3UTR | ACUCACAAAUCACUACCUCUGUUAUAUUGACAAGCUCUAUUUCCUAUUCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAUUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000329271.3 | 3UTR | ACUCACAAAUCACUACCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
278 hsa-miR-4500 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063205 ADIPOR2 adiponectin receptor 2 2 2
MIRT065701 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT066489 HMGA2 high mobility group AT-hook 2 2 4
MIRT067415 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068169 TXLNA taxilin alpha 2 2
MIRT068540 NHLRC3 NHL repeat containing 3 2 6
MIRT068798 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073020 ARID3B AT-rich interaction domain 3B 2 6
MIRT073683 IGF1R insulin like growth factor 1 receptor 2 8
MIRT076241 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077628 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080409 ONECUT2 one cut homeobox 2 2 2
MIRT083315 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084989 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094172 PCGF3 polycomb group ring finger 3 2 6
MIRT094475 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095781 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100105 ABT1 activator of basal transcription 1 2 8
MIRT112254 MDM4 MDM4, p53 regulator 2 4
MIRT118595 STK4 serine/threonine kinase 4 2 2
MIRT120932 PDE12 phosphodiesterase 12 2 8
MIRT123336 CALU calumenin 2 2
MIRT123991 POLR3D RNA polymerase III subunit D 2 2
MIRT152317 TNFSF9 TNF superfamily member 9 2 2
MIRT153921 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168608 HMGA1 high mobility group AT-hook 1 2 4
MIRT180614 CRY2 cryptochrome circadian clock 2 2 2
MIRT187726 SUOX sulfite oxidase 2 2
MIRT191415 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193113 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215732 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218822 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240344 UBXN2B UBX domain protein 2B 2 2
MIRT243480 TRIM71 tripartite motif containing 71 2 2
MIRT244088 EDN1 endothelin 1 2 2
MIRT252341 SALL3 spalt like transcription factor 3 2 2
MIRT255327 CDV3 CDV3 homolog 2 2
MIRT259295 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259499 TXLNG taxilin gamma 2 2
MIRT260715 CLDN12 claudin 12 2 6
MIRT264701 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266228 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266635 CHTOP chromatin target of PRMT1 2 2
MIRT268847 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT284540 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT294453 ZNF264 zinc finger protein 264 2 2
MIRT297023 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297451 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300049 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300907 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303328 MXD1 MAX dimerization protein 1 2 2
MIRT309858 NAT8L N-acetyltransferase 8 like 2 2
MIRT322434 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324742 ACER2 alkaline ceramidase 2 2 2
MIRT402068 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT442014 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445653 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447131 KIF27 kinesin family member 27 2 2
MIRT448262 ZNF774 zinc finger protein 774 2 2
MIRT449002 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449949 FMNL3 formin like 3 2 2
MIRT451150 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451620 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451689 C1RL complement C1r subcomponent like 2 2
MIRT452087 NUCB2 nucleobindin 2 2 2
MIRT452427 QDPR quinoid dihydropteridine reductase 2 2
MIRT452938 DISC1 disrupted in schizophrenia 1 2 2
MIRT453397 RHD Rh blood group D antigen 2 6
MIRT454159 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454275 FXN frataxin 2 2
MIRT454535 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454849 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455671 GLO1 glyoxalase I 2 2
MIRT457243 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457671 ZNF587 zinc finger protein 587 2 2
MIRT457882 THEM6 thioesterase superfamily member 6 2 4
MIRT458012 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458275 FUT10 fucosyltransferase 10 2 2
MIRT459732 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460447 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460495 FAM105A family with sequence similarity 105 member A 2 6
MIRT460933 NOA1 nitric oxide associated 1 2 4
MIRT461088 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461164 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461360 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462377 YAE1D1 Yae1 domain containing 1 2 2
MIRT462775 ZNF8 zinc finger protein 8 2 2
MIRT463426 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463656 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464260 VCL vinculin 2 2
MIRT465121 TSC22D2 TSC22 domain family member 2 2 4
MIRT466190 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466728 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469098 RNF144B ring finger protein 144B 2 2
MIRT469718 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470422 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470684 POLR2D RNA polymerase II subunit D 2 4
MIRT470866 PLXND1 plexin D1 2 2
MIRT471269 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471960 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472677 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472735 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473132 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473237 SMCR7L mitochondrial elongation factor 1 2 5
MIRT473824 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473935 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474020 LRRC20 leucine rich repeat containing 20 2 2
MIRT474504 KLHDC8B kelch domain containing 8B 2 2
MIRT474762 KIAA0930 KIAA0930 2 2
MIRT474912 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475327 IFNLR1 interferon lambda receptor 1 2 2
MIRT475374 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475729 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476544 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476982 FAM83G family with sequence similarity 83 member G 2 4
MIRT477539 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477676 EFHD2 EF-hand domain family member D2 2 2
MIRT479751 CCND1 cyclin D1 2 2
MIRT481189 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481235 ATXN7L3 ataxin 7 like 3 2 2
MIRT481358 ATG9A autophagy related 9A 2 2
MIRT481383 ATG12 autophagy related 12 2 2
MIRT481647 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481843 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482179 AHR aryl hydrocarbon receptor 2 2
MIRT482215 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485301 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486654 ZNF28 zinc finger protein 28 2 2
MIRT489409 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491861 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492217 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492632 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493320 LIMD2 LIM domain containing 2 2 2
MIRT493897 FAM43A family with sequence similarity 43 member A 2 4
MIRT494259 CEP120 centrosomal protein 120 2 2
MIRT494681 ARID3A AT-rich interaction domain 3A 2 2
MIRT495963 TBC1D19 TBC1 domain family member 19 2 2
MIRT496117 SNX17 sorting nexin 17 2 2
MIRT497870 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498115 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499400 PLCG2 phospholipase C gamma 2 2 4
MIRT499489 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499648 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499937 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499993 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500821 THBS1 thrombospondin 1 2 3
MIRT500900 STRN striatin 2 4
MIRT501111 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501179 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501206 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501249 SEMA4C semaphorin 4C 2 6
MIRT501334 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501357 RNF44 ring finger protein 44 2 4
MIRT501394 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501437 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501749 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501939 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502104 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502123 KMT2D lysine methyltransferase 2D 2 4
MIRT502787 CEP135 centrosomal protein 135 2 2
MIRT502839 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504783 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505020 ZNF644 zinc finger protein 644 2 2
MIRT505577 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506359 NUP155 nucleoporin 155 2 6
MIRT506936 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507248 FIGN fidgetin, microtubule severing factor 2 8
MIRT507691 COIL coilin 2 6
MIRT508397 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508660 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508927 AK4 adenylate kinase 4 2 4
MIRT510387 ZNF566 zinc finger protein 566 2 6
MIRT510521 YOD1 YOD1 deubiquitinase 2 6
MIRT511381 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512740 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515949 C9orf156 tRNA methyltransferase O 2 2
MIRT516078 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT521392 RDX radixin 2 4
MIRT522344 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT523623 FZD9 frizzled class receptor 9 2 4
MIRT523728 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523981 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524108 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525722 SOD2 superoxide dismutase 2 2 2
MIRT527758 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529722 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533183 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536373 LEFTY1 left-right determination factor 1 2 2
MIRT543781 RBM12B RNA binding motif protein 12B 2 4
MIRT543863 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545383 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545895 ZNF200 zinc finger protein 200 2 4
MIRT546328 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547374 MSI2 musashi RNA binding protein 2 2 2
MIRT547577 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547834 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT548260 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548342 EPHA4 EPH receptor A4 2 2
MIRT548539 DUSP1 dual specificity phosphatase 1 2 2
MIRT548554 DNAL1 dynein axonemal light chain 1 2 2
MIRT548787 COLEC12 collectin subfamily member 12 2 2
MIRT548976 CCNT2 cyclin T2 2 2
MIRT549026 CBX5 chromobox 5 2 2
MIRT549213 BEND4 BEN domain containing 4 2 4
MIRT549759 ZNF611 zinc finger protein 611 2 6
MIRT549794 KIAA0391 KIAA0391 2 2
MIRT549843 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550723 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550893 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551277 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551313 GSG2 histone H3 associated protein kinase 2 6
MIRT551928 AKAP8 A-kinase anchoring protein 8 2 4
MIRT551998 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552405 ZNF460 zinc finger protein 460 2 4
MIRT553016 USP38 ubiquitin specific peptidase 38 2 2
MIRT555544 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555716 PDZD8 PDZ domain containing 8 2 2
MIRT557377 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557957 FAM222B family with sequence similarity 222 member B 2 2
MIRT559086 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559493 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561777 PEG10 paternally expressed 10 2 2
MIRT564396 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565445 SURF4 surfeit 4 2 2
MIRT566514 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567437 GNG5 G protein subunit gamma 5 2 2
MIRT567712 E2F6 E2F transcription factor 6 2 2
MIRT568652 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569493 THYN1 thymocyte nuclear protein 1 2 2
MIRT573816 TGOLN2 trans-golgi network protein 2 2 2
MIRT574358 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574754 GOLGA4 golgin A4 2 2
MIRT574791 FAM104A family with sequence similarity 104 member A 2 2
MIRT576081 Poteg POTE ankyrin domain family, member G 2 2
MIRT576813 Thbs1 thrombospondin 1 2 3
MIRT616365 RWDD1 RWD domain containing 1 2 2
MIRT617846 FMO4 flavin containing monooxygenase 4 2 2
MIRT642389 ZNF556 zinc finger protein 556 2 2
MIRT680514 PRIM2 DNA primase subunit 2 2 2
MIRT680542 ZNF584 zinc finger protein 584 2 2
MIRT680795 ZNF578 zinc finger protein 578 2 2
MIRT680833 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681136 INTS7 integrator complex subunit 7 2 2
MIRT681266 RFC2 replication factor C subunit 2 2 2
MIRT681318 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681354 BRI3BP BRI3 binding protein 2 2
MIRT681501 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681531 ZNF738 zinc finger protein 738 2 2
MIRT681653 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681733 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681756 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681792 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681864 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681936 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682097 ITGA3 integrin subunit alpha 3 2 4
MIRT682177 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682233 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682379 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682439 MTX3 metaxin 3 2 2
MIRT682599 CPA4 carboxypeptidase A4 2 2
MIRT682635 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689323 FPR1 formyl peptide receptor 1 2 2
MIRT689725 ATXN2 ataxin 2 2 2
MIRT691031 ZNF799 zinc finger protein 799 2 2
MIRT691930 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694879 ZNF417 zinc finger protein 417 2 2
MIRT695250 ZNF443 zinc finger protein 443 2 2
MIRT695408 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700593 PRSS22 protease, serine 22 2 2
MIRT701434 NHLRC2 NHL repeat containing 2 2 2
MIRT702479 KIAA1328 KIAA1328 2 2
MIRT702716 IPO9 importin 9 2 2
MIRT704036 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704415 CTPS1 CTP synthase 1 2 2
MIRT705745 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712369 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713515 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT735773 STAT3 signal transducer and activator of transcription 3 6 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4500 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission