miRTarBase - #MIRT096759


—
pre-miRNA Information
pre-miRNA hsa-mir-539   
Genomic Coordinates chr14: 101047321 - 101047398
Synonyms MIRN539, hsa-mir-539, MIR539
Description Homo sapiens miR-539 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-539-5p
Sequence 9| GGAGAAAUUAUCCUUGGUGUGU |30
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 10 14 + 101047338 22499667, 26449202, 27229138, 28550310, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs920592001 1 dbSNP
rs949143380 2 dbSNP
rs1037241141 4 dbSNP
rs1261686093 10 dbSNP
rs747290147 19 dbSNP
rs1397145918 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPBP1   
Synonyms GPBP, SSH6, VASCULIN
Description GC-rich promoter binding protein 1
Transcript NM_001127235   
Other Transcripts NM_001127236 , NM_022913   
Expression
Putative miRNA Targets on GPBP1
3'UTR of GPBP1
(miRNA target sites are highlighted)		 
>GPBP1|NM_001127235|3'UTR
   1 AGGATTTCCTAACAGCTTTAGAAATCTTAGTGTGATACATCTCTCATACAGTTTGGGGTGAATTGTAAAAATGAAGAACT
  81 ATAATTTATGTAGTGAAATACCCCATTAGAAGAGGATTTTTTGGGGGACTTCAATATGAAGAAAACCAAGAATGTTTTGT
 161 TGGGCTGTGTTGAACATTATTTCTTTGTAAATGAATGTTGTAGGAATGAGGACTTGGGTTGGTCCAACATTGACTTTCTT
 241 CATCACTGCAACATTTCTCTGACTAGCAATGTGACGATGTAACAAATGAGATTTTCTCATTTAATAATAAAAAATTGTGT
 321 AATGTTTTGCAAAGCTTCTGTCTTAAAATGTCCAGGTCTTAAGAAAAAAGGCAGCTTACACTGTTTTGCTTGCAGAGTCA
 401 TATCTTTTTCGTACAATGGAAATCCTCAAGTCCACTTTGTGCGGTCTCCCTCTCCTTCCCCCAAAAAACAACAACAACAA
 481 AACAAAAACCAAAAAGGAAAATGTAGCATGTTGGCTAAAACTGGAGCAAAGTGCACTAAAACAATTTCCTGAACTCACCT
 561 GTTGTACTATTCACCTTTTAAACCATAAATTGCTCTTTAGCCATTTGTAGTGCAGTAAATGTTACAGGAAAAGACTTGGC
 641 ACATTTTCTTCCAAATTTTAAGAGGTGATTTTCAAAAGCTTTATTGGGGTATGTTGTCAGACCAGGGTTTTCAGAGTTGA
 721 TGGAAAAGAGTCTTGTGAGAAAACTTATTTTGATAAATTATTACACACGCAGAAAAACTGATCACACTGACTGGATCTGT
 801 CCACGACATGGAAAATAAACTGGATTTTCAGAATATTGTTGTTTTCTGTAGTGTTCAAGGTATTGTTTCTAAACATAAAC
 881 ATACTCTAAACATGCTTTATTCACTTGTTAAAGTCATACTTTTAAAAGTAATACCTTACTAAAGATGGTGATTACTTTTC
 961 CGAGGTCAGAAAAGGAAAGCTAAGCGTTTTCATTATCAAATACACAAGCTTATTAAATGAATGACTGTTAACTACTTTAT
1041 TTTCATTTGCACATTAATTTTGGAATTGTTTCTGTTTTGCTGCTGACGGAAATACTATTTTGGCTCTGTGTATATTTGTA
1121 TTTTGATTTTTCTGGTTTGTTTACCCCCATTTGCTTTTAGCTCCCCCTTATGTTTAAATATATTCTAACTTATGTAAAGA
1201 GCATAATCTTAGAGCAAAAATACTTGAGGTTTTATGTCAGATCTAATCTTAAGTGTTTGTTGTTTTTTAAAAAGTGTTTT
1281 CTCAGATGGCTGCAGTGTTTTTGCTATTTCTGCATAAATACCCTACCTGGACTCCCCAGTTTTCACCAGAAACTGTTATT
1361 TTTTTTTGTTGTTGTTCCCACTGAGACTGATGGTGATGGGGAAATTAAAAACAACACACTAGCACACTCCCACAAAACTT
1441 GAGGAAGAGTTAGAATGGTAATAAAATATTAAATAGACCTTATACTTAAAATAAGGTTTCACTATATAATTTGTCACAAT
1521 TCAATCTAATCAGCTAAAGTTAAATGTAGTTAGAATTAGCCACAGGAGAATGTAAAGCATGCTTTGACGAAGCTATCGGT
1601 AACACATATTGAATGTCTTTGAGACTCTTAGATTGTACTATTTGCTTAATAGATTAATGAAATTTATCAGATACAACCTG
1681 TATTTCCAAAAACAAGCTAGAAGGAACCTGAGGAATGTGGTTTACATTTGAGATCCACCTTACTGTGTTTTCTACTTTCA
1761 GAAAAGATTCTGTAGTTTTGGTTTTTGGCATCTTTCTTATACTCAGTTTTTTCTGCCTTAATTCCCATTTACCAGCAGTT
1841 AACTCATGTTTATTGTGCTTTCATGCATTGTGATATGGAATGTGTTTAGTAATTTACTCCTTATAAATATGGTAAAGTAC
1921 AGTGGTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguGUGGU-UCCUAUUAAAGAGg 5'
             ||:||  | |  ||||||| 
Target 5' cttCATCACTGCAACATTTCTCt 3'
 238 - 260 151.00 -10.00
2 
miRNA  3' ugugUGGUUCCUAUUAAAGAGg 5'
              || || || | |||||| 
Target 5' tgtaACAAATGAGATTTTCTCa 3'
 278 - 299 134.00 -6.80
3 
miRNA  3' uguGUGGUUCCUAUUAAAGAGg 5'
             |||:|   ||||||| || 
Target 5' tttCACTA--TATAATTTGTCa 3'
 1497 - 1516 131.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2528751 9 COSMIC
COSN31593100 55 COSMIC
COSN26602084 94 COSMIC
COSN30154650 96 COSMIC
COSN31531277 129 COSMIC
COSN31574315 151 COSMIC
COSN26677393 188 COSMIC
COSN31484986 201 COSMIC
COSN31479415 209 COSMIC
COSN31598453 228 COSMIC
COSN20797743 315 COSMIC
COSN25146650 443 COSMIC
COSN9452449 478 COSMIC
COSN14719457 637 COSMIC
COSN2111301 939 COSMIC
COSN9954014 1366 COSMIC
COSN14736514 1460 COSMIC
COSN21443900 1660 COSMIC
COSN5077697 1768 COSMIC
COSN20886212 1775 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1484709837 4 dbSNP
rs181775847 12 dbSNP
rs1261893843 15 dbSNP
rs778333215 17 dbSNP
rs370921313 21 dbSNP
rs765230956 27 dbSNP
rs1487084631 31 dbSNP
rs1445641562 35 dbSNP
rs752524178 38 dbSNP
rs201510984 40 dbSNP
rs1011104780 43 dbSNP
rs1453382182 46 dbSNP
rs758217605 48 dbSNP
rs1387237263 50 dbSNP
rs1450466712 52 dbSNP
rs1440398166 58 dbSNP
rs1288274522 59 dbSNP
rs1230118307 73 dbSNP
rs1300323733 82 dbSNP
rs779103857 82 dbSNP
rs1022497260 87 dbSNP
rs966973374 89 dbSNP
rs769136941 96 dbSNP
rs1398431317 97 dbSNP
rs200140806 102 dbSNP
rs1431144769 105 dbSNP
rs978317117 106 dbSNP
rs1349237879 121 dbSNP
rs1162663913 123 dbSNP
rs1407009571 123 dbSNP
rs1054614765 135 dbSNP
rs1169312617 142 dbSNP
rs891508174 147 dbSNP
rs1223479718 148 dbSNP
rs1282062384 154 dbSNP
rs1264825970 158 dbSNP
rs924246372 160 dbSNP
rs185401257 165 dbSNP
rs566629741 168 dbSNP
rs1187479610 177 dbSNP
rs1488328745 178 dbSNP
rs1245335776 179 dbSNP
rs1224518529 189 dbSNP
rs965087134 198 dbSNP
rs976883967 216 dbSNP
rs201008237 222 dbSNP
rs534819333 228 dbSNP
rs1257560804 230 dbSNP
rs1216825074 242 dbSNP
rs1320740536 248 dbSNP
rs1296492191 250 dbSNP
rs569235196 253 dbSNP
rs1278809326 254 dbSNP
rs1436880715 257 dbSNP
rs921047050 260 dbSNP
rs1438581787 271 dbSNP
rs1234462645 273 dbSNP
rs1029323002 276 dbSNP
rs932462516 277 dbSNP
rs1048290496 278 dbSNP
rs1425349625 287 dbSNP
rs1170783633 292 dbSNP
rs1432233763 304 dbSNP
rs909796657 314 dbSNP
rs1193265634 316 dbSNP
rs939878368 317 dbSNP
rs1469324094 319 dbSNP
rs1427150143 322 dbSNP
rs1036955818 323 dbSNP
rs906496634 331 dbSNP
rs1003572036 335 dbSNP
rs1251960963 337 dbSNP
rs1018120375 339 dbSNP
rs747347861 349 dbSNP
rs1310638439 351 dbSNP
rs895267876 355 dbSNP
rs17735275 371 dbSNP
rs1022381435 372 dbSNP
rs1028163702 374 dbSNP
rs1308376038 381 dbSNP
rs1444465111 383 dbSNP
rs1355526468 384 dbSNP
rs1404740287 387 dbSNP
rs966858882 394 dbSNP
rs999703366 401 dbSNP
rs1301796754 409 dbSNP
rs777015898 412 dbSNP
rs1454927986 414 dbSNP
rs759744797 416 dbSNP
rs965398016 417 dbSNP
rs189715376 422 dbSNP
rs1177387667 425 dbSNP
rs1406190004 427 dbSNP
rs1251395207 428 dbSNP
rs769768258 430 dbSNP
rs1338340941 436 dbSNP
rs1482415650 439 dbSNP
rs757127820 443 dbSNP
rs1028481417 444 dbSNP
rs1342557058 445 dbSNP
rs535449919 450 dbSNP
rs1266615095 452 dbSNP
rs557266946 456 dbSNP
rs1307114971 463 dbSNP
rs936174327 464 dbSNP
rs762854268 466 dbSNP
rs1054662584 467 dbSNP
rs891955875 467 dbSNP
rs909680559 468 dbSNP
rs1474535344 469 dbSNP
rs1360334659 479 dbSNP
rs781257631 479 dbSNP
rs1050789223 486 dbSNP
rs890805653 491 dbSNP
rs1364836149 497 dbSNP
rs1186931964 503 dbSNP
rs575828324 512 dbSNP
rs1258338628 530 dbSNP
rs182799152 539 dbSNP
rs939845838 541 dbSNP
rs1189006370 545 dbSNP
rs1424349827 548 dbSNP
rs558085363 551 dbSNP
rs1262269484 553 dbSNP
rs1006489002 554 dbSNP
rs927934605 555 dbSNP
rs573344714 560 dbSNP
rs1261171053 562 dbSNP
rs1243450995 566 dbSNP
rs1425924716 567 dbSNP
rs1294560536 570 dbSNP
rs1415068464 573 dbSNP
rs1339389728 577 dbSNP
rs1055172660 588 dbSNP
rs895141220 595 dbSNP
rs1384207546 597 dbSNP
rs1323611893 599 dbSNP
rs946769936 602 dbSNP
rs1325398537 607 dbSNP
rs1428069410 613 dbSNP
rs995824455 615 dbSNP
rs1420169041 616 dbSNP
rs1043803450 623 dbSNP
rs1477632577 636 dbSNP
rs763993675 637 dbSNP
rs951274034 638 dbSNP
rs999672047 643 dbSNP
rs1262153686 652 dbSNP
rs7168 660 dbSNP
rs971389652 662 dbSNP
rs1233318405 668 dbSNP
rs561762172 675 dbSNP
rs902125584 678 dbSNP
rs927277207 680 dbSNP
rs780649658 684 dbSNP
rs573719486 686 dbSNP
rs1229137537 692 dbSNP
rs1289411974 695 dbSNP
rs998255917 695 dbSNP
rs544210134 699 dbSNP
rs1385644721 701 dbSNP
rs1397268857 703 dbSNP
rs1326702735 706 dbSNP
rs562826201 715 dbSNP
rs1283501288 716 dbSNP
rs913429589 717 dbSNP
rs1169928240 718 dbSNP
rs1475846393 725 dbSNP
rs1373480898 732 dbSNP
rs533095229 748 dbSNP
rs946190521 749 dbSNP
rs983841266 751 dbSNP
rs1254737833 762 dbSNP
rs1255598716 763 dbSNP
rs1456972002 763 dbSNP
rs374105381 763 dbSNP
rs151213345 764 dbSNP
rs1444305756 765 dbSNP
rs769675121 769 dbSNP
rs575024962 770 dbSNP
rs972597953 772 dbSNP
rs35950077 773 dbSNP
rs927870338 775 dbSNP
rs1231477760 783 dbSNP
rs1039379968 786 dbSNP
rs1473400398 787 dbSNP
rs546731760 791 dbSNP
rs898154946 798 dbSNP
rs939245926 804 dbSNP
rs991153422 805 dbSNP
rs185615990 806 dbSNP
rs1383440706 810 dbSNP
rs535486090 817 dbSNP
rs1171785373 822 dbSNP
rs1432566706 832 dbSNP
rs1047390667 833 dbSNP
rs886963068 834 dbSNP
rs779055282 836 dbSNP
rs1043772794 837 dbSNP
rs1183288037 839 dbSNP
rs550583495 840 dbSNP
rs1451507385 845 dbSNP
rs1024402287 847 dbSNP
rs1277396217 853 dbSNP
rs1312613227 857 dbSNP
rs1384658633 861 dbSNP
rs1350575422 863 dbSNP
rs1281490988 868 dbSNP
rs1240123352 870 dbSNP
rs902634662 871 dbSNP
rs1281379526 882 dbSNP
rs935493933 885 dbSNP
rs1040585887 887 dbSNP
rs1278817837 892 dbSNP
rs1416846367 896 dbSNP
rs902011330 899 dbSNP
rs1377082009 901 dbSNP
rs996408170 903 dbSNP
rs1174011103 909 dbSNP
rs1419050205 910 dbSNP
rs1001617119 911 dbSNP
rs1348476470 918 dbSNP
rs1029670084 919 dbSNP
rs1236373293 920 dbSNP
rs1268924485 922 dbSNP
rs1461015059 928 dbSNP
rs1258682230 936 dbSNP
rs1202064561 940 dbSNP
rs1216294362 943 dbSNP
rs77827085 947 dbSNP
rs1005252894 956 dbSNP
rs1355809596 962 dbSNP
rs755790209 963 dbSNP
rs140115283 973 dbSNP
rs986897390 977 dbSNP
rs1313296863 980 dbSNP
rs765865385 986 dbSNP
rs1343380052 987 dbSNP
rs1320276294 993 dbSNP
rs1401215941 1004 dbSNP
rs1412498824 1004 dbSNP
rs994327976 1005 dbSNP
rs1162110051 1008 dbSNP
rs1160699770 1009 dbSNP
rs1338062708 1010 dbSNP
rs1193409474 1018 dbSNP
rs912723411 1022 dbSNP
rs942494100 1022 dbSNP
rs1034826848 1025 dbSNP
rs1412125316 1026 dbSNP
rs1217180356 1030 dbSNP
rs960836041 1045 dbSNP
rs1271374899 1053 dbSNP
rs1235173754 1054 dbSNP
rs753369066 1056 dbSNP
rs1277744201 1065 dbSNP
rs1217019818 1071 dbSNP
rs150285037 1072 dbSNP
rs1431455797 1073 dbSNP
rs930948940 1075 dbSNP
rs1462506409 1083 dbSNP
rs1046976081 1088 dbSNP
rs1422151867 1089 dbSNP
rs1426330322 1089 dbSNP
rs1187424951 1095 dbSNP
rs542036457 1098 dbSNP
rs1013500045 1115 dbSNP
rs1215653554 1124 dbSNP
rs979435469 1126 dbSNP
rs1469010323 1136 dbSNP
rs1328002391 1140 dbSNP
rs1333904206 1145 dbSNP
rs1257501068 1149 dbSNP
rs747470289 1151 dbSNP
rs137987347 1160 dbSNP
rs1040865428 1162 dbSNP
rs923433100 1170 dbSNP
rs1297494893 1177 dbSNP
rs932158203 1182 dbSNP
rs1050679005 1183 dbSNP
rs1265165679 1186 dbSNP
rs888064794 1194 dbSNP
rs1001648324 1196 dbSNP
rs1443001486 1196 dbSNP
rs1330062270 1198 dbSNP
rs73757334 1218 dbSNP
rs1171570920 1230 dbSNP
rs772076344 1239 dbSNP
rs1038005014 1244 dbSNP
rs1196129392 1249 dbSNP
rs1248906879 1253 dbSNP
rs1440037068 1260 dbSNP
rs557764284 1263 dbSNP
rs1175508074 1274 dbSNP
rs6878147 1274 dbSNP
rs1481743989 1277 dbSNP
rs183617481 1288 dbSNP
rs1209663849 1299 dbSNP
rs1020544419 1302 dbSNP
rs1277882585 1307 dbSNP
rs1236462081 1317 dbSNP
rs1348437061 1318 dbSNP
rs562357140 1322 dbSNP
rs1466294118 1323 dbSNP
rs960553682 1325 dbSNP
rs1375096614 1326 dbSNP
rs1167075490 1327 dbSNP
rs1446831429 1329 dbSNP
rs1374069304 1331 dbSNP
rs1175896976 1332 dbSNP
rs1435911018 1332 dbSNP
rs1394134164 1336 dbSNP
rs1421017847 1339 dbSNP
rs1012524386 1345 dbSNP
rs1181536063 1348 dbSNP
rs1484798573 1352 dbSNP
rs1023498616 1353 dbSNP
rs1254630350 1354 dbSNP
rs557887479 1354 dbSNP
rs1348514512 1355 dbSNP
rs1236782223 1359 dbSNP
rs964170802 1359 dbSNP
rs975205714 1359 dbSNP
rs919628981 1360 dbSNP
rs931000262 1362 dbSNP
rs149481496 1366 dbSNP
rs908203843 1366 dbSNP
rs546159833 1368 dbSNP
rs979320985 1369 dbSNP
rs545025153 1372 dbSNP
rs1227026773 1375 dbSNP
rs1249856370 1380 dbSNP
rs1455777575 1382 dbSNP
rs1364505668 1392 dbSNP
rs188206602 1393 dbSNP
rs956932127 1398 dbSNP
rs1046332650 1400 dbSNP
rs905039874 1401 dbSNP
rs1485912072 1407 dbSNP
rs781635009 1407 dbSNP
rs923372380 1410 dbSNP
rs1203359881 1412 dbSNP
rs1486794654 1415 dbSNP
rs1490019949 1416 dbSNP
rs746141728 1417 dbSNP
rs1332234526 1419 dbSNP
rs1051072544 1420 dbSNP
rs1294807182 1420 dbSNP
rs1055886984 1425 dbSNP
rs893177864 1429 dbSNP
rs909384739 1432 dbSNP
rs1402821950 1439 dbSNP
rs1204885647 1441 dbSNP
rs1325303693 1441 dbSNP
rs942227716 1444 dbSNP
rs1166015139 1451 dbSNP
rs1268894351 1452 dbSNP
rs146862953 1459 dbSNP
rs71624159 1460 dbSNP
rs1190699457 1461 dbSNP
rs1430270898 1462 dbSNP
rs1019799218 1468 dbSNP
rs1212973416 1474 dbSNP
rs1466802115 1475 dbSNP
rs964180906 1477 dbSNP
rs73757335 1478 dbSNP
rs529363550 1479 dbSNP
rs551013729 1483 dbSNP
rs1056204500 1486 dbSNP
rs1027144422 1488 dbSNP
rs1250003583 1488 dbSNP
rs1431335198 1488 dbSNP
rs1169045623 1491 dbSNP
rs1364880126 1495 dbSNP
rs1422709295 1502 dbSNP
rs896258764 1504 dbSNP
rs952607329 1506 dbSNP
rs1368335476 1514 dbSNP
rs1381752532 1517 dbSNP
rs569160941 1521 dbSNP
rs533357895 1525 dbSNP
rs1023385546 1527 dbSNP
rs1229583270 1532 dbSNP
rs1390554580 1547 dbSNP
rs1192973189 1554 dbSNP
rs139220054 1561 dbSNP
rs1254355163 1562 dbSNP
rs1193667585 1569 dbSNP
rs1436864192 1573 dbSNP
rs908236698 1578 dbSNP
rs949004721 1583 dbSNP
rs982043801 1589 dbSNP
rs1280026889 1590 dbSNP
rs1232809871 1596 dbSNP
rs1000707666 1598 dbSNP
rs1030892396 1599 dbSNP
rs1266573069 1600 dbSNP
rs749354873 1604 dbSNP
rs1334217916 1606 dbSNP
rs771341472 1606 dbSNP
rs1392147374 1607 dbSNP
rs976516273 1608 dbSNP
rs768678846 1610 dbSNP
rs1259163950 1619 dbSNP
rs953549881 1625 dbSNP
rs1054063013 1628 dbSNP
rs893639668 1632 dbSNP
rs1188928932 1633 dbSNP
rs1384430472 1635 dbSNP
rs1442562223 1638 dbSNP
rs1183592223 1641 dbSNP
rs1483168414 1649 dbSNP
rs1257286460 1654 dbSNP
rs947483758 1656 dbSNP
rs574337820 1663 dbSNP
rs567155216 1666 dbSNP
rs1041773604 1667 dbSNP
rs777235208 1669 dbSNP
rs909353484 1671 dbSNP
rs903197531 1673 dbSNP
rs1350402806 1674 dbSNP
rs1453071516 1675 dbSNP
rs1287247087 1677 dbSNP
rs1391106044 1678 dbSNP
rs1008162427 1681 dbSNP
rs1019838450 1683 dbSNP
rs1412634168 1685 dbSNP
rs1377032041 1689 dbSNP
rs900114220 1694 dbSNP
rs1405230338 1699 dbSNP
rs193254649 1708 dbSNP
rs1472732557 1710 dbSNP
rs972290955 1711 dbSNP
rs997091657 1714 dbSNP
rs556016566 1717 dbSNP
rs1380976763 1719 dbSNP
rs774477891 1721 dbSNP
rs1313983738 1724 dbSNP
rs1316860089 1725 dbSNP
rs1237693832 1729 dbSNP
rs1286469269 1731 dbSNP
rs1027606861 1732 dbSNP
rs1334454769 1735 dbSNP
rs567823114 1735 dbSNP
rs952903271 1740 dbSNP
rs919538849 1745 dbSNP
rs1265736216 1748 dbSNP
rs1465955307 1755 dbSNP
rs1429965225 1757 dbSNP
rs982947324 1768 dbSNP
rs1015313134 1772 dbSNP
rs537945470 1776 dbSNP
rs1056571740 1781 dbSNP
rs1188143323 1787 dbSNP
rs1393081839 1791 dbSNP
rs1162395884 1796 dbSNP
rs1462669638 1799 dbSNP
rs556224232 1801 dbSNP
rs1186249202 1803 dbSNP
rs1474715654 1806 dbSNP
rs981744410 1807 dbSNP
rs926262740 1810 dbSNP
rs774290411 1815 dbSNP
rs896155368 1822 dbSNP
rs1183391486 1828 dbSNP
rs577608350 1832 dbSNP
rs937948245 1834 dbSNP
rs1044805392 1835 dbSNP
rs1322505492 1840 dbSNP
rs1290368328 1844 dbSNP
rs183132375 1847 dbSNP
rs1359801964 1848 dbSNP
rs1271921395 1850 dbSNP
rs1435723247 1859 dbSNP
rs1418502810 1863 dbSNP
rs1323246726 1866 dbSNP
rs1462716890 1868 dbSNP
rs1350036509 1873 dbSNP
rs1170206128 1877 dbSNP
rs541654702 1878 dbSNP
rs1030861227 1883 dbSNP
rs1041804534 1891 dbSNP
rs924671537 1897 dbSNP
rs373353082 1901 dbSNP
rs1336280290 1906 dbSNP
rs1041049187 1908 dbSNP
rs143349713 1914 dbSNP
rs1232462345 1922 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugugugguUCCUAUUAAAGAGg 5'
                  | || | |||||| 
Target 5' --------AUGAGAUUUUCUCa 3'
 		1 - 14
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000424459.3 | 3UTR | AUGAGAUUUUCUCAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.541 3.2e-3 0.503 6.1e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.605 1.4e-2 0.516 3.6e-2 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.852 1.6e-2 0.886 9.4e-3 6 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.287 8.2e-2 0.345 4.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.283 9.5e-2 -0.428 2.1e-2 23 Click to see details
GSE27834 Pluripotent stem cells 0.336 1.0e-1 0.385 7.0e-2 16 Click to see details
GSE38226 Liver fibrosis 0.264 1.2e-1 0.005 4.9e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.332 1.5e-1 0.406 9.5e-2 12 Click to see details
GSE21032 Prostate cancer -0.116 1.5e-1 -0.164 6.9e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.223 1.7e-1 0.408 3.7e-2 20 Click to see details
GSE21849 B cell lymphoma -0.166 1.9e-1 -0.163 2.0e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.153 2.0e-1 0.003 4.9e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.151 2.6e-1 -0.060 4.0e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.041 3.7e-1 -0.154 1.1e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.028 4.0e-1 0.082 2.4e-1 79 Click to see details
GSE17306 Multiple myeloma -0.035 4.1e-1 0.058 3.5e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.033 4.4e-1 0.197 1.7e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.009 4.7e-1 -0.013 4.5e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells 0.016 4.7e-1 -0.140 2.6e-1 24 Click to see details
GSE19536 Breast cancer -0.004 4.8e-1 0.060 2.8e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.513 0.01 0.509 0.02 18 Click to see details
COAD -0.704 0.03 -0.500 0.1 8 Click to see details
STAD 0.334 0.03 0.126 0.25 31 Click to see details
KIRC -0.185 0.07 -0.146 0.12 66 Click to see details
THCA -0.187 0.1 -0.244 0.04 50 Click to see details
HNSC -0.176 0.13 -0.079 0.31 42 Click to see details
LUSC -0.183 0.14 -0.124 0.23 37 Click to see details
LUAD -0.473 0.14 -0.607 0.07 7 Click to see details
ESCA 0.323 0.17 0.400 0.11 11 Click to see details
CESC -0.828 0.19 -0.500 0.33 3 Click to see details
KICH -0.191 0.19 -0.317 0.07 23 Click to see details
KIRP -0.163 0.19 -0.202 0.14 30 Click to see details
LIHC -0.111 0.23 -0.167 0.13 48 Click to see details
PRAD -0.069 0.32 -0.024 0.44 47 Click to see details
BRCA 0.051 0.32 0.040 0.36 84 Click to see details
PAAD -0.349 0.33 -0.800 0.1 4 Click to see details
PCPG 0.272 0.41 0.500 0.33 3 Click to see details
CHOL 0.071 0.43 0.067 0.43 9 Click to see details
UCEC 0.023 0.46 -0.070 0.39 19 Click to see details
UCEC 0.023 0.46 -0.070 0.39 19 Click to see details
UCEC 0.023 0.46 -0.070 0.39 19 Click to see details
193 hsa-miR-539-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053510 TWIST1 twist family bHLH transcription factor 1 4 1
MIRT053516 ZEB1 zinc finger E-box binding homeobox 1 4 1
MIRT057687 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT066722 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT071515 CALM1 calmodulin 1 1 1
MIRT084964 BACH1 BTB domain and CNC homolog 1 2 2
MIRT096759 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT099799 SOX4 SRY-box 4 2 2
MIRT126502 OTUD1 OTU deubiquitinase 1 2 2
MIRT163869 WDR1 WD repeat domain 1 2 2
MIRT176316 DDX3Y DEAD-box helicase 3, Y-linked 2 2
MIRT182188 POU2F1 POU class 2 homeobox 1 2 4
MIRT234348 MSL1 male specific lethal 1 homolog 2 8
MIRT244630 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 4
MIRT262597 ZNF37A zinc finger protein 37A 2 2
MIRT282630 IGF1R insulin like growth factor 1 receptor 2 2
MIRT287286 PSME3 proteasome activator subunit 3 2 2
MIRT310569 DCK deoxycytidine kinase 2 4
MIRT335358 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT367797 PRRG4 proline rich and Gla domain 4 2 2
MIRT439294 WASF3 WAS protein family member 3 2 3
MIRT439373 TULP3 tubby like protein 3 1 1
MIRT439515 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT439603 SLC39A6 solute carrier family 39 member 6 1 1
MIRT439659 SFMBT2 Scm like with four mbt domains 2 1 1
MIRT439661 SF3B1 splicing factor 3b subunit 1 1 1
MIRT439664 SETX senataxin 1 1
MIRT439728 RPS4X ribosomal protein S4, X-linked 1 1
MIRT440082 NUCB2 nucleobindin 2 1 1
MIRT440321 LOC728392 uncharacterized LOC728392 1 1
MIRT440354 KLHL2 kelch like family member 2 1 1
MIRT440371 KIF21A kinesin family member 21A 1 1
MIRT440412 KAT2B lysine acetyltransferase 2B 1 1
MIRT440606 FXR2 FMR1 autosomal homolog 2 1 1
MIRT440789 DNMT3A DNA methyltransferase 3 alpha 1 1
MIRT440803 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 1 1
MIRT440919 CNOT4 CCR4-NOT transcription complex subunit 4 1 1
MIRT440975 CDC27 cell division cycle 27 1 1
MIRT441206 ARFGEF2 ADP ribosylation factor guanine nucleotide exchange factor 2 1 1
MIRT441291 ACPP acid phosphatase, prostate 1 1
MIRT441634 KDM5A lysine demethylase 5A 2 2
MIRT442560 CAB39 calcium binding protein 39 2 2
MIRT443087 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT443454 CLIC5 chloride intracellular channel 5 2 2
MIRT443721 TAF1B TATA-box binding protein associated factor, RNA polymerase I subunit B 2 2
MIRT443772 STS steroid sulfatase 2 2
MIRT444081 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT444548 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT444564 TRA2B transformer 2 beta homolog 2 2
MIRT444723 LAMA2 laminin subunit alpha 2 2 2
MIRT444958 ADAM22 ADAM metallopeptidase domain 22 2 2
MIRT445051 SLC16A9 solute carrier family 16 member 9 2 2
MIRT445143 IKBIP IKBKB interacting protein 2 2
MIRT445415 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT445620 CLIC4 chloride intracellular channel 4 2 2
MIRT445967 IKZF5 IKAROS family zinc finger 5 2 2
MIRT446159 RPL12 ribosomal protein L12 2 2
MIRT446231 C17orf80 chromosome 17 open reading frame 80 2 2
MIRT446392 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT446944 ZMAT3 zinc finger matrin-type 3 2 2
MIRT447194 CDCP1 CUB domain containing protein 1 2 2
MIRT447360 FAM161B family with sequence similarity 161 member B 2 2
MIRT447793 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT447830 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448123 CCDC80 coiled-coil domain containing 80 2 2
MIRT448401 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT448720 ITGA2 integrin subunit alpha 2 2 2
MIRT448800 GLIS3 GLIS family zinc finger 3 2 2
MIRT449070 CNDP2 carnosine dipeptidase 2 2 2
MIRT449122 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT449412 TRIM5 tripartite motif containing 5 2 2
MIRT449712 TSPYL1 TSPY like 1 2 2
MIRT449845 BCL2L13 BCL2 like 13 2 2
MIRT449944 IGF1 insulin like growth factor 1 2 2
MIRT450088 OR2A4 olfactory receptor family 2 subfamily A member 4 2 2
MIRT450808 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT451876 SOD2 superoxide dismutase 2 2 8
MIRT452003 FKBP5 FK506 binding protein 5 2 2
MIRT452244 TRAM1 translocation associated membrane protein 1 2 2
MIRT453892 DUSP18 dual specificity phosphatase 18 2 2
MIRT457507 SLC35F6 solute carrier family 35 member F6 2 2
MIRT458522 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT459799 POTED POTE ankyrin domain family member D 2 10
MIRT459869 KIAA1191 KIAA1191 2 2
MIRT460004 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT464765 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT464933 TXLNA taxilin alpha 2 2
MIRT465140 TSC22D2 TSC22 domain family member 2 2 2
MIRT469364 REST RE1 silencing transcription factor 2 6
MIRT474820 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475668 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT476144 GPR137C G protein-coupled receptor 137C 2 8
MIRT478054 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 8
MIRT478588 CTDSPL2 CTD small phosphatase like 2 2 2
MIRT478805 CRTAP cartilage associated protein 2 2
MIRT479295 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT481480 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484232 IER2 immediate early response 2 2 2
MIRT485424 LDLR low density lipoprotein receptor 2 6
MIRT486920 CSTF2 cleavage stimulation factor subunit 2 2 4
MIRT488396 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT488426 COPA coatomer protein complex subunit alpha 2 2
MIRT489553 SOX11 SRY-box 11 2 6
MIRT493068 MTCH1 mitochondrial carrier 1 2 2
MIRT494096 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT497894 STRN striatin 2 2
MIRT498084 SETD5 SET domain containing 5 2 2
MIRT499923 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT501618 PISD phosphatidylserine decarboxylase 2 2
MIRT501835 NCOA2 nuclear receptor coactivator 2 2 2
MIRT502043 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 6
MIRT502255 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT502327 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT502991 CCDC71L coiled-coil domain containing 71 like 2 8
MIRT505415 TCF7L2 transcription factor 7 like 2 2 4
MIRT505694 SESN3 sestrin 3 2 2
MIRT506325 ONECUT2 one cut homeobox 2 2 2
MIRT506331 NUPL2 nucleoporin like 2 2 4
MIRT506877 KIAA0101 PCNA clamp associated factor 2 6
MIRT508237 ZNF121 zinc finger protein 121 2 4
MIRT509849 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT510002 UCP1 uncoupling protein 1 2 6
MIRT510324 SLC2A3 solute carrier family 2 member 3 2 4
MIRT511449 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 6
MIRT512379 PHB2 prohibitin 2 2 2
MIRT513672 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 4
MIRT516479 RAB32 RAB32, member RAS oncogene family 2 4
MIRT517589 ZNF579 zinc finger protein 579 2 4
MIRT520501 TRAM2 translocation associated membrane protein 2 2 6
MIRT521656 PRKD3 protein kinase D3 2 2
MIRT524646 C4orf32 family with sequence similarity 241 member A 2 2
MIRT528365 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT530455 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT537168 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT537761 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT537959 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT539317 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT539610 SHISA9 shisa family member 9 2 2
MIRT539641 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540335 OPHN1 oligophrenin 1 2 2
MIRT543806 COCH cochlin 2 2
MIRT544135 GLO1 glyoxalase I 2 4
MIRT544497 SLC25A46 solute carrier family 25 member 46 2 2
MIRT544792 ZKSCAN8 zinc finger with KRAB and SCAN domains 8 2 2
MIRT545832 ZNF367 zinc finger protein 367 2 4
MIRT546461 SLC39A14 solute carrier family 39 member 14 2 2
MIRT546578 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT548379 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549858 MCM4 minichromosome maintenance complex component 4 2 2
MIRT550705 TP53RK TP53 regulating kinase 2 4
MIRT550839 ABRACL ABRA C-terminal like 2 2
MIRT551955 RNF157 ring finger protein 157 2 2
MIRT552508 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT553922 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT555151 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT555348 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT559946 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT560145 RNPS1 RNA binding protein with serine rich domain 1 2 2
MIRT560848 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561238 ZNF652 zinc finger protein 652 2 2
MIRT562248 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT563485 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT563872 BASP1 brain abundant membrane attached signal protein 1 2 2
MIRT568196 CBX6 chromobox 6 2 2
MIRT571648 SF1 splicing factor 1 2 2
MIRT574107 SPINT2 serine peptidase inhibitor, Kunitz type 2 2 2
MIRT608237 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT609337 HRASLS5 HRAS like suppressor family member 5 2 2
MIRT612010 COX17 COX17, cytochrome c oxidase copper chaperone 2 2
MIRT612278 ZNF226 zinc finger protein 226 2 2
MIRT612726 NFAM1 NFAT activating protein with ITAM motif 1 2 4
MIRT623647 HS3ST5 heparan sulfate-glucosamine 3-sulfotransferase 5 2 2
MIRT644590 SPOP speckle type BTB/POZ protein 2 2
MIRT647567 ZNF660 zinc finger protein 660 2 2
MIRT649818 PSMC1 proteasome 26S subunit, ATPase 1 2 2
MIRT650882 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT654470 RANBP2 RAN binding protein 2 2 2
MIRT662531 PTCD2 pentatricopeptide repeat domain 2 2 2
MIRT667796 JHDM1D lysine demethylase 7A 1 1
MIRT668978 CLCN3 chloride voltage-gated channel 3 2 2
MIRT696546 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697819 UBQLN1 ubiquilin 1 2 2
MIRT704048 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT705514 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 2
MIRT715899 SIPA1L1 signal induced proliferation associated 1 like 1 2 2
MIRT716350 C10orf105 chromosome 10 open reading frame 105 2 2
MIRT716638 DPY19L4 dpy-19 like 4 2 2
MIRT721205 PUS7L pseudouridylate synthase 7 like 2 2
MIRT732106 CDK4 cyclin dependent kinase 4 3 1
MIRT732127 CARD11 caspase recruitment domain family member 11 3 1
MIRT736678 TRIAP1 TP53 regulated inhibitor of apoptosis 1 3 0
MIRT755656 SLC11A2 solute carrier family 11 member 2 3 1
MIRT755660 Irak3 interleukin-1 receptor-associated kinase 3 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-539 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-539 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-539 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-539 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 up-regulated
miR-539 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-539-5p Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-539 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-539 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-539 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-539-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-539-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-539-5p (2Z)-2-(tert-butylhydrazinylidene)-N-(3-chloro-1,4-dioxonaphthalen-2-yl)-3-(3,7,12-trioxo-4H-naphtho[2,3-h]quinoxalin-2-yl)propanamide 5479912 NSC649574 resistant
hsa-miR-539-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-539-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-539-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-539-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-539-5p (E)-N-ethyl-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enamide 5388754 NSC638409 sensitive
hsa-miR-539-5p (Z)-3-[5-[3,5-bis(trifluoromethyl)phenyl]furan-2-yl]prop-2-enenitrile 5468615 NSC672868 sensitive
hsa-miR-539-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-(2-methylphenyl)propanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hepta 383478 NSC671870 sensitive
hsa-miR-539-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-539-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-539-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-539-5p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-539-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-539-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-539-5p 1-(benzenesulfonyl)-2-[1-(benzenesulfonyl)-3-methylindol-2-yl]-3-methylindole 396901 NSC704080 resistant
hsa-miR-539-5p 1-[10-[4-(dimethylamino)-2-methylquinolin-1-ium-1-yl]decyl]-N,N,2-trimethylquinolin-1-ium-4-amine;perchlorate 387883 NSC682095 sensitive
hsa-miR-539-5p 1-[2-(3-chloropropyl)phenyl]-3,4-dihydroisoquinoline;hydrochloride 390024 NSC686940 sensitive
hsa-miR-539-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-539-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-539-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-539-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-539-5p 10-methyl-2-[(3,4,5-trimethoxyphenyl)methyl]phenothiazine-1-carbonitrile 374832 NSC653255 sensitive
hsa-miR-539-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-539-5p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-539-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-539-5p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-539-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-539-5p 2-(trifluoromethyl)benzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383194 NSC671313 sensitive
hsa-miR-539-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-539-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-539-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-539-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-539-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-539-5p 2-ethyl-n-phenyl-5,6,7,8-tetrahydrothieno[2,3-b]quinolin-4-amine 365483 NSC633116 sensitive
hsa-miR-539-5p 2-methyl-1-[10-[(2-methylquinolin-4-yl)amino]decyl]quinolin-1-ium-4-amine;chloride;hydrochloride 387885 NSC682096 sensitive
hsa-miR-539-5p 2-methyl-4,4-diphenyl-1,4-benzoxaphosphinin-4-ium;bromide 24199840 NSC346098 sensitive
hsa-miR-539-5p 2-n-[3-(diethylaminomethyl)-4-methoxyphenyl]-4-n-[4-(dimethylamino)cyclohexyl]quinazoline-2,4-diamine;hydrochloride 54610390 NSC174030 sensitive
hsa-miR-539-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-539-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-539-5p 2,3-dibenzoyloxy-4-hydroxy-4-oxobutanoate;(2,5-dimethylphenyl)-(4-methylphenyl)-phenylsulfanium 5351228 NSC116693 sensitive
hsa-miR-539-5p 2,5-dibenzyl-2-undecyloctahydro-1h-pyrrolo[3,4-c]pyridin-2-ium bromide 378731 NSC661832 sensitive
hsa-miR-539-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-539-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-539-5p 3-(3-fluorophenyl)-n-pyridin-3-yl-2h-pyrazolo[3,4-d][1,3]thiazol-5-amine 60147811 NSC752461 sensitive
hsa-miR-539-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-539-5p 3-amino-4-(1,3-benzothiazol-2-yl)-7-nitro-2-(1-phenylethyl)isoquinolin-1-one 391659 NSC691201 sensitive
hsa-miR-539-5p 3-nitro-5-oxo-7h-benzimidazolo[1,2-a]quinoline-6-carbonitrile 391674 NSC691216 sensitive
hsa-miR-539-5p 3,3'-diethyl-9-methylthiacarbocyanine iodide 5351210 NSC96932 sensitive
hsa-miR-539-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-539-5p 3,4,7-trichloro-n,n-bis(2-chloroethyl)-11-oxobenzo[d][1,3,6,2]benzodioxathiaphosphocin-11-amine 382835 NSC670664 sensitive
hsa-miR-539-5p 4-(3h-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl acetate 384820 NSC675272 sensitive
hsa-miR-539-5p 4-(4-carbazol-9-ylbutanoylamino)-n-[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 406397 NSC724462 sensitive
hsa-miR-539-5p 4-(5-(4-(hydroxy(oxido)amino)phenyl)-2-furyl)-2-(4-toluidino)-1,3-thiazole 367868 NSC638034 sensitive
hsa-miR-539-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-539-5p 4-[(13R)-13-hydroxy-13-[(2S,5S)-5-[(2S,5S)-5-[1-hydroxy-13-[(2S)-2-methyl-5-oxo-2H-furan-4-yl]tridecyl]oxolan-2-yl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one 374064 NSC651320 sensitive
hsa-miR-539-5p 4-[(2z)-2-[3-butyl-4-(4-chlorophenyl)-1,3-thiazolidin-2-ylidene]hydrazinyl]-2h-phthalazin-1-one 9572675 NSC724117 sensitive
hsa-miR-539-5p 4-[(e)-2-[3-(4-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613025 NSC750038 sensitive
hsa-miR-539-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-539-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-539-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-539-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-539-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-539-5p 5-(4-chlorophenyl)-3-[3-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]phenyl]-1H-imidazol-2-one 46919707 NSC748559 resistant
hsa-miR-539-5p 5-[(5s,8ar)-5-(4-fluoroanilino)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-3-methoxycyclohexa-3,5-diene-1,2-dione 369957 NSC642324 sensitive
hsa-miR-539-5p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-539-5p 5-chroman-6-yl-2-(4-pyridyl)oxazole 380226 NSC665702 sensitive
hsa-miR-539-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-539-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-539-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-539-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-539-5p 7-[(3-fluorophenyl)methoxy]-9-[(3-fluorophenyl)methyl]-2-[(4-fluorophenyl)methyl]-1-methylpyrido[3,4-b]indol-2-ium 54766740 NSC760181 sensitive
hsa-miR-539-5p 7-epi-3,4-bis-nor-dolastatin 11 396354 NSC702158 sensitive
hsa-miR-539-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-539-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-539-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-539-5p 8-benzyl-12-[2-(4-chloroanilino)-2-oxoethyl]sulfanyl-5-methyl-7-oxo-3-thia-1,8,10,11-tetrazatricyclo[7.3.0.02,6]dodeca-2(6),4,9,11-tetraene-4-carboxamide 155805059 NSC762858 sensitive
hsa-miR-539-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-539-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-539-5p 9-bromo-2,3-dimethoxy-7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-6-one 395805 NSC700693 resistant
hsa-miR-539-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-539-5p Baccharin 5358645 NSC269757 sensitive
hsa-miR-539-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-539-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-539-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-539-5p C12h8n2o2s 3838042 NSC675587 sensitive
hsa-miR-539-5p C22h12f6o6s2 389883 NSC686511 sensitive
hsa-miR-539-5p Carbon monoxide; cyclopentane; 1-ethoxy-3a-methyl-azulen-4-one; iron 499038 NSC649307 sensitive
hsa-miR-539-5p Cuspidatin c 5459164 NSC636859 sensitive
hsa-miR-539-5p Cytovaricin 5477715 NSC349622 sensitive
hsa-miR-539-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-539-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-539-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-539-5p Dimethyl (1s,7s,8s,9s,10s,12s)-9,10-diacetyloxy-11-[tert-butyl(dimethyl)silyl]oxy-7-phenylmethoxy-2-oxa-3-azatricyclo[6.3.1.04,12]dodec-3-ene-1,12-dicarboxylate 360859 NSC623520 sensitive
hsa-miR-539-5p Ethyl (E)-3-(6-methoxy-1-thiophen-3-yl-3,4-dihydronaphthalen-2-yl)prop-2-enoate 24205739 NSC736553 sensitive
hsa-miR-539-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-539-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-539-5p Indanthren corinth rk 5351878 NSC74702 sensitive
hsa-miR-539-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-539-5p Inostamycin 368135 NSC638478 sensitive
hsa-miR-539-5p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-539-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-539-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-539-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-539-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-539-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-539-5p Leucinostatine d 5459065 NSC608984 sensitive
hsa-miR-539-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-539-5p Methyl (1r,2s,3r,6r,13s,15r,17s)-10,15,16-trihydroxy-9,13-dimethyl-4,11-dioxo-3-[(z)-4,4,4-trifluoro-3-phenylbut-2-enoyl]oxy-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-17-carboxylate 5467619 NSC656901 sensitive
hsa-miR-539-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-539-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-539-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-539-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-539-5p Ncimech_000253 366144 NSC634471 sensitive
hsa-miR-539-5p NSC644919 NSC644919 sensitive
hsa-miR-539-5p NSC699071 NSC699071 sensitive
hsa-miR-539-5p NSC751830 NSC751830 resistant
hsa-miR-539-5p Oxidanium;1,3-diphenylpropane-1,3-dione;neodymium(3+);hydroxide 24202397 NSC647042 sensitive
hsa-miR-539-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-539-5p Propan-2-yl (3z)-4-benzyl-2,5-dioxo-6-[(2,4,5-trimethoxy-3-methylphenyl)methyl]-3-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]piperazine-1-carboxylate 5387228 NSC622070 sensitive
hsa-miR-539-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-539-5p Propyl gallate 4947 NSC2626 resistant
hsa-miR-539-5p Pyrazolanthrone 8515 NSC75890 resistant
hsa-miR-539-5p Pyrimido[5,4-g]pteridine-2,4,6,8(1h,3h,7h,9h)-tetrone, 1,9-bis(methoxymethyl)-3,7-dimethyl-, 5-oxide 385097 NSC676032 sensitive
hsa-miR-539-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-539-5p Sb-236687 17892742 NSC756422 resistant
hsa-miR-539-5p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-539-5p Stk366297 242249 NSC50648 sensitive
hsa-miR-539-5p Stl361983 256661 NSC83715 resistant
hsa-miR-539-5p Tetraoxo[?]dione 388215 NSC682809 sensitive
hsa-miR-539-5p Tris(1,10-phenanthroline)cerium(iii)-trithiocyanate 24202209 NSC632734 resistant
hsa-miR-539-5p Ursa-11,13(18)-dien-28-oic acid-3.beta.-ol 378695 NSC661747 sensitive
hsa-miR-539-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-539-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-539-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-539-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-539-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-539-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-539-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-539-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-539-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-539-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission