miRTarBase - #MIRT096935


—
pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PAPD7   
Synonyms LAK-1, LAK1, POLK, POLS, TRF4, TRF4-1, TRF41, TUTASE5
Description poly(A) RNA polymerase D7, non-canonical
Transcript NM_001171805   
Other Transcripts NM_001171806 , NM_006999   
Expression
Putative miRNA Targets on PAPD7
3'UTR of PAPD7
(miRNA target sites are highlighted)		 
>PAPD7|NM_001171805|3'UTR
   1 TGGCTCCTGGCTGCGTCAGCCTCCCCCACCCCTCTGCAGACTGCCCCGCGGCCTCGGCCACCGGCAGGGGAACCGAGACC
  81 AGCACCCCGCACGTCAGCCGGGCTCGCGGCACGCCCGCCGCTGATCACTCTGCATGTTTCTTCGTGTGGTGGTCGCGTCC
 161 ATCTTCAAGAACAGCTCGTTGTGCTCATCTGTGAAGCCTTATTAAACGTGGACGTTGTTTTCTGCCTTCCCAGGATTCTT
 241 CCTTCAGTGCTGAGGCAGGTCGGGCTCAGGAACTGCAGGGACGTGAACATGCGCTTGCGGTTTGAGGTAGCCGTGTCTGT
 321 TCCTTCGCGGTTTGCTATTTTCATTTCCTGTTCGTCAAAGCAGCAGAGGAGATCAAACCCCGTTCGTGTGTCTTTCCTCC
 401 ACGGATAAGCTTGGGAGGTCATTGTTTTACTGCCCTCACATTTTGTTTGAAATTTCAGAACTGTTTTTCTATGTAAATAT
 481 TGAAAACTTATGATTTGTGCAATAACTCAGATATTTTTTATTTAATTTCCTATTTTCACATAAGTTATATTTAAGGGAGG
 561 AGGGAATTTTTTTTAAACAAGCTTAGGTCCTTTCCCGAGCTGCATTTTCTAAGTTGGGTCATCGTGTCGGCTGGTTGTCT
 641 GACGAGCATCGTTACAAACACCATGATGAGGGGTTTGGGGTTTTATTTTGATGTCTTTTCTTTTGGTCGGAAGTGAGTGA
 721 AGGAGCCAGGTCGCCCTGAAGGTTTTCCAAAGGGCTTGGCTCCAGAGCCACCTGGCAGACTGCCCGTGGCCCTGCTGTCG
 801 GGCCCCAGGCCGTTGTCCTGCTCTGACCACAGAGTTTTAATGTTTTGGTTTTCACTTCTTTTAAACTGGACAACAAATCC
 881 AGCATTTCAAGTGCCAGAAGTATAACTTTCTAAGGAGAGAAGGGTTGTCACATTATAAAATCTTTAGGAAAATGTGAACT
 961 GGAAAACGCTTCGGTCAGTTTTAGTGACATAGCCTGTGATGATGGGTCTGGTGACTATTATTGCGGACCGTGGTACCCAG
1041 TTTTAGGAATGTGGAGAAAGGAATTCTGTTGATTCCGTTGAGGAATCTGTAGCGTATGCATTCGTTCTGTTAAGAGCAAA
1121 TCTAGGAGAAGTGCTTCAGCTGCCCAGTGCGCCGTGGGGAGTGTTTTAACGGATCGTGTCGCAGGAGAGCACAGCCCAGC
1201 GTTGGGGCCGGGACCGCTGGCGCCCGACGTCGGAAGCATACAGGTATACTATGCAAGTGTATTCTGCCACAACAACCACT
1281 GTCTTTGTTACCTTTTTTTGAACAAGAATATATCCATCCTGCCTAACCCTGAGTTTTTGGAGCACCACAGTTGTCCTGGG
1361 AGTTGGTTGCATCTTGTAGGCCATCTGACTTCCTGTTTTTAAAACGGGGGTCTGGTCTTGCTAAACACTACAGGTAGGTT
1441 GGTCTTTGAAGTCCACTAGTGGAGAATGTCAAGACAAGATACTTATTACCATGACATCTGATGCATGTGCAGCAGTGGGG
1521 AGTTCTAGATTGATCTCTGAATGTGATCGACGCCCAGCAAGGACAAGCTTTAAAATGTCTGCGGTCTGCCCTTTTGAAGC
1601 AGGACTGGCTCACTCTGTCATTGGGAGCTGTCAGCTGCGACTGCAGGTTCTCTAGGAGGCATTCCAGAATAGAGTAGCAC
1681 ACTGTGTCTGCAGTTCTCGATGACCGAAAGTTATCAAAAATATTTAAAATATTTAAATTGTGAACCTATTGATAAAGAAT
1761 ATTTATAAAAACTGATCTGTAGGCCTGTACTAATCTCTACGCATTAGCAATATTGACTGTAAACCCACATTAAGGAAACC
1841 ACTACGGGTCTGGCAGTGCGTGTCCCGTGGGGTGTGCATTTTAAAACTCGATTCATAGACACAGGTACCATGTTCCATTT
1921 CCGTCATGGTGAAGCAAATGAATTGGCCTGGCTACCACTGTGGTCGCGTGCTACAGGTTTGACAAAAAGATATCATGTTT
2001 CGATTTTTTTGTGTGTGGACAACAATATGGAAGCTAAAATTGACATATTTTTATGTAAAGTTTTTCTATTCTTTGATTTT
2081 TAATAAACTTTGGAAACCAGTTTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUGGUAAC-----GAU-UU---CACGUUAa 5'
            | :||||     :|| :|   ||||||| 
Target 5' taAATATTGAAAACTTATGATTTGTGCAATa 3'
 474 - 504 144.00 -7.50
2 
miRNA  3' agugGUA-ACGAU-UUCACGUUaa 5'
              ||| || |: | |||||:  
Target 5' atgaCATCTGATGCATGTGCAGca 3'
 1491 - 1514 118.00 -11.10
3 
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            ||:| |||  |||||:| | 
Target 5' atACTA-TGC--AAGTGTATTc 3'
 1246 - 1264 115.00 -10.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30107879 6 COSMIC
COSN20057503 15 COSMIC
COSN31507891 26 COSMIC
COSN18729826 28 COSMIC
COSN26437093 51 COSMIC
COSN28836387 89 COSMIC
COSN31577005 156 COSMIC
COSN31545050 215 COSMIC
COSN30172228 223 COSMIC
COSN28801921 262 COSMIC
COSN30176223 305 COSMIC
COSN6925736 329 COSMIC
COSN9309692 402 COSMIC
COSN31536023 444 COSMIC
COSN31515047 541 COSMIC
COSN29468635 556 COSMIC
COSN31588094 564 COSMIC
COSN31545391 575 COSMIC
COSN19002552 622 COSMIC
COSN31491222 633 COSMIC
COSN28758284 640 COSMIC
COSN29274780 687 COSMIC
COSN30541713 725 COSMIC
COSN25757973 849 COSMIC
COSN24534152 954 COSMIC
COSN32062309 1017 COSMIC
COSN31594153 1089 COSMIC
COSN31569723 1144 COSMIC
COSN31480398 1171 COSMIC
COSN31577786 1173 COSMIC
COSN32058509 1223 COSMIC
COSN14980162 1247 COSMIC
COSN30542866 1319 COSMIC
COSN30543068 1320 COSMIC
COSN31482808 1533 COSMIC
COSN19067371 1542 COSMIC
COSN26752206 1641 COSMIC
COSN26567140 1694 COSMIC
COSN31486121 1720 COSMIC
COSN9955969 1743 COSMIC
COSN23706648 1891 COSMIC
COSN31543349 1939 COSMIC
COSN31555852 1957 COSMIC
COSN22616845 1969 COSMIC
COSN31569006 2067 COSMIC
COSN31529771 2090 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs537954282 2 dbSNP
rs989644580 4 dbSNP
rs763607292 6 dbSNP
rs1299116562 7 dbSNP
rs1340762865 9 dbSNP
rs1330073622 14 dbSNP
rs374273741 15 dbSNP
rs368438275 16 dbSNP
rs966963490 20 dbSNP
rs766622423 22 dbSNP
rs1233797682 23 dbSNP
rs3822436 24 dbSNP
rs1232935958 26 dbSNP
rs372015045 28 dbSNP
rs957266568 30 dbSNP
rs778024726 31 dbSNP
rs749437135 32 dbSNP
rs911799388 33 dbSNP
rs771231370 34 dbSNP
rs762194546 35 dbSNP
rs940628853 40 dbSNP
rs921028880 42 dbSNP
rs971922229 47 dbSNP
rs745739473 48 dbSNP
rs375445893 49 dbSNP
rs368724278 50 dbSNP
rs760626895 51 dbSNP
rs1196411604 52 dbSNP
rs28381435 56 dbSNP
rs895122582 57 dbSNP
rs1254456348 59 dbSNP
rs1210639552 62 dbSNP
rs938017149 63 dbSNP
rs1226548859 64 dbSNP
rs948047837 67 dbSNP
rs1270897686 73 dbSNP
rs896598811 75 dbSNP
rs1046462487 76 dbSNP
rs1311996468 78 dbSNP
rs1415187963 81 dbSNP
rs975036100 85 dbSNP
rs554075757 86 dbSNP
rs372277358 89 dbSNP
rs902688666 90 dbSNP
rs1265097749 93 dbSNP
rs1000225301 94 dbSNP
rs574007652 100 dbSNP
rs1419563658 101 dbSNP
rs575657775 104 dbSNP
rs1010589010 106 dbSNP
rs1486959737 107 dbSNP
rs375320330 108 dbSNP
rs953163748 109 dbSNP
rs542882975 113 dbSNP
rs1019067390 114 dbSNP
rs562901799 117 dbSNP
rs1468793708 118 dbSNP
rs748037273 120 dbSNP
rs576352088 121 dbSNP
rs920399264 124 dbSNP
rs1357122272 125 dbSNP
rs1453980702 130 dbSNP
rs951986976 131 dbSNP
rs984176151 134 dbSNP
rs916653813 135 dbSNP
rs948140627 145 dbSNP
rs1046428320 146 dbSNP
rs1403098903 146 dbSNP
rs927963708 155 dbSNP
rs746833521 156 dbSNP
rs1475848214 157 dbSNP
rs768809578 158 dbSNP
rs1285705717 159 dbSNP
rs1053135645 162 dbSNP
rs937924903 167 dbSNP
rs545532433 169 dbSNP
rs1272691742 173 dbSNP
rs1055564843 176 dbSNP
rs893946045 178 dbSNP
rs1223009499 179 dbSNP
rs1265950716 179 dbSNP
rs1281441822 184 dbSNP
rs539974549 187 dbSNP
rs1373520831 188 dbSNP
rs1216686895 191 dbSNP
rs1280919612 194 dbSNP
rs1011019335 208 dbSNP
rs1369582910 210 dbSNP
rs1050580979 211 dbSNP
rs781275748 214 dbSNP
rs558112325 215 dbSNP
rs1157305833 219 dbSNP
rs1018576636 225 dbSNP
rs962016248 229 dbSNP
rs993402303 232 dbSNP
rs1400497053 233 dbSNP
rs1027996853 236 dbSNP
rs1269565892 237 dbSNP
rs758135806 247 dbSNP
rs1179159878 256 dbSNP
rs565215182 260 dbSNP
rs274675 262 dbSNP
rs1032490664 263 dbSNP
rs1196723089 266 dbSNP
rs900771934 269 dbSNP
rs71600237 270 dbSNP
rs1157856915 275 dbSNP
rs866753997 277 dbSNP
rs1345006910 281 dbSNP
rs371509469 283 dbSNP
rs1305318144 284 dbSNP
rs1286144816 289 dbSNP
rs1366798617 290 dbSNP
rs915786127 290 dbSNP
rs996427944 293 dbSNP
rs1303439983 294 dbSNP
rs10037633 299 dbSNP
rs529208421 300 dbSNP
rs1287629717 307 dbSNP
rs1430720008 308 dbSNP
rs1301377714 312 dbSNP
rs1375549530 313 dbSNP
rs955021173 314 dbSNP
rs1394714811 316 dbSNP
rs986424269 317 dbSNP
rs1455637212 325 dbSNP
rs190018612 327 dbSNP
rs568873510 328 dbSNP
rs935344412 329 dbSNP
rs1052475983 330 dbSNP
rs915461981 338 dbSNP
rs1490184128 344 dbSNP
rs1485107708 349 dbSNP
rs959586156 350 dbSNP
rs144572996 354 dbSNP
rs551481107 355 dbSNP
rs555282487 358 dbSNP
rs947012111 359 dbSNP
rs1050548045 361 dbSNP
rs889289063 378 dbSNP
rs1008559776 382 dbSNP
rs1040544282 383 dbSNP
rs897458944 386 dbSNP
rs28381436 387 dbSNP
rs1446071319 393 dbSNP
rs1371385459 395 dbSNP
rs1169856442 397 dbSNP
rs1165937985 398 dbSNP
rs274674 403 dbSNP
rs553965830 404 dbSNP
rs567471697 414 dbSNP
rs1474749828 416 dbSNP
rs1258042929 419 dbSNP
rs924048428 422 dbSNP
rs35781419 426 dbSNP
rs1322091367 429 dbSNP
rs951940183 430 dbSNP
rs936754016 431 dbSNP
rs1054389520 441 dbSNP
rs1443070715 441 dbSNP
rs759979999 444 dbSNP
rs900658740 447 dbSNP
rs1022765585 449 dbSNP
rs1297657391 461 dbSNP
rs181234493 463 dbSNP
rs1454774750 465 dbSNP
rs1315472251 466 dbSNP
rs1308542980 470 dbSNP
rs556578060 472 dbSNP
rs576414257 481 dbSNP
rs971237404 488 dbSNP
rs763794729 492 dbSNP
rs961447952 498 dbSNP
rs995259803 503 dbSNP
rs573654063 507 dbSNP
rs959239828 510 dbSNP
rs1462574064 512 dbSNP
rs1275081573 514 dbSNP
rs1162695718 521 dbSNP
rs1035503591 525 dbSNP
rs956837945 533 dbSNP
rs988546417 540 dbSNP
rs1307984687 544 dbSNP
rs915279038 548 dbSNP
rs946938365 550 dbSNP
rs1203280373 558 dbSNP
rs1189820956 560 dbSNP
rs986346498 564 dbSNP
rs1416894011 565 dbSNP
rs1249403440 567 dbSNP
rs990581255 567 dbSNP
rs917847665 584 dbSNP
rs545061609 587 dbSNP
rs1270772612 591 dbSNP
rs970597819 597 dbSNP
rs1462380804 598 dbSNP
rs1334792386 600 dbSNP
rs1274156374 602 dbSNP
rs1183759499 616 dbSNP
rs774977721 616 dbSNP
rs910694179 624 dbSNP
rs944888028 625 dbSNP
rs1161792951 629 dbSNP
rs1053871117 630 dbSNP
rs1422331723 636 dbSNP
rs1411002046 640 dbSNP
rs147882827 644 dbSNP
rs1395161112 645 dbSNP
rs1398116109 649 dbSNP
rs776202781 651 dbSNP
rs572594285 652 dbSNP
rs770389105 655 dbSNP
rs1337595669 656 dbSNP
rs929109020 665 dbSNP
rs1420556698 666 dbSNP
rs1049197366 672 dbSNP
rs1450249104 673 dbSNP
rs1192501487 675 dbSNP
rs1468377281 677 dbSNP
rs1254190813 680 dbSNP
rs1212210580 685 dbSNP
rs1271702703 686 dbSNP
rs1348976836 689 dbSNP
rs541491988 693 dbSNP
rs1239999599 696 dbSNP
rs761367354 699 dbSNP
rs148576717 709 dbSNP
rs896816159 710 dbSNP
rs995542218 717 dbSNP
rs1383946035 718 dbSNP
rs1289255862 727 dbSNP
rs1213852330 733 dbSNP
rs1270290772 734 dbSNP
rs1022901330 736 dbSNP
rs1203938308 742 dbSNP
rs1026744525 743 dbSNP
rs1396429936 747 dbSNP
rs1201603959 751 dbSNP
rs1262160563 760 dbSNP
rs1261407873 765 dbSNP
rs959355626 772 dbSNP
rs567493168 777 dbSNP
rs1489352824 783 dbSNP
rs1012054766 785 dbSNP
rs907148702 786 dbSNP
rs529089388 787 dbSNP
rs1276740484 792 dbSNP
rs749984862 793 dbSNP
rs542953033 794 dbSNP
rs957000988 798 dbSNP
rs988253953 800 dbSNP
rs958067996 801 dbSNP
rs1022211365 802 dbSNP
rs1311890267 805 dbSNP
rs1434990559 806 dbSNP
rs968037198 807 dbSNP
rs1165671448 808 dbSNP
rs1474688559 810 dbSNP
rs562619441 812 dbSNP
rs1186383172 813 dbSNP
rs1421620236 816 dbSNP
rs989854780 819 dbSNP
rs1471022015 821 dbSNP
rs1177219342 826 dbSNP
rs1405702778 829 dbSNP
rs1210416540 836 dbSNP
rs1486136300 841 dbSNP
rs922054173 848 dbSNP
rs1194158705 855 dbSNP
rs1338603063 880 dbSNP
rs986315566 884 dbSNP
rs112187753 885 dbSNP
rs1353295463 889 dbSNP
rs758287300 891 dbSNP
rs1320049203 892 dbSNP
rs1345507316 905 dbSNP
rs945000267 913 dbSNP
rs1414964444 916 dbSNP
rs1429963603 918 dbSNP
rs544243996 921 dbSNP
rs1326198616 922 dbSNP
rs1408873317 923 dbSNP
rs117255937 924 dbSNP
rs919466965 933 dbSNP
rs748934515 936 dbSNP
rs1187718776 941 dbSNP
rs1475621408 942 dbSNP
rs912057219 944 dbSNP
rs929013623 946 dbSNP
rs1437310457 949 dbSNP
rs551102447 949 dbSNP
rs1273853588 951 dbSNP
rs1048861974 954 dbSNP
rs1036617197 959 dbSNP
rs887412820 968 dbSNP
rs766318395 969 dbSNP
rs1044108008 973 dbSNP
rs534913207 974 dbSNP
rs1441083002 979 dbSNP
rs1282071786 981 dbSNP
rs1335813630 989 dbSNP
rs1332820583 997 dbSNP
rs1449605973 1000 dbSNP
rs1392926955 1017 dbSNP
rs1002827291 1018 dbSNP
rs527385382 1020 dbSNP
rs1048510280 1022 dbSNP
rs1321052605 1025 dbSNP
rs142992752 1026 dbSNP
rs891630844 1030 dbSNP
rs567568922 1031 dbSNP
rs1215485214 1034 dbSNP
rs1010041295 1039 dbSNP
rs1022347077 1055 dbSNP
rs1467027590 1059 dbSNP
rs968131591 1060 dbSNP
rs562564089 1068 dbSNP
rs751289625 1076 dbSNP
rs906376182 1077 dbSNP
rs151083904 1078 dbSNP
rs1428605042 1079 dbSNP
rs1030927473 1083 dbSNP
rs1017597555 1094 dbSNP
rs556852682 1095 dbSNP
rs989515489 1097 dbSNP
rs1437855757 1098 dbSNP
rs28381437 1100 dbSNP
rs879140259 1105 dbSNP
rs1381153303 1108 dbSNP
rs553332854 1113 dbSNP
rs1408480378 1114 dbSNP
rs781465229 1132 dbSNP
rs1399934116 1139 dbSNP
rs919380834 1147 dbSNP
rs987551610 1148 dbSNP
rs1394621297 1151 dbSNP
rs911940229 1152 dbSNP
rs186140867 1155 dbSNP
rs984986843 1161 dbSNP
rs1240105115 1162 dbSNP
rs972612153 1167 dbSNP
rs908944872 1168 dbSNP
rs539291941 1171 dbSNP
rs1287704245 1172 dbSNP
rs141069275 1176 dbSNP
rs930870814 1177 dbSNP
rs1044078912 1181 dbSNP
rs928330240 1182 dbSNP
rs938559942 1189 dbSNP
rs370072952 1191 dbSNP
rs1430475293 1192 dbSNP
rs1361637014 1200 dbSNP
rs1053059174 1201 dbSNP
rs947849220 1202 dbSNP
rs577697322 1203 dbSNP
rs1374880850 1208 dbSNP
rs1176925084 1210 dbSNP
rs891591840 1211 dbSNP
rs1417315058 1214 dbSNP
rs1011394391 1215 dbSNP
rs1042891741 1216 dbSNP
rs903943359 1217 dbSNP
rs1007630619 1222 dbSNP
rs777664936 1223 dbSNP
rs1485153430 1225 dbSNP
rs906259768 1226 dbSNP
rs541579832 1227 dbSNP
rs1314393060 1229 dbSNP
rs1284320351 1232 dbSNP
rs551550607 1233 dbSNP
rs1223801900 1234 dbSNP
rs771493733 1242 dbSNP
rs1268298138 1247 dbSNP
rs998147903 1248 dbSNP
rs1303446527 1249 dbSNP
rs1467637557 1250 dbSNP
rs1169620018 1254 dbSNP
rs1466122566 1257 dbSNP
rs1425439389 1259 dbSNP
rs1026554753 1262 dbSNP
rs190465975 1267 dbSNP
rs1184041555 1281 dbSNP
rs1233713453 1282 dbSNP
rs573806891 1283 dbSNP
rs1183292880 1286 dbSNP
rs1011227944 1293 dbSNP
rs1231849308 1293 dbSNP
rs1479367319 1293 dbSNP
rs1029033880 1297 dbSNP
rs1260326144 1298 dbSNP
rs1231863881 1304 dbSNP
rs984955765 1320 dbSNP
rs953361472 1331 dbSNP
rs909415761 1334 dbSNP
rs1398050072 1338 dbSNP
rs1371249952 1345 dbSNP
rs1297701385 1361 dbSNP
rs969763793 1363 dbSNP
rs78323632 1376 dbSNP
rs1162456521 1378 dbSNP
rs1460714080 1381 dbSNP
rs962096562 1384 dbSNP
rs1166430230 1393 dbSNP
rs1416986903 1400 dbSNP
rs1162794376 1404 dbSNP
rs1178722387 1406 dbSNP
rs1388452993 1406 dbSNP
rs562665806 1407 dbSNP
rs928268288 1414 dbSNP
rs952361569 1433 dbSNP
rs1212441789 1445 dbSNP
rs1328935697 1451 dbSNP
rs1359853656 1452 dbSNP
rs1488341746 1457 dbSNP
rs1247201821 1459 dbSNP
rs938371998 1460 dbSNP
rs1306294531 1465 dbSNP
rs1240982337 1467 dbSNP
rs1379283636 1468 dbSNP
rs531526464 1478 dbSNP
rs1334876547 1484 dbSNP
rs373447716 1487 dbSNP
rs1440127382 1491 dbSNP
rs1391153965 1492 dbSNP
rs916126882 1500 dbSNP
rs1451095451 1501 dbSNP
rs947344132 1505 dbSNP
rs1158939557 1506 dbSNP
rs1247386159 1506 dbSNP
rs1046019096 1507 dbSNP
rs1392767586 1514 dbSNP
rs1265411052 1516 dbSNP
rs1192286240 1537 dbSNP
rs1354835085 1538 dbSNP
rs544855561 1549 dbSNP
rs1268444012 1550 dbSNP
rs889623356 1552 dbSNP
rs181992032 1553 dbSNP
rs1007560315 1555 dbSNP
rs527290450 1558 dbSNP
rs935057214 1563 dbSNP
rs1039137580 1583 dbSNP
rs547120395 1584 dbSNP
rs1355902117 1587 dbSNP
rs1244764998 1592 dbSNP
rs1233406857 1593 dbSNP
rs1331618719 1602 dbSNP
rs560636604 1603 dbSNP
rs1380302893 1604 dbSNP
rs1026772993 1608 dbSNP
rs1052306649 1611 dbSNP
rs1421193361 1621 dbSNP
rs529763890 1629 dbSNP
rs746219336 1636 dbSNP
rs550128982 1638 dbSNP
rs1016403576 1639 dbSNP
rs970234022 1640 dbSNP
rs979817253 1648 dbSNP
rs1201721115 1651 dbSNP
rs1427104745 1655 dbSNP
rs1010701074 1658 dbSNP
rs1035430790 1660 dbSNP
rs889006469 1668 dbSNP
rs527566417 1673 dbSNP
rs1018937245 1678 dbSNP
rs1199959567 1680 dbSNP
rs1345881721 1683 dbSNP
rs1257688667 1686 dbSNP
rs960081425 1694 dbSNP
rs186330577 1699 dbSNP
rs1401419577 1700 dbSNP
rs28381438 1700 dbSNP
rs1027859179 1704 dbSNP
rs552895496 1706 dbSNP
rs566124314 1707 dbSNP
rs1403804975 1715 dbSNP
rs991640585 1733 dbSNP
rs978650882 1735 dbSNP
rs911031250 1740 dbSNP
rs942523547 1749 dbSNP
rs1478893736 1751 dbSNP
rs1339295202 1755 dbSNP
rs534993747 1761 dbSNP
rs971599560 1775 dbSNP
rs1258411270 1785 dbSNP
rs981767053 1790 dbSNP
rs1317253924 1791 dbSNP
rs761335385 1792 dbSNP
rs1220248851 1794 dbSNP
rs901924529 1801 dbSNP
rs1283231236 1802 dbSNP
rs933436257 1806 dbSNP
rs1251975495 1811 dbSNP
rs914961436 1823 dbSNP
rs1197016852 1824 dbSNP
rs146440814 1825 dbSNP
rs1400215756 1830 dbSNP
rs1172090985 1831 dbSNP
rs1467509607 1833 dbSNP
rs1416202311 1835 dbSNP
rs1162868689 1839 dbSNP
rs1473262317 1845 dbSNP
rs772655979 1846 dbSNP
rs1461933384 1847 dbSNP
rs191917215 1848 dbSNP
rs1253739617 1853 dbSNP
rs889059159 1854 dbSNP
rs944590890 1860 dbSNP
rs1430251328 1861 dbSNP
rs762455069 1868 dbSNP
rs1016541030 1873 dbSNP
rs1200524398 1879 dbSNP
rs1466946892 1883 dbSNP
rs766300327 1890 dbSNP
rs182965603 1891 dbSNP
rs1277192334 1896 dbSNP
rs1476578727 1900 dbSNP
rs1377089293 1908 dbSNP
rs556084648 1910 dbSNP
rs1001682817 1913 dbSNP
rs1348451088 1913 dbSNP
rs754782588 1923 dbSNP
rs377165283 1924 dbSNP
rs988973161 1927 dbSNP
rs767175071 1928 dbSNP
rs1302639485 1939 dbSNP
rs1157105087 1953 dbSNP
rs752557593 1954 dbSNP
rs978619773 1956 dbSNP
rs879124845 1966 dbSNP
rs942659701 1967 dbSNP
rs756232869 1968 dbSNP
rs956581492 1969 dbSNP
rs922437261 1973 dbSNP
rs1285269758 1977 dbSNP
rs1324546816 1986 dbSNP
rs187586511 1994 dbSNP
rs1254053080 1997 dbSNP
rs914992138 2002 dbSNP
rs28381439 2003 dbSNP
rs1242901258 2004 dbSNP
rs946467492 2005 dbSNP
rs1048297634 2008 dbSNP
rs567238436 2010 dbSNP
rs941999212 2012 dbSNP
rs1352047909 2019 dbSNP
rs564818762 2020 dbSNP
rs191587694 2024 dbSNP
rs1419381277 2027 dbSNP
rs1361188371 2030 dbSNP
rs1487259386 2033 dbSNP
rs1201041226 2036 dbSNP
rs767426889 2041 dbSNP
rs1479911786 2045 dbSNP
rs1173453677 2046 dbSNP
rs1191768197 2053 dbSNP
rs757467427 2058 dbSNP
rs1376313804 2069 dbSNP
rs1057265404 2072 dbSNP
rs895974007 2079 dbSNP
rs1488431236 2100 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 11044.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 11044.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 11044.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000230859.6 | 3UTR | CUUAUGAUUUGUGCAAUAACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.768 5.9e-6 0.767 6.1e-6 24 Click to see details
GSE28260 Renal cortex and medulla 0.887 2.6e-5 0.740 1.9e-3 13 Click to see details
GSE32688 Pancreatic cancer -0.359 2.2e-2 -0.445 5.4e-3 32 Click to see details
GSE38226 Liver fibrosis 0.411 3.2e-2 0.380 4.5e-2 21 Click to see details
GSE17306 Multiple myeloma -0.246 4.4e-2 0.298 1.9e-2 49 Click to see details
GSE17498 Multiple myeloma 0.248 6.1e-2 0.234 7.3e-2 40 Click to see details
GSE19350 CNS germ cell tumors 0.444 7.4e-2 0.462 6.5e-2 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.297 1.0e-1 -0.059 4.0e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.103 1.7e-1 -0.128 1.1e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.201 1.7e-1 0.116 2.9e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.171 2.2e-1 -0.134 2.7e-1 23 Click to see details
GSE21687 Ependynoma primary tumors 0.087 2.5e-1 -0.274 1.4e-2 64 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.269 3.3e-1 0.200 3.7e-1 5 Click to see details
GSE26953 Aortic valvular endothelial cells 0.093 3.3e-1 0.248 1.2e-1 24 Click to see details
GSE21849 B cell lymphoma 0.031 4.4e-1 0.479 4.3e-3 29 Click to see details
GSE27834 Pluripotent stem cells -0.011 4.8e-1 -0.009 4.9e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.011 4.8e-1 -0.009 4.9e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission