miRTarBase - #MIRT096893


—
pre-miRNA Information
pre-miRNA hsa-mir-16-2   
Genomic Coordinates chr3: 160404745 - 160404825
Description Homo sapiens miR-16-2 stem-loop
Comment This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-16-2-3p
Sequence 53| CCAAUAUUACUGUGCUGCUUUA |74
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30477465 2 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746992239 2 dbSNP
rs775368833 4 dbSNP
rs373202341 10 dbSNP
rs768780684 13 dbSNP
rs1341798864 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ERBB2IP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 55914.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000284037.5 | 3UTR | AUAUGUGAACUCAAAUAUUGCACUUCUUUCAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.668 6.4e-4 0.722 1.6e-4 20 Click to see details
GSE19783 ER- ER- breast cancer -0.29 4.8e-3 -0.246 1.4e-2 79 Click to see details
GSE32688 Pancreatic cancer 0.43 7.0e-3 0.422 8.1e-3 32 Click to see details
GSE28544 Breast cancer 0.483 8.4e-3 0.576 1.6e-3 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.733 1.2e-2 0.667 2.5e-2 9 Click to see details
GSE19536 Breast cancer -0.197 2.5e-2 -0.128 1.0e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells -0.367 3.9e-2 -0.241 1.3e-1 24 Click to see details
GSE38226 Liver fibrosis 0.382 4.4e-2 0.069 3.8e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.206 5.1e-2 -0.181 7.6e-2 64 Click to see details
GSE21032 Prostate cancer -0.152 8.5e-2 -0.083 2.3e-1 83 Click to see details
GSE17498 Multiple myeloma 0.214 9.2e-2 0.230 7.7e-2 40 Click to see details
GSE28260 Renal cortex and medulla -0.367 1.1e-1 -0.374 1.0e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.109 3.0e-1 0.114 2.9e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.079 3.6e-1 -0.108 3.1e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.059 3.9e-1 -0.075 3.6e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.021 4.7e-1 -0.049 4.4e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.012 4.8e-1 0.293 1.0e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.979 0.01 1.000 0.5 4 Click to see details
BRCA -0.246 0.01 -0.247 0.01 83 Click to see details
KICH 0.289 0.08 0.313 0.06 25 Click to see details
BLCA -0.325 0.09 -0.261 0.15 18 Click to see details
KIRP -0.183 0.16 -0.263 0.07 32 Click to see details
KIRC 0.113 0.18 0.079 0.26 68 Click to see details
STAD 0.162 0.19 0.241 0.1 31 Click to see details
ESCA 0.271 0.21 0.245 0.23 11 Click to see details
PRAD 0.091 0.27 0.104 0.24 48 Click to see details
LUAD 0.159 0.31 0.189 0.28 12 Click to see details
UCEC 0.117 0.32 0.226 0.18 19 Click to see details
CHOL -0.176 0.33 -0.300 0.22 9 Click to see details
THCA -0.046 0.36 -0.091 0.25 59 Click to see details
LIHC -0.048 0.37 -0.054 0.36 49 Click to see details
LUSC 0.049 0.39 0.078 0.32 38 Click to see details
CESC 0.242 0.42 0.500 0.33 3 Click to see details
PCPG 0.067 0.48 -0.500 0.33 3 Click to see details
HNSC -0.005 0.49 -0.115 0.23 42 Click to see details
HNSC -0.005 0.49 -0.115 0.23 42 Click to see details
HNSC -0.005 0.49 -0.115 0.23 42 Click to see details
75 hsa-miR-16-2-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004488 RARB retinoic acid receptor beta 3 1
MIRT038707 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT057208 PPIF peptidylprolyl isomerase F 2 4
MIRT058726 RSBN1 round spermatid basic protein 1 2 8
MIRT074502 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 4
MIRT081544 ZNF431 zinc finger protein 431 2 4
MIRT096893 ERBB2IP erbb2 interacting protein 2 2
MIRT105124 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT107898 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT109432 KLHL15 kelch like family member 15 2 6
MIRT166742 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 6
MIRT171257 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 2 2
MIRT192760 B2M beta-2-microglobulin 2 2
MIRT194905 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT215599 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT223632 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 4
MIRT241605 AMOTL1 angiomotin like 1 2 4
MIRT291174 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT444286 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT463285 ZFX zinc finger protein, X-linked 2 4
MIRT471759 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT479611 CDC25A cell division cycle 25A 2 2
MIRT481497 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 8
MIRT483117 SH3BP5 SH3 domain binding protein 5 2 2
MIRT502279 GRPEL2 GrpE like 2, mitochondrial 2 8
MIRT507838 CCNT1 cyclin T1 2 2
MIRT508179 MTRNR2L6 MT-RNR2-like 6 2 4
MIRT510576 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 6
MIRT517853 RPS4X ribosomal protein S4, X-linked 2 4
MIRT521690 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 8
MIRT525070 FRK fyn related Src family tyrosine kinase 2 2
MIRT527082 UBE2E3 ubiquitin conjugating enzyme E2 E3 2 2
MIRT529552 EI24 EI24, autophagy associated transmembrane protein 2 2
MIRT530426 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT533909 TBC1D15 TBC1 domain family member 15 2 2
MIRT536627 IPO7 importin 7 2 2
MIRT537647 ERGIC2 ERGIC and golgi 2 2 4
MIRT538512 CLCN3 chloride voltage-gated channel 3 2 2
MIRT539219 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT539348 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT539954 CCT4 chaperonin containing TCP1 subunit 4 2 2
MIRT541208 HOXA10 homeobox A10 2 2
MIRT543216 TMEM117 transmembrane protein 117 2 2
MIRT543399 DROSHA drosha ribonuclease III 2 2
MIRT546648 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT546852 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT549917 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT552998 USP46 ubiquitin specific peptidase 46 2 2
MIRT555254 PREPL prolyl endopeptidase-like 2 2
MIRT555956 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT557095 HOXA9 homeobox A9 2 2
MIRT561396 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561654 RNF219 ring finger protein 219 2 2
MIRT563101 PABPC4L poly(A) binding protein cytoplasmic 4 like 2 2
MIRT565979 RNF44 ring finger protein 44 2 2
MIRT572396 CCDC14 coiled-coil domain containing 14 2 2
MIRT574400 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT607623 VSNL1 visinin like 1 2 2
MIRT610645 CTGF connective tissue growth factor 2 2
MIRT623379 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT624687 AR androgen receptor 2 2
MIRT632089 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT644216 CBS cystathionine-beta-synthase 2 2
MIRT647841 BID BH3 interacting domain death agonist 2 2
MIRT651649 WASF2 WAS protein family member 2 2 2
MIRT689064 AGMAT agmatinase 2 2
MIRT698150 TNPO1 transportin 1 2 2
MIRT700516 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT704081 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT705970 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT715694 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT717184 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT724607 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT724854 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT725401 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-16-2 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-16-2-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-16-2-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (HOS)
hsa-miR-16-2-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (HOS)
hsa-miR-16-2-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-16-2-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-16-2-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-16-2-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-16-2-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-16-2-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-16-2-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (HCT8)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-16-2-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (MDA-231)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-16-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission