miRTarBase - #MIRT096296


—
pre-miRNA Information
pre-miRNA hsa-mir-646   
Genomic Coordinates chr20: 60308474 - 60308567
Synonyms MIRN646, hsa-mir-646, MIR646
Description Homo sapiens miR-646 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-646
Sequence 61| AAGCAGCUGCCUCUGAGGC |79
Evidence Experimental
Experiments SAGE
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs750684400 6 dbSNP
rs112880289 10 dbSNP
rs553679341 11 dbSNP
rs941692683 13 dbSNP
rs6513497 14 dbSNP
rs1431341059 18 dbSNP
rs1479355932 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SQSTM1   
Synonyms A170, DMRV, FTDALS3, NADGP, OSIL, PDB3, ZIP3, p60, p62, p62B
Description sequestosome 1
Transcript NM_003900   
Other Transcripts NM_001142299 , NM_001142298   
Expression
Putative miRNA Targets on SQSTM1
3'UTR of SQSTM1
(miRNA target sites are highlighted)		 
>SQSTM1|NM_003900|3'UTR
   1 CCACTTTTGCCCACCTCTTCTGCGTGCCCCTCTTCTGTCTCATAGTTGTGTTAAGCTTGCGTAGAATTGCAGGTCTCTGT
  81 ACGGGCCAGTTTCTCTGCCTTCTTCCAGGATCAGGGGTTAGGGTGCAAGAAGCCATTTAGGGCAGCAAAACAAGTGACAT
 161 GAAGGGAGGGTCCCTGTGTGTGTGTGTGCTGATGTTTCCTGGGTGCCCTGGCTCCTTGCAGCAGGGCTGGGCCTGCGAGA
 241 CCCAAGGCTCACTGCAGCGCGCTCCTGACCCCTCCCTGCAGGGGCTACGTTAGCAGCCCAGCACATAGCTTGCCTAATGG
 321 CTTTCACTTTCTCTTTTGTTTTAAATGACTCATAGGTCCCTGACATTTAGTTGATTATTTTCTGCTACAGACCTGGTACA
 401 CTCTGATTTTAGATAAAGTAAGCCTAGGTGTTGTCAGCAGGCAGGCTGGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGA
 481 CTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGAGCTGCCTCCTGGTCTCTTCACCACTGTAGTTCTC
 561 TCATTTCCAAACCATCAGCTGCTTTTAAAATAAGATCTCTTTGTAGCCATCCTGTTAAATTTGTAAACAATCTAATTAAA
 641 TGGCATCAGCACTTTAACCAATGACGTTTGCATAGAGAGAAATGATTGACAGTAAGTTTATTGTTAATGGTTCTTACAGA
 721 GTATCTTTAAAAGTGCCTTAGGGGAACCCTGTCCCTCCTAACAAGTGTATCTCGATTAATAACCTGCCAGTCCCAGATCA
 801 CACATCATCATCGAAGTCTTCCCCAGTTATAAAGAGGTCACATAGTCGTGTGGGTCGAGGATTCTGTGCCTCCAGGACCA
 881 GGGGCCCACCCTCTGCCCAGGGAGTCCTTGCGTCCCATGAGGTCTTCCCGCAAGGCCTCTCAGACCCAGATGTGACGGGG
 961 TGTGTGGCCCGAGGAAGCTGGACAGCGGCAGTGGGCCTGCTGAGGCCTTCTCTTGAGGCCTGTGCTCTGGGGGTCCCTTG
1041 CTTAGCCTGTGCTGGACCAGCTGGCCTGGGGTCCCTCTGAAGAGACCTTGGCTGCTCACTGTCCACATGTGAACTTTTTC
1121 TAGGTGGCAGGACAAATTGCGCCCATTTAGAGGATGTGGCTGTAACCTGCTGGATGGGACTCCATAGCTCCTTCCCAGGA
1201 CCCCTCAGCTCCCCGGCACTGCAGTCTGCAGAGTTCTCCTGGAGGCAGGGGCTGCTGCCTTGTTTCACCTTCCATGTCAG
1281 GCCAGCCTGTCCCTGAAAGAGAAGATGGCCATGCCCTCCATGTGTAAGAACAATGCCAGGGCCCAGGAGGACCGCCTGCC
1361 CTGCCTGGGCCTTGGCTGGGCCTCTGGTTCTGACACTTTCTGCTGGAAGCTGTCAGGCTGGGACAGGCTTTGATTTTGAG
1441 GGTTAGCAAGACAAAGCAAATAAATGCCTTCCACCTCACCGCAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cggagucuccGUCGACGAa 5'
                    |||||||| 
Target 5' tccaaaccatCAGCTGCTt 3'
 566 - 584 145.00 -13.54
2 
miRNA  3' cgGAG--UCUCCG---UCGACGAa 5'
            |||  :|||||   :|||||| 
Target 5' ttCTCCTGGAGGCAGGGGCTGCTg 3'
 1234 - 1257 143.00 -21.20
3 
miRNA  3' cgGAG---UCUCCG---UCGACGAa 5'
            |||   |||| |   :|||||| 
Target 5' ccCTCTGAAGAGACCTTGGCTGCTc 3'
 1073 - 1097 137.00 -15.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
904053 40 ClinVar
353167 61 ClinVar
904054 67 ClinVar
904055 83 ClinVar
353168 84 ClinVar
353169 175 ClinVar
353170 176 ClinVar
353171 244 ClinVar
353172 260 ClinVar
353173 261 ClinVar
353174 280 ClinVar
353175 289 ClinVar
904832 388 ClinVar
904833 393 ClinVar
904834 432 ClinVar
353176 540 ClinVar
906445 625 ClinVar
906446 711 ClinVar
906447 723 ClinVar
353177 724 ClinVar
906448 787 ClinVar
353178 838 ClinVar
931366 894 ClinVar
353179 988 ClinVar
353180 1102 ClinVar
353181 1112 ClinVar
353182 1139 ClinVar
907441 1142 ClinVar
353183 1206 ClinVar
353184 1236 ClinVar
907442 1274 ClinVar
353185 1298 ClinVar
353186 1323 ClinVar
353187 1337 ClinVar
904121 1354 ClinVar
904122 1395 ClinVar
353188 1481 ClinVar
COSN26996754 9 COSMIC
COSN30128575 11 COSMIC
COSN30470689 16 COSMIC
COSN30178906 18 COSMIC
COSN28854148 25 COSMIC
COSN1083803 62 COSMIC
COSN28646453 67 COSMIC
COSN31507815 72 COSMIC
COSN30187241 73 COSMIC
COSN30115880 85 COSMIC
COSN30178889 94 COSMIC
COSN19669184 186 COSMIC
COSN31513223 193 COSMIC
COSN30169974 318 COSMIC
COSN32077802 475 COSMIC
COSN21651396 496 COSMIC
COSN24385572 497 COSMIC
COSN26434856 507 COSMIC
COSN9422825 538 COSMIC
COSM5991784 591 COSMIC
COSN30115310 636 COSMIC
COSN30506311 652 COSMIC
COSN30101941 656 COSMIC
COSN30154186 676 COSMIC
COSN31606710 680 COSMIC
COSN31491885 708 COSMIC
COSN30150770 726 COSMIC
COSN26968747 733 COSMIC
COSN26564628 736 COSMIC
COSN26968746 775 COSMIC
COSN28191558 790 COSMIC
COSN1312979 793 COSMIC
COSN30153509 797 COSMIC
COSN27160810 798 COSMIC
COSM1620160 801 COSMIC
COSM3011931 814 COSMIC
COSM3854251 818 COSMIC
COSM3744810 848 COSMIC
COSM5569763 851 COSMIC
COSM1066715 857 COSMIC
COSM5868305 858 COSMIC
COSM6497562 913 COSMIC
COSM3854252 925 COSMIC
COSM8934478 931 COSMIC
COSM272428 932 COSMIC
COSM3661758 940 COSMIC
COSM346806 944 COSMIC
COSM7187887 950 COSMIC
COSM5356673 954 COSMIC
COSM6616323 958 COSMIC
COSM9888502 959 COSMIC
COSM3674414 965 COSMIC
COSM4667843 971 COSMIC
COSM1186922 972 COSMIC
COSM5756644 984 COSMIC
COSM9640310 1003 COSMIC
COSM3776579 1013 COSMIC
COSM5727958 1013 COSMIC
COSM737499 1016 COSMIC
COSM9437981 1020 COSMIC
COSM8490932 1034 COSMIC
COSM1436572 1037 COSMIC
COSM4877458 1055 COSMIC
COSM8066078 1070 COSMIC
COSM8066251 1071 COSMIC
COSM6616318 1076 COSMIC
COSM7121053 1081 COSMIC
COSM118794 1090 COSMIC
COSM7974404 1098 COSMIC
COSM3827843 1121 COSMIC
COSM5975542 1121 COSMIC
COSM212399 1124 COSMIC
COSM1132189 1139 COSMIC
COSM8625437 1140 COSMIC
COSM5166531 1142 COSMIC
COSM8322036 1159 COSMIC
COSM7144872 1174 COSMIC
COSM8149060 1177 COSMIC
COSM3784848 1184 COSMIC
COSM4966651 1204 COSMIC
COSM8095547 1205 COSMIC
COSM3674415 1215 COSMIC
COSM9542691 1215 COSMIC
COSM8926761 1230 COSMIC
COSM5169335 1241 COSMIC
COSM7979392 1250 COSMIC
COSM7530237 1252 COSMIC
COSM4005996 1268 COSMIC
COSM7983299 1274 COSMIC
COSM7635911 1302 COSMIC
COSN30504271 1309 COSMIC
COSN30469171 1311 COSMIC
COSN7924646 1319 COSMIC
COSN30455214 1354 COSMIC
COSN30173161 1393 COSMIC
COSN21767558 1481 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1402163457 2 dbSNP
rs757166561 4 dbSNP
rs753485135 8 dbSNP
rs778783549 8 dbSNP
rs750331363 9 dbSNP
rs1363446902 11 dbSNP
rs1434726029 13 dbSNP
rs138527258 14 dbSNP
rs757952273 14 dbSNP
rs765122407 14 dbSNP
rs1302204265 16 dbSNP
rs779531319 18 dbSNP
rs369114803 21 dbSNP
rs1255447669 23 dbSNP
rs752519655 24 dbSNP
rs758468329 25 dbSNP
rs768290894 25 dbSNP
rs1329780260 28 dbSNP
rs778010441 31 dbSNP
rs760432280 33 dbSNP
rs777849713 34 dbSNP
rs775033427 35 dbSNP
rs760096900 36 dbSNP
rs1431057756 37 dbSNP
rs373148815 39 dbSNP
rs376209849 40 dbSNP
rs1458278155 41 dbSNP
rs1193754701 43 dbSNP
rs370200075 44 dbSNP
rs751702490 51 dbSNP
rs753608025 58 dbSNP
rs577638223 60 dbSNP
rs369609665 61 dbSNP
rs750423230 62 dbSNP
rs1282571396 66 dbSNP
rs140407570 67 dbSNP
rs751025643 68 dbSNP
rs945668579 69 dbSNP
rs1230196656 70 dbSNP
rs1041583907 77 dbSNP
rs11548622 83 dbSNP
rs757311547 83 dbSNP
rs155790 84 dbSNP
rs775814512 87 dbSNP
rs1222073912 96 dbSNP
rs747720686 97 dbSNP
rs1472274283 99 dbSNP
rs763290503 102 dbSNP
rs1190253593 103 dbSNP
rs1006467602 104 dbSNP
rs1160928698 105 dbSNP
rs1251986740 107 dbSNP
rs771468767 110 dbSNP
rs1191154986 112 dbSNP
rs1405882640 113 dbSNP
rs781300399 113 dbSNP
rs888099194 113 dbSNP
rs1163779153 117 dbSNP
rs1017794004 131 dbSNP
rs1247997965 133 dbSNP
rs1179026432 137 dbSNP
rs1366704822 141 dbSNP
rs1005652425 145 dbSNP
rs796259575 146 dbSNP
rs1015277726 150 dbSNP
rs1200072391 154 dbSNP
rs964933084 157 dbSNP
rs998103787 161 dbSNP
rs1030474241 167 dbSNP
rs1277610488 168 dbSNP
rs1014179726 169 dbSNP
rs955301962 169 dbSNP
rs987883372 173 dbSNP
rs1491347217 174 dbSNP
rs10688915 175 dbSNP
rs1175766995 175 dbSNP
rs1491433353 175 dbSNP
rs386418446 175 dbSNP
rs186996560 176 dbSNP
rs958008519 178 dbSNP
rs1157269610 179 dbSNP
rs967690981 182 dbSNP
rs1332989748 185 dbSNP
rs71714822 185 dbSNP
rs989864881 186 dbSNP
rs913918805 188 dbSNP
rs778634431 190 dbSNP
rs979372280 191 dbSNP
rs11249660 193 dbSNP
rs922763648 195 dbSNP
rs1313950250 201 dbSNP
rs1282071241 204 dbSNP
rs1320219410 206 dbSNP
rs926546897 211 dbSNP
rs17409649 212 dbSNP
rs1266493714 214 dbSNP
rs17409643 215 dbSNP
rs1449340111 222 dbSNP
rs1377231209 223 dbSNP
rs1049449325 225 dbSNP
rs1449215460 228 dbSNP
rs1196792358 235 dbSNP
rs1361200895 236 dbSNP
rs937920044 237 dbSNP
rs1005313086 238 dbSNP
rs1380426056 240 dbSNP
rs1159911168 243 dbSNP
rs886060504 244 dbSNP
rs1181133022 247 dbSNP
rs543706405 250 dbSNP
rs746273783 253 dbSNP
rs117531194 259 dbSNP
rs886060505 260 dbSNP
rs529602681 261 dbSNP
rs1165424670 262 dbSNP
rs1422784475 264 dbSNP
rs1463646294 265 dbSNP
rs1488563402 271 dbSNP
rs992405330 272 dbSNP
rs11548631 280 dbSNP
rs878898094 281 dbSNP
rs886060506 289 dbSNP
rs559922612 290 dbSNP
rs1446834521 295 dbSNP
rs1296708802 297 dbSNP
rs1300652446 305 dbSNP
rs1361721063 306 dbSNP
rs1377457958 306 dbSNP
rs533446391 309 dbSNP
rs1032865080 313 dbSNP
rs1348734843 317 dbSNP
rs11548630 320 dbSNP
rs1317820472 327 dbSNP
rs1216936674 328 dbSNP
rs989590292 332 dbSNP
rs771841908 334 dbSNP
rs551056409 336 dbSNP
rs1478144602 346 dbSNP
rs1265247543 350 dbSNP
rs1220083525 353 dbSNP
rs1487556884 354 dbSNP
rs913854594 355 dbSNP
rs1264894756 357 dbSNP
rs966767565 358 dbSNP
rs977392422 362 dbSNP
rs1222642843 363 dbSNP
rs1323712333 365 dbSNP
rs1276767775 367 dbSNP
rs1218408985 371 dbSNP
rs1341448166 376 dbSNP
rs1280668727 377 dbSNP
rs1308082069 382 dbSNP
rs1385547235 387 dbSNP
rs188873621 388 dbSNP
rs181341443 389 dbSNP
rs1459174904 393 dbSNP
rs1397666151 394 dbSNP
rs1235897324 396 dbSNP
rs150371553 397 dbSNP
rs1432491260 399 dbSNP
rs910060240 400 dbSNP
rs1191836915 401 dbSNP
rs1182203333 402 dbSNP
rs1256408151 407 dbSNP
rs941068037 410 dbSNP
rs1198187382 413 dbSNP
rs1319063234 419 dbSNP
rs1260352836 425 dbSNP
rs775566403 428 dbSNP
rs1309393144 433 dbSNP
rs1331019853 436 dbSNP
rs1301441464 437 dbSNP
rs1038980612 447 dbSNP
rs1036821882 466 dbSNP
rs1262453085 473 dbSNP
rs900767065 474 dbSNP
rs1476794184 484 dbSNP
rs1388014408 487 dbSNP
rs1373934625 490 dbSNP
rs1195304812 491 dbSNP
rs764211030 495 dbSNP
rs1030951759 496 dbSNP
rs1402238120 502 dbSNP
rs138055371 506 dbSNP
rs185559724 507 dbSNP
rs1378134526 509 dbSNP
rs1178063990 512 dbSNP
rs534941108 513 dbSNP
rs1009345716 516 dbSNP
rs1236380394 517 dbSNP
rs1458360264 522 dbSNP
rs768333264 522 dbSNP
rs1020705777 523 dbSNP
rs967761589 524 dbSNP
rs979111918 525 dbSNP
rs1344671271 528 dbSNP
rs1467945921 535 dbSNP
rs1410426981 536 dbSNP
rs1236002273 537 dbSNP
rs1060271 540 dbSNP
rs1307855580 541 dbSNP
rs14800 542 dbSNP
rs1165934882 544 dbSNP
rs1240481092 545 dbSNP
rs1351922587 549 dbSNP
rs1456644525 550 dbSNP
rs746444162 551 dbSNP
rs1371298349 555 dbSNP
rs767960499 559 dbSNP
rs879696246 560 dbSNP
rs14799 561 dbSNP
rs776124208 562 dbSNP
rs992079644 564 dbSNP
rs1395248846 567 dbSNP
rs1001466762 568 dbSNP
rs1411768616 569 dbSNP
rs1286491810 575 dbSNP
rs1349806112 576 dbSNP
rs1032814197 577 dbSNP
rs1378591438 580 dbSNP
rs1228761746 582 dbSNP
rs772638668 585 dbSNP
rs1158109291 588 dbSNP
rs11548623 592 dbSNP
rs11548620 593 dbSNP
rs892975687 598 dbSNP
rs775444139 601 dbSNP
rs760769659 602 dbSNP
rs577802143 603 dbSNP
rs768589839 604 dbSNP
rs776961227 606 dbSNP
rs538337173 608 dbSNP
rs556686676 609 dbSNP
rs1240239884 610 dbSNP
rs11548626 614 dbSNP
rs1355148846 615 dbSNP
rs772928838 617 dbSNP
rs976696373 618 dbSNP
rs762893891 619 dbSNP
rs746140288 620 dbSNP
rs11548628 622 dbSNP
rs766287584 624 dbSNP
rs11548619 625 dbSNP
rs1273021873 629 dbSNP
rs769882808 633 dbSNP
rs10173 634 dbSNP
rs1359817478 637 dbSNP
rs1298660111 641 dbSNP
rs766911366 643 dbSNP
rs14801 653 dbSNP
rs780452209 657 dbSNP
rs1344979922 659 dbSNP
rs749644765 660 dbSNP
rs769151251 661 dbSNP
rs1387167973 662 dbSNP
rs112765500 663 dbSNP
rs942094889 665 dbSNP
rs1039447748 666 dbSNP
rs985679358 667 dbSNP
rs190193171 668 dbSNP
rs1369454291 669 dbSNP
rs1263760209 672 dbSNP
rs1190494573 674 dbSNP
rs1263110259 674 dbSNP
rs1477168432 674 dbSNP
rs1477429930 676 dbSNP
rs1217923626 680 dbSNP
rs1448249434 683 dbSNP
rs910038373 683 dbSNP
rs1188922162 687 dbSNP
rs1356586392 689 dbSNP
rs1426902219 691 dbSNP
rs542177571 692 dbSNP
rs900465425 693 dbSNP
rs1401719376 694 dbSNP
rs560957240 696 dbSNP
rs1433405228 704 dbSNP
rs149508576 711 dbSNP
rs1391722810 712 dbSNP
rs1167286608 716 dbSNP
rs1464407967 718 dbSNP
rs541743046 719 dbSNP
rs1195074639 722 dbSNP
rs1476657224 722 dbSNP
rs144467418 724 dbSNP
rs1212600382 725 dbSNP
rs1451613140 727 dbSNP
rs886060507 729 dbSNP
rs1052004387 730 dbSNP
rs1418203902 731 dbSNP
rs780421957 736 dbSNP
rs1258429492 737 dbSNP
rs949858771 738 dbSNP
rs1435912036 740 dbSNP
rs1273220516 741 dbSNP
rs1010425075 744 dbSNP
rs1328205017 747 dbSNP
rs1331697346 747 dbSNP
rs752454397 751 dbSNP
rs774786383 754 dbSNP
rs1400079066 756 dbSNP
rs760128130 759 dbSNP
rs770438256 761 dbSNP
rs779423592 761 dbSNP
rs746176027 763 dbSNP
rs903609899 767 dbSNP
rs763592667 768 dbSNP
rs759005945 769 dbSNP
rs780652376 771 dbSNP
rs559679314 774 dbSNP
rs768839085 775 dbSNP
rs748885911 776 dbSNP
rs748378859 777 dbSNP
rs775975516 777 dbSNP
rs1183376167 782 dbSNP
rs769948339 783 dbSNP
rs773016719 784 dbSNP
rs73334055 787 dbSNP
rs370269451 788 dbSNP
rs766053650 791 dbSNP
rs774391024 794 dbSNP
rs759375479 796 dbSNP
rs1206351053 797 dbSNP
rs759284983 797 dbSNP
rs1357388098 799 dbSNP
rs1440417187 800 dbSNP
rs764971145 803 dbSNP
rs776303445 803 dbSNP
rs937204744 803 dbSNP
rs1305682444 807 dbSNP
rs754632178 808 dbSNP
rs892944984 812 dbSNP
rs755839994 813 dbSNP
rs552007127 814 dbSNP
rs563731385 816 dbSNP
rs1296388652 819 dbSNP
rs758847992 820 dbSNP
rs983266233 824 dbSNP
rs780269320 825 dbSNP
rs1275809324 826 dbSNP
rs1310968250 827 dbSNP
rs1357734065 829 dbSNP
rs747619918 830 dbSNP
rs755377558 831 dbSNP
rs781266614 832 dbSNP
rs748178902 833 dbSNP
rs752607373 833 dbSNP
rs770038029 834 dbSNP
rs148611524 838 dbSNP
rs974854235 841 dbSNP
rs749485375 844 dbSNP
rs762770205 844 dbSNP
rs1438765226 847 dbSNP
rs770814240 848 dbSNP
rs142061446 849 dbSNP
rs1192999580 851 dbSNP
rs1178519592 852 dbSNP
rs759522250 854 dbSNP
rs867895372 854 dbSNP
rs764149779 855 dbSNP
rs771844281 856 dbSNP
rs150786805 857 dbSNP
rs763677235 858 dbSNP
rs1317320739 860 dbSNP
rs374714786 863 dbSNP
rs1331329975 867 dbSNP
rs1486598896 868 dbSNP
rs753602551 871 dbSNP
rs761368110 872 dbSNP
rs139424223 874 dbSNP
rs751816628 875 dbSNP
rs1352997641 880 dbSNP
rs1017216048 881 dbSNP
rs755533137 882 dbSNP
rs781637325 883 dbSNP
rs1207261915 886 dbSNP
rs1377485311 889 dbSNP
rs1283946896 892 dbSNP
rs753168881 894 dbSNP
rs963185868 897 dbSNP
rs751473908 903 dbSNP
rs756233444 903 dbSNP
rs777813552 904 dbSNP
rs749587982 905 dbSNP
rs796951435 907 dbSNP
rs1182928329 908 dbSNP
rs531042257 912 dbSNP
rs745599933 913 dbSNP
rs1157793435 914 dbSNP
rs772077418 919 dbSNP
rs1406799489 920 dbSNP
rs775618569 922 dbSNP
rs949750432 926 dbSNP
rs772022233 930 dbSNP
rs760679087 931 dbSNP
rs757109530 937 dbSNP
rs781379450 940 dbSNP
rs1289640472 941 dbSNP
rs1476185520 945 dbSNP
rs768348048 946 dbSNP
rs1237446200 947 dbSNP
rs776215636 952 dbSNP
rs11548638 954 dbSNP
rs750453657 955 dbSNP
rs756422494 956 dbSNP
rs377076809 957 dbSNP
rs375294105 958 dbSNP
rs1253993599 960 dbSNP
rs1261352815 960 dbSNP
rs144080871 961 dbSNP
rs1180992148 963 dbSNP
rs1289693891 965 dbSNP
rs1043257125 970 dbSNP
rs767842607 971 dbSNP
rs540010749 972 dbSNP
rs756605512 974 dbSNP
rs777834009 975 dbSNP
rs1429922141 980 dbSNP
rs1309332857 981 dbSNP
rs1368150911 982 dbSNP
rs370481237 987 dbSNP
rs199727564 988 dbSNP
rs1341541727 992 dbSNP
rs778961691 994 dbSNP
rs746082405 995 dbSNP
rs772051734 997 dbSNP
rs570055949 998 dbSNP
rs746949003 1003 dbSNP
rs1041517658 1006 dbSNP
rs1290097631 1007 dbSNP
rs780179500 1007 dbSNP
rs998221866 1012 dbSNP
rs1165114847 1016 dbSNP
rs1189204957 1018 dbSNP
rs1256810653 1020 dbSNP
rs146092066 1023 dbSNP
rs1185153093 1026 dbSNP
rs1192905848 1027 dbSNP
rs749671180 1029 dbSNP
rs776230758 1030 dbSNP
rs1170091584 1040 dbSNP
rs116069534 1041 dbSNP
rs769319285 1042 dbSNP
rs772785564 1045 dbSNP
rs762650433 1046 dbSNP
rs767934309 1053 dbSNP
rs371482381 1054 dbSNP
rs1382487941 1057 dbSNP
rs1436138223 1062 dbSNP
rs761182927 1067 dbSNP
rs764533820 1070 dbSNP
rs755291116 1071 dbSNP
rs1318586958 1073 dbSNP
rs779431270 1073 dbSNP
rs61746305 1074 dbSNP
rs1201679148 1077 dbSNP
rs757320769 1078 dbSNP
rs765347184 1079 dbSNP
rs750678816 1080 dbSNP
rs1245849296 1081 dbSNP
rs1427487388 1085 dbSNP
rs758628629 1087 dbSNP
rs746754910 1088 dbSNP
rs200300835 1090 dbSNP
rs754999782 1091 dbSNP
rs1174860661 1096 dbSNP
rs781035932 1099 dbSNP
rs61742526 1102 dbSNP
rs1322926992 1105 dbSNP
rs867515164 1106 dbSNP
rs748732103 1107 dbSNP
rs763199567 1108 dbSNP
rs199887787 1112 dbSNP
rs748941071 1117 dbSNP
rs1374726030 1118 dbSNP
rs1221656981 1121 dbSNP
rs770512697 1124 dbSNP
rs775853768 1126 dbSNP
rs368323623 1132 dbSNP
rs1323761668 1136 dbSNP
rs1258676286 1138 dbSNP
rs10277 1139 dbSNP
rs774468810 1141 dbSNP
rs143664576 1142 dbSNP
rs372880666 1144 dbSNP
rs1465813951 1149 dbSNP
rs1198001257 1151 dbSNP
rs541354577 1153 dbSNP
rs1473168719 1159 dbSNP
rs766672073 1160 dbSNP
rs1343794181 1162 dbSNP
rs1453405099 1172 dbSNP
rs1294310557 1173 dbSNP
rs1363690337 1175 dbSNP
rs751804819 1176 dbSNP
rs754872474 1177 dbSNP
rs781024263 1178 dbSNP
rs748097828 1182 dbSNP
rs1230135831 1184 dbSNP
rs1231650002 1185 dbSNP
rs926131737 1189 dbSNP
rs756011095 1191 dbSNP
rs777158440 1192 dbSNP
rs1245127397 1195 dbSNP
rs937509590 1196 dbSNP
rs1489694869 1197 dbSNP
rs748746630 1198 dbSNP
rs553584436 1200 dbSNP
rs1483703474 1203 dbSNP
rs1179461916 1204 dbSNP
rs778576827 1206 dbSNP
rs772438323 1207 dbSNP
rs1165868817 1211 dbSNP
rs914228872 1213 dbSNP
rs767667234 1215 dbSNP
rs768969990 1216 dbSNP
rs1371238321 1217 dbSNP
rs1411625082 1220 dbSNP
rs1296355437 1229 dbSNP
rs762242695 1230 dbSNP
rs770287311 1231 dbSNP
rs765194020 1235 dbSNP
rs776265041 1236 dbSNP
rs886060508 1236 dbSNP
rs1394606854 1238 dbSNP
rs773459500 1241 dbSNP
rs763168668 1251 dbSNP
rs766549467 1254 dbSNP
rs1042065603 1258 dbSNP
rs751892071 1261 dbSNP
rs759825154 1262 dbSNP
rs1207306086 1265 dbSNP
rs767217752 1267 dbSNP
rs752475897 1268 dbSNP
rs756026168 1269 dbSNP
rs777724565 1273 dbSNP
rs1443080077 1274 dbSNP
rs376933990 1276 dbSNP
rs1163136621 1280 dbSNP
rs371031967 1281 dbSNP
rs753743592 1282 dbSNP
rs1411749724 1288 dbSNP
rs1168362082 1292 dbSNP
rs949116045 1293 dbSNP
rs201824663 1294 dbSNP
rs1304435976 1297 dbSNP
rs745365806 1298 dbSNP
rs745524145 1298 dbSNP
rs886060509 1298 dbSNP
rs1380306253 1302 dbSNP
rs1451517595 1305 dbSNP
rs1297851652 1306 dbSNP
rs771699503 1307 dbSNP
rs1212324197 1311 dbSNP
rs781433632 1312 dbSNP
rs748507473 1313 dbSNP
rs376162024 1314 dbSNP
rs773908994 1315 dbSNP
rs763544769 1316 dbSNP
rs1239262235 1318 dbSNP
rs1065154 1323 dbSNP
rs1248912067 1325 dbSNP
rs774501769 1329 dbSNP
rs1395443339 1332 dbSNP
rs759688377 1335 dbSNP
rs199862884 1337 dbSNP
rs1433772996 1338 dbSNP
rs1178467486 1341 dbSNP
rs1403704904 1342 dbSNP
rs1469122826 1343 dbSNP
rs531005543 1350 dbSNP
rs1314579210 1351 dbSNP
rs1436678583 1354 dbSNP
rs1358652562 1355 dbSNP
rs1158244313 1363 dbSNP
rs758268512 1365 dbSNP
rs1168745642 1367 dbSNP
rs1365969076 1370 dbSNP
rs1391166857 1375 dbSNP
rs1185856285 1376 dbSNP
rs1475046477 1377 dbSNP
rs1190634600 1389 dbSNP
rs954826627 1392 dbSNP
rs182968597 1395 dbSNP
rs1003016539 1405 dbSNP
rs1352378879 1406 dbSNP
rs1263527639 1407 dbSNP
rs1243806875 1415 dbSNP
rs561116387 1418 dbSNP
rs1356087686 1427 dbSNP
rs1399331692 1429 dbSNP
rs1276165238 1437 dbSNP
rs866404591 1439 dbSNP
rs1227472862 1442 dbSNP
rs1338579504 1444 dbSNP
rs1317705590 1445 dbSNP
rs1383051663 1447 dbSNP
rs1387415599 1454 dbSNP
rs1161622291 1457 dbSNP
rs1461269210 1472 dbSNP
rs1034528953 1475 dbSNP
rs886060510 1481 dbSNP
rs958408949 1482 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8878.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cggagucuccGUCGACGAa 5'
                    |||||||| 
Target 5' uccaaaccauCAGCUGCUu 3'
 		11 - 29
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000389805.4 | 3UTR | UUCUCUCAUUUCCAAACCAUCAGCUGCUUuuaaaauaag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000389805.4 | 3UTR | UUCUCUCAUUUCCAAACCAUCAGCUGCUUuuaaaauaag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000389805.4 | 3UTR | UUCUCUCAUUUCCAAACCAUCAGCUGCUUuuaaaaua
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.74 1.9e-3 -0.571 2.1e-2 13 Click to see details
GSE28544 Breast cancer 0.478 9.1e-3 0.406 2.5e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.28 6.0e-2 -0.281 6.0e-2 32 Click to see details
GSE27834 Pluripotent stem cells -0.404 6.0e-2 -0.424 5.1e-2 16 Click to see details
GSE14794 Lymphoblastoid cells 0.153 7.5e-2 0.169 5.6e-2 90 Click to see details
GSE38226 Liver fibrosis -0.223 1.7e-1 -0.160 2.4e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.106 2.0e-1 -0.076 2.8e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.144 2.6e-1 0.269 1.1e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.101 3.2e-1 0.005 4.9e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.11 3.2e-1 0.105 3.3e-1 20 Click to see details
GSE17498 Multiple myeloma 0.044 3.9e-1 -0.026 4.4e-1 40 Click to see details
GSE21849 B cell lymphoma -0.034 4.3e-1 -0.055 3.9e-1 29 Click to see details
GSE17306 Multiple myeloma 0.013 4.6e-1 0.458 4.7e-4 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.014 4.7e-1 0.170 2.1e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.014 4.7e-1 0.170 2.1e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
243 hsa-miR-646 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061535 BTG2 BTG anti-proliferation factor 2 2 4
MIRT064692 CCND2 cyclin D2 2 4
MIRT068834 FNDC3A fibronectin type III domain containing 3A 2 10
MIRT079080 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT092735 SETD5 SET domain containing 5 2 4
MIRT093692 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096244 CANX calnexin 2 2
MIRT096296 SQSTM1 sequestosome 1 2 4
MIRT098839 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 2 2
MIRT100229 PRR3 proline rich 3 2 4
MIRT156479 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT186378 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT196460 TAOK1 TAO kinase 1 2 2
MIRT211252 FGF2 fibroblast growth factor 2 2 2
MIRT215233 NPM1 nucleophosmin 1 2 4
MIRT215383 CREBRF CREB3 regulatory factor 2 2
MIRT224972 BAG4 BCL2 associated athanogene 4 2 4
MIRT235598 KIF3B kinesin family member 3B 2 2
MIRT249860 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT258407 FOXK1 forkhead box K1 2 2
MIRT269359 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT310455 REST RE1 silencing transcription factor 2 2
MIRT314057 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT322288 SLC39A14 solute carrier family 39 member 14 2 2
MIRT326311 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT329703 SCD stearoyl-CoA desaturase 2 2
MIRT341278 PABPN1 poly(A) binding protein nuclear 1 2 3
MIRT403798 AKIRIN1 akirin 1 2 2
MIRT438549 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT441908 SEPN1 selenoprotein N 2 2
MIRT444125 ZNRF3 zinc and ring finger 3 2 2
MIRT445458 EXT1 exostosin glycosyltransferase 1 2 4
MIRT446500 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT446538 GOLGA8B golgin A8 family member B 2 2
MIRT447770 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448438 TLL1 tolloid like 1 2 2
MIRT448768 GOLGA8A golgin A8 family member A 2 2
MIRT460749 SRP14 signal recognition particle 14 2 2
MIRT461556 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463163 ZNF367 zinc finger protein 367 2 10
MIRT464234 VEGFA vascular endothelial growth factor A 5 12
MIRT464496 UCK2 uridine-cytidine kinase 2 2 2
MIRT465157 TSC22D2 TSC22 domain family member 2 2 2
MIRT466429 TFAP2A transcription factor AP-2 alpha 2 8
MIRT467395 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT468672 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469407 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470750 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT471947 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472468 NAPG NSF attachment protein gamma 2 12
MIRT474571 KLHDC3 kelch domain containing 3 2 2
MIRT477443 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT480541 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT482110 AKT3 AKT serine/threonine kinase 3 2 4
MIRT485206 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT492318 SETD1B SET domain containing 1B 2 4
MIRT497144 TAPBP TAP binding protein 2 2
MIRT498976 ORC4 origin recognition complex subunit 4 2 8
MIRT499112 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT499448 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500089 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500317 ZNF622 zinc finger protein 622 2 8
MIRT500414 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500572 USP53 ubiquitin specific peptidase 53 2 2
MIRT500596 UBN2 ubinuclein 2 2 10
MIRT500797 TLK1 tousled like kinase 1 2 8
MIRT500932 SRPR SRP receptor alpha subunit 2 6
MIRT500946 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501081 SMAD7 SMAD family member 7 2 8
MIRT501515 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT501879 MOB4 MOB family member 4, phocein 2 8
MIRT502195 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT502630 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502650 DCTN5 dynactin subunit 5 2 8
MIRT502914 CDCA4 cell division cycle associated 4 2 8
MIRT502938 CDC37L1 cell division cycle 37 like 1 2 8
MIRT502987 CCND1 cyclin D1 6 3
MIRT503181 AGO2 argonaute 2, RISC catalytic component 2 6
MIRT504532 ZNF620 zinc finger protein 620 2 6
MIRT504715 DLC1 DLC1 Rho GTPase activating protein 2 6
MIRT504967 ZNRF2 zinc and ring finger 2 2 2
MIRT505073 ZFHX4 zinc finger homeobox 4 2 6
MIRT505109 YTHDC1 YTH domain containing 1 2 6
MIRT505342 TMEM245 transmembrane protein 245 2 6
MIRT505389 TMEM100 transmembrane protein 100 2 2
MIRT505681 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506162 PLAG1 PLAG1 zinc finger 2 8
MIRT506185 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506354 NUP50 nucleoporin 50 2 6
MIRT506480 MYO5A myosin VA 2 6
MIRT506833 KIF23 kinesin family member 23 2 6
MIRT507310 FEM1B fem-1 homolog B 2 4
MIRT507847 CCNE2 cyclin E2 2 6
MIRT508670 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT509137 ZNF691 zinc finger protein 691 2 4
MIRT509686 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT512205 C1orf21 chromosome 1 open reading frame 21 2 6
MIRT518087 TRIM35 tripartite motif containing 35 2 2
MIRT518990 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT520964 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT521049 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521192 SBNO1 strawberry notch homolog 1 2 6
MIRT521619 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT522770 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT533754 TMEM184B transmembrane protein 184B 2 2
MIRT534131 SNTB2 syntrophin beta 2 2 4
MIRT537159 GID8 GID complex subunit 8 homolog 2 2
MIRT537812 EFNB2 ephrin B2 2 4
MIRT538108 DDX6 DEAD-box helicase 6 2 2
MIRT540839 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541019 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT541145 PISD phosphatidylserine decarboxylase 2 2
MIRT541387 CDC42SE2 CDC42 small effector 2 2 2
MIRT541422 CBX4 chromobox 4 2 2
MIRT543521 PRSS21 protease, serine 21 2 2
MIRT543794 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543831 GSG1 germ cell associated 1 2 2
MIRT544961 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545182 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545343 CCDC83 coiled-coil domain containing 83 2 2
MIRT545367 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT545656 SPARC secreted protein acidic and cysteine rich 2 2
MIRT545678 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545938 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546107 USP48 ubiquitin specific peptidase 48 2 4
MIRT546603 SALL1 spalt like transcription factor 1 2 4
MIRT546628 RTN4 reticulon 4 2 2
MIRT547321 NPTN neuroplastin 2 2
MIRT547660 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547994 HCFC2 host cell factor C2 2 4
MIRT548048 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548098 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 4
MIRT548721 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548938 CDK17 cyclin dependent kinase 17 2 2
MIRT549071 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549272 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549438 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT550462 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550794 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT550819 FAM229B family with sequence similarity 229 member B 2 2
MIRT551537 EMB embigin 2 2
MIRT552031 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552340 ZNF704 zinc finger protein 704 2 2
MIRT552444 ZNF449 zinc finger protein 449 2 2
MIRT553116 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT553448 TOX4 TOX high mobility group box family member 4 2 2
MIRT553725 TBX18 T-box 18 2 2
MIRT553805 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554696 RNF149 ring finger protein 149 2 2
MIRT554831 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT555139 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555269 PRDM4 PR/SET domain 4 2 2
MIRT555312 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT555558 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT556379 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556669 KMT2D lysine methyltransferase 2D 2 4
MIRT556853 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557476 GPR27 G protein-coupled receptor 27 2 4
MIRT558361 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT558385 DHX33 DEAH-box helicase 33 2 2
MIRT558502 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558515 CTDSPL CTD small phosphatase like 2 4
MIRT558583 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558641 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT558653 CNKSR3 CNKSR family member 3 2 2
MIRT558865 CD2AP CD2 associated protein 2 2
MIRT558888 CCNE1 cyclin E1 2 4
MIRT559002 CA8 carbonic anhydrase 8 2 2
MIRT559149 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559999 RAB3IP RAB3A interacting protein 2 2
MIRT562023 LANCL1 LanC like 1 2 2
MIRT562474 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT562586 CBX2 chromobox 2 2 2
MIRT562595 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT562873 KIAA1456 KIAA1456 2 2
MIRT562989 KIAA0408 KIAA0408 2 4
MIRT563082 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563499 DLGAP3 DLG associated protein 3 2 2
MIRT563892 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564328 CCNT1 cyclin T1 2 2
MIRT564945 XKR7 XK related 7 2 2
MIRT564981 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT566302 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT566701 MTMR3 myotubularin related protein 3 2 2
MIRT566827 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571236 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT571424 RIF1 replication timing regulatory factor 1 2 2
MIRT571637 SKI SKI proto-oncogene 2 2
MIRT571836 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT571962 KIF5B kinesin family member 5B 2 2
MIRT572104 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT572183 CDK6 cyclin dependent kinase 6 2 2
MIRT572720 RBL1 RB transcriptional corepressor like 1 2 2
MIRT574589 N4BP1 NEDD4 binding protein 1 2 2
MIRT575878 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT609979 HERPUD2 HERPUD family member 2 2 2
MIRT612932 GPRIN3 GPRIN family member 3 2 2
MIRT614327 C1orf220 chromosome 1 open reading frame 220 2 2
MIRT614694 TRAK1 trafficking kinesin protein 1 2 2
MIRT618328 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT618456 ZFP30 ZFP30 zinc finger protein 2 4
MIRT621135 EMC7 ER membrane protein complex subunit 7 2 4
MIRT622878 PDE12 phosphodiesterase 12 2 4
MIRT631163 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT632793 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT636731 AFAP1 actin filament associated protein 1 2 2
MIRT649297 IRF8 interferon regulatory factor 8 2 2
MIRT650955 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT653267 SOGA3 SOGA family member 3 2 2
MIRT654665 PSMG1 proteasome assembly chaperone 1 2 2
MIRT656180 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT659252 CUL3 cullin 3 2 2
MIRT663826 NLRP12 NLR family pyrin domain containing 12 2 4
MIRT676632 CSNK1E casein kinase 1 epsilon 2 2
MIRT679503 ZNF106 zinc finger protein 106 2 2
MIRT680978 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682272 RS1 retinoschisin 1 2 2
MIRT682421 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT682510 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693926 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT700660 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT700740 PLEKHA8 pleckstrin homology domain containing A8 2 2
MIRT702871 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT703192 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT704453 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT704709 CHEK1 checkpoint kinase 1 2 2
MIRT706164 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT713334 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT713416 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT716300 PAX1 paired box 1 2 2
MIRT717394 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT718453 BTNL9 butyrophilin like 9 2 2
MIRT718728 VWA9 integrator complex subunit 14 2 2
MIRT719029 SHROOM3 shroom family member 3 2 2
MIRT720367 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT723120 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT733741 EGFR epidermal growth factor receptor 4 0
MIRT734281 HIF1A hypoxia inducible factor 1 alpha subunit 3 0
MIRT735934 EYA3 EYA transcriptional coactivator and phosphatase 3 3 0
MIRT755830 IGF1 insulin like growth factor 1 5 1
MIRT755831 BCL2 BCL2, apoptosis regulator 4 1
MIRT755832 CDK2 cyclin dependent kinase 2 4 1
MIRT755833 BAX BCL2 associated X, apoptosis regulator 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-646 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-miR-646 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-646 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-646 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-646 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-646 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-646 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-646 Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission