miRTarBase - #MIRT096501


—
pre-miRNA Information
pre-miRNA hsa-mir-548w   
Genomic Coordinates chr16: 26025237 - 26025310
Description Homo sapiens miR-548w stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548w
Sequence 10| AAAAGUAACUGCGGUUUUUGCCU |32
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 16 + 26025249 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs918935898 1 dbSNP
rs573018690 4 dbSNP
rs1355338018 5 dbSNP
rs1232952112 7 dbSNP
rs768527810 12 dbSNP
rs1331351492 13 dbSNP
rs925963272 14 dbSNP
rs1299975801 16 dbSNP
rs1247960808 17 dbSNP
rs1217191628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BRIX1   
Synonyms BRIX, BXDC2
Description BRX1, biogenesis of ribosomes
Transcript NM_018321   
Expression
Putative miRNA Targets on BRIX1
3'UTR of BRIX1
(miRNA target sites are highlighted)		 
>BRIX1|NM_018321|3'UTR
   1 GTCAATGGAAACCTGATTTGTTTTTCAGTTACTTTATATTTATTTTGTATTCAATGTGTAAATACTTTTATTATCTAATA
  81 CTATCTTACGTCTAATTAGTGTAGCATTTACAAGAAAGAAAAATTAAGATCTTAAAATCAGTGATTATCTTTTTCTAAAT
 161 AAAATATCACCAGAATTCATCAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uccguuuuuggcGUCAAUGAAAa 5'
                      |||||||||| 
Target 5' tgatttgtttttCAGTTACTTTa 3'
 14 - 36 155.00 -10.80
2 
miRNA  3' uccGUUUUUGGCGUCAAU-GAAAa 5'
             :|||| | |:: ||| |||| 
Target 5' tctTAAAATCAGTGATTATCTTTt 3'
 130 - 153 132.00 -6.50
3 
miRNA  3' uccguuUUUGGCGUCAAUGAAAa 5'
                ||  :|:|  |||||| 
Target 5' gtattcAATGTGTAAATACTTTt 3'
 47 - 69 121.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26968085 18 COSMIC
COSN30155636 53 COSMIC
COSN9433774 420 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374881575 6 dbSNP
rs755492270 7 dbSNP
rs781718839 14 dbSNP
rs1351127237 17 dbSNP
rs1428020866 19 dbSNP
rs753039316 20 dbSNP
rs763647074 21 dbSNP
rs1331822768 27 dbSNP
rs776316078 33 dbSNP
rs999278355 36 dbSNP
rs760556018 37 dbSNP
rs1448192854 38 dbSNP
rs1274263218 39 dbSNP
rs778062020 47 dbSNP
rs749542734 50 dbSNP
rs1311655915 54 dbSNP
rs572215432 58 dbSNP
rs1240670119 61 dbSNP
rs1184287333 75 dbSNP
rs1266633231 75 dbSNP
rs1328862870 80 dbSNP
rs1272346661 88 dbSNP
rs763753384 90 dbSNP
rs1017769705 91 dbSNP
rs1339963423 93 dbSNP
rs1265516079 111 dbSNP
rs1378217356 115 dbSNP
rs184068732 125 dbSNP
rs900011254 133 dbSNP
rs375971413 138 dbSNP
rs976334995 140 dbSNP
rs1029936181 141 dbSNP
rs950390662 144 dbSNP
rs760205107 146 dbSNP
rs1251582525 150 dbSNP
rs1306870131 152 dbSNP
rs768288357 160 dbSNP
rs27966 162 dbSNP
rs1421117376 170 dbSNP
rs1367942627 173 dbSNP
rs1164795984 177 dbSNP
rs1456605190 180 dbSNP
rs996990357 184 dbSNP
rs1179366954 197 dbSNP
rs1470626136 205 dbSNP
rs983536568 212 dbSNP
rs1251444983 224 dbSNP
rs908927887 230 dbSNP
rs1490863522 237 dbSNP
rs1270915675 240 dbSNP
rs1223100709 250 dbSNP
rs1180243435 251 dbSNP
rs891381140 256 dbSNP
rs941777778 258 dbSNP
rs990644292 262 dbSNP
rs753546788 267 dbSNP
rs1287339304 285 dbSNP
rs1177117954 292 dbSNP
rs1360826235 293 dbSNP
rs1407400872 297 dbSNP
rs560235847 302 dbSNP
rs1004248656 305 dbSNP
rs1464156865 317 dbSNP
rs141986142 318 dbSNP
rs555090949 334 dbSNP
rs1015587933 336 dbSNP
rs1436361506 340 dbSNP
rs949264149 343 dbSNP
rs542652030 344 dbSNP
rs563035383 351 dbSNP
rs1401653740 354 dbSNP
rs1411432063 359 dbSNP
rs1396509626 374 dbSNP
rs1157242348 375 dbSNP
rs1392802928 376 dbSNP
rs1286018826 378 dbSNP
rs188626415 382 dbSNP
rs1190746150 384 dbSNP
rs1488115981 385 dbSNP
rs1212745037 388 dbSNP
rs1217610167 392 dbSNP
rs1465201167 415 dbSNP
rs574825078 416 dbSNP
rs1226154957 418 dbSNP
rs1283350676 424 dbSNP
rs1325305787 424 dbSNP
rs1218197335 425 dbSNP
rs1366021994 429 dbSNP
rs531559487 445 dbSNP
rs1350305101 449 dbSNP
rs1291153067 450 dbSNP
rs1224471671 455 dbSNP
rs923866702 468 dbSNP
rs150400177 469 dbSNP
rs1209954185 476 dbSNP
rs764731312 484 dbSNP
rs1251967763 489 dbSNP
rs1175369061 499 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55299.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uccguuuuuggcGUCAAUGAAAa 5'
                      |||||||||| 
Target 5' -------uuuuuCAGUUACUUUa 3'
 		1 - 16
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000336767.5 | 3UTR | UUUUUCAGUUACUUUAUAUUUAUUUUGUAUUCAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548w Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057125 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063369 ETNK1 ethanolamine kinase 1 2 2
MIRT072492 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082186 ACTN4 actinin alpha 4 2 6
MIRT083033 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085188 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088905 FOXN2 forkhead box N2 2 4
MIRT089494 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092039 ABHD5 abhydrolase domain containing 5 2 2
MIRT094685 FEM1C fem-1 homolog C 2 2
MIRT095393 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096501 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101296 FAM135A family with sequence similarity 135 member A 2 2
MIRT103356 CBX3 chromobox 3 2 2
MIRT103872 FOXK1 forkhead box K1 2 2
MIRT104334 CLDN12 claudin 12 2 2
MIRT104501 PEG10 paternally expressed 10 2 6
MIRT111795 MPZL1 myelin protein zero like 1 2 2
MIRT177238 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177273 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177626 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178042 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179102 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179587 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195299 LEPROT leptin receptor overlapping transcript 2 2
MIRT203143 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208430 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214578 SMAD5 SMAD family member 5 2 4
MIRT216103 IL6ST interleukin 6 signal transducer 2 2
MIRT216355 CCNB1 cyclin B1 2 4
MIRT220050 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226729 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227698 TBC1D13 TBC1 domain family member 13 2 2
MIRT230071 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248637 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254790 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264376 YAP1 Yes associated protein 1 2 2
MIRT266972 LRRC55 leucine rich repeat containing 55 2 4
MIRT273949 SPRYD4 SPRY domain containing 4 2 2
MIRT281802 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293252 DR1 down-regulator of transcription 1 2 2
MIRT297097 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308170 PDE12 phosphodiesterase 12 2 2
MIRT309013 USP53 ubiquitin specific peptidase 53 2 2
MIRT311470 PRRC1 proline rich coiled-coil 1 2 2
MIRT312586 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328130 ZNF711 zinc finger protein 711 2 2
MIRT329313 FAM53C family with sequence similarity 53 member C 2 2
MIRT334642 NEK7 NIMA related kinase 7 2 2
MIRT340673 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378858 ITGB8 integrin subunit beta 8 2 2
MIRT395789 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405639 WBP4 WW domain binding protein 4 2 4
MIRT408287 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442097 ZNRF2 zinc and ring finger 2 2 8
MIRT442840 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443116 VLDLR very low density lipoprotein receptor 2 2
MIRT443147 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443298 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445080 ZNF207 zinc finger protein 207 2 2
MIRT445384 PTCHD1 patched domain containing 1 2 4
MIRT447070 MCC mutated in colorectal cancers 2 2
MIRT447300 ZNF562 zinc finger protein 562 2 2
MIRT447512 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449511 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449902 C11orf34 placenta expressed transcript 1 1 2
MIRT450551 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450719 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454923 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455892 KIF2C kinesin family member 2C 2 2
MIRT463732 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471182 PHB2 prohibitin 2 2 2
MIRT472764 MTMR6 myotubularin related protein 6 2 8
MIRT474457 KLHL11 kelch like family member 11 2 8
MIRT475985 GTPBP2 GTP binding protein 2 2 2
MIRT482277 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485858 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486192 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488609 FAM3C family with sequence similarity 3 member C 2 6
MIRT489984 DDB1 damage specific DNA binding protein 1 2 2
MIRT493476 IPMK inositol polyphosphate multikinase 2 2
MIRT494280 CEP120 centrosomal protein 120 2 2
MIRT497992 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498473 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498559 TMEM30B transmembrane protein 30B 2 2
MIRT499867 SVOP SV2 related protein 2 10
MIRT500220 INHBA inhibin beta A subunit 2 10
MIRT500694 TRIM37 tripartite motif containing 37 2 2
MIRT500988 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501023 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502736 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502798 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502887 CDK4 cyclin dependent kinase 4 2 8
MIRT503483 ZNF154 zinc finger protein 154 2 6
MIRT503717 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505137 YOD1 YOD1 deubiquitinase 2 2
MIRT505802 RSBN1 round spermatid basic protein 1 2 8
MIRT505841 POLR1B RNA polymerase I subunit B 2 4
MIRT509284 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516829 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520519 TRA2B transformer 2 beta homolog 2 2
MIRT520723 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525403 SHISA9 shisa family member 9 2 4
MIRT525867 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526013 RBM4B RNA binding motif protein 4B 2 2
MIRT526084 TMEM41B transmembrane protein 41B 2 2
MIRT527931 FRY FRY microtubule binding protein 2 2
MIRT528818 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531062 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535495 PANX1 pannexin 1 2 2
MIRT536682 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536835 HMBOX1 homeobox containing 1 2 2
MIRT537202 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537834 EFNA5 ephrin A5 2 2
MIRT538345 CSE1L chromosome segregation 1 like 2 4
MIRT541242 GPC4 glypican 4 2 2
MIRT543235 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543450 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543711 XKR9 XK related 9 2 2
MIRT543907 ESYT1 extended synaptotagmin 1 2 2
MIRT543999 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544070 METTL8 methyltransferase like 8 2 2
MIRT544187 ANGPTL3 angiopoietin like 3 2 2
MIRT544808 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545046 PRELID1 PRELI domain containing 1 2 2
MIRT545214 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545289 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545550 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546497 SIK1 salt inducible kinase 1 2 2
MIRT546914 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547675 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547770 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548687 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548901 CHEK2 checkpoint kinase 2 2 4
MIRT549957 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550489 TMEM241 transmembrane protein 241 2 2
MIRT551049 MKLN1 muskelin 1 2 2
MIRT552811 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553145 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553830 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554258 SIX4 SIX homeobox 4 2 2
MIRT555781 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556318 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556499 LIPA lipase A, lysosomal acid type 2 2
MIRT556693 KLHL28 kelch like family member 28 2 2
MIRT556752 KLF7 Kruppel like factor 7 2 2
MIRT556990 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557146 HOXA13 homeobox A13 2 2
MIRT557487 GPR27 G protein-coupled receptor 27 2 4
MIRT558102 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559344 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560335 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561299 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561883 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561927 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562935 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563291 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563405 KIF3A kinesin family member 3A 2 2
MIRT563562 KIAA1586 KIAA1586 2 2
MIRT565876 NHS NHS actin remodeling regulator 2 2
MIRT566081 RCC2 regulator of chromosome condensation 2 2 2
MIRT566396 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567259 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571468 CCDC80 coiled-coil domain containing 80 2 2
MIRT572939 VDAC2 voltage dependent anion channel 2 2 2
MIRT573628 ZNF724P zinc finger protein 724 2 2
MIRT573717 KHSRP KH-type splicing regulatory protein 2 2
MIRT609088 SMIM15 small integral membrane protein 15 2 6
MIRT617936 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618379 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619627 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623455 KDM5A lysine demethylase 5A 2 2
MIRT629145 CTCFL CCCTC-binding factor like 2 2
MIRT638521 LYRM2 LYR motif containing 2 2 2
MIRT649483 CLDN16 claudin 16 2 2
MIRT683148 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691660 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693201 MKI67 marker of proliferation Ki-67 2 2
MIRT695334 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701023 PCGF5 polycomb group ring finger 5 2 2
MIRT708753 RYBP RING1 and YY1 binding protein 2 2
MIRT717558 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719286 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725172 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548w Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548w Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission