pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4464 |
Genomic Coordinates | chr6: 90312742 - 90312833 |
Description | Homo sapiens miR-4464 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4464 | |||||||||||||||||||||||||||||||||||
Sequence | 12| AAGGUUUGGAUAGAUGCAAUA |32 | |||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FOXC1 | ||||||||||||||||||||
Synonyms | ARA, ASGD3, FKHL7, FREAC-3, FREAC3, IGDA, IHG1, IRID1, RIEG3 | ||||||||||||||||||||
Description | forkhead box C1 | ||||||||||||||||||||
Transcript | NM_001453 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FOXC1 | |||||||||||||||||||||
3'UTR of FOXC1 (miRNA target sites are highlighted) |
>FOXC1|NM_001453|3'UTR 1 CACACCCTCAAAGCCGAACTAAATCGAACCCCAAAGCAGGAAAAGCTAAAGGAACCCATCAAGGCAAAATCGAAACTAAA 81 AAAAAAAAATCCAATTAAAAAAAACCCCTGAGAATATTCACCACACCAGCGAACAGAATATCCCTCCAAAAATTCAGCTC 161 ACCAGCACCAGCACGAAGAAAACTCTATTTTCTTAACCGATTAATTCAGAGCCACCTCCACTTTGCCTTGTCTAAATAAA 241 CAAACCCGTAAACTGTTTTATACAGAGACAGCAAAATCTTGGTTTATTAAAGGACAGTGTTACTCCAGATAACACGTAAG 321 TTTCTTCTTGCTTTTCAGAGACCTGCTTTCCCCTCCTCCCGTCTCCCCTCTCTTGCCTTCTTCCTTGCCTCTCACCTGTA 401 AGATATTATTTTATCCTATGTTGAAGGGAGGGGGAAAGTCCCCGTTTATGAAAGTCGCTTTCTTTTTATTCATGGACTTG 481 TTTTAAAATGTAAATTGCAACATAGTAATTTATTTTTAATTTGTAGTTGGATGTCGTGGACCAAACGCCAGAAAGTGTTC 561 CCAAAACCTGACGTTAAATTGCCTGAAACTTTAAATTGTGCTTTTTTTCTCATTATAAAAAGGGAAACTGTATTAATCTT 641 ATTCTATCCTCTTTTCTTTCTTTTTGTTGAACATATTCATTGTTTGTTTATTAATAAATTACCATTCAGTTTGAATGAGA 721 CCTATATGTCTGGATACTTTAATAGAGCTTTAATTATTACGAAAAAAGATTTCAGAGATAAAACACTAGAAGTTACCTAT 801 TCTCCACCTAAATCTCTGAAAAATGGAGAAACCCTCTGACTAGTCCATGTCAAATTTTACTAAAAGTCTTTTTGTTTAGA 881 TTTATTTTCCTGCAGCATCTTCTGCAAAATGTACTATATAGTCAGCTTGCTTTGAGGCTAGTAAAAAGATATTTTTCTAA 961 ACAGATTGGAGTTGGCATATAAACAAATACGTTTTCTCACTAATGACAGTCCATGATTCGGAAATTTTAAGCCCATGAAT 1041 CAGCCGCGGTCTTACCACGGTGATGCCTGTGTGCCGAGAGATGGGACTGTGCGGCCAGATATGCACAGATAAATATTTGG 1121 CTTGTGTATTCCATATAAAATTGCAGTGCATATTATACATCCCTGTGAGCCAGATGCTGAATAGATATTTTCCTATTATT 1201 TCAGTCCTTTATAAAAGGAAAAATAAACCAGTTTTTAAATGTATGTATATAATTCTCCCCCATTTACAATCCTTCATGTA 1281 TTACATAGAAGGATTGCTTTTTTAAAAATATACTGCGGGTTGGAAAGGGATATTTAATCTTTGAGAAACTATTTTAGAAA 1361 ATATGTTTGTAGAACAATTATTTTTGAAAAAGATTTAAAGCAATAACAAGAAGGAAGGCGAGAGGAGCAGAACATTTTGG 1441 TCTAGGGTGGTTTCTTTTTAAACCATTTTTTCTTGTTAATTTACAGTTAAACCTAGGGGACAATCCGGATTGGCCCTCCC 1521 CCTTTTGTAAATAACCCAGGAAATGTAATAAATTCATTATCTTAGGGTGATCTGCCCTGCCAATCAGACTTTGGGGAGAT 1601 GGCGATTTGATTACAGACGTTCGGGGGGGTGGGGGGCTTGCAGTTTGTTTTGGAGATAATACAGTTTCCTGCTATCTGCC 1681 GCTCCTATCTAGAGGCAACACTTAAGCAGTAATTGCTGTTGCTTGTTGTCAAAATTTGATCATTGTTAAAGGATTGCTGC 1761 AAATAAATACACTTTAATTTCAGTCAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 2296.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000380874.2 | 3UTR | UUAAACCUAGGGGACAAUCCGGAUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000380874.2 | 3UTR | UUAAACCUAGGGGACAAUCCGGAUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000380874.2 | 3UTR | UUAAUUUACAGUUAAACCUAGGGGACAAUCCGGAUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000380874.2 | 3UTR | UUAAACCUAGGGGACAAUCCGGAUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000380874.2 | 3UTR | UAAUUUACAGUUAAACCUAGGGGACAAUCCGGAUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
81 hsa-miR-4464 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT056004 | ARL5B | ADP ribosylation factor like GTPase 5B | 2 | 2 | ||||||||
MIRT061568 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT078651 | ICT1 | mitochondrial ribosomal protein L58 | 2 | 2 | ||||||||
MIRT087551 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | 2 | 4 | ||||||||
MIRT088139 | SEPT2 | septin 2 | 2 | 4 | ||||||||
MIRT095089 | SEC24A | SEC24 homolog A, COPII coat complex component | 2 | 4 | ||||||||
MIRT099065 | FOXC1 | forkhead box C1 | 2 | 4 | ||||||||
MIRT150194 | MIDN | midnolin | 2 | 2 | ||||||||
MIRT178173 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | 2 | 4 | ||||||||
MIRT178942 | C11ORF57 | chromosome 11 open reading frame 57 | 2 | 2 | ||||||||
MIRT188776 | SESN2 | sestrin 2 | 2 | 2 | ||||||||
MIRT267026 | EFHD2 | EF-hand domain family member D2 | 2 | 2 | ||||||||
MIRT307213 | ACVR2B | activin A receptor type 2B | 2 | 2 | ||||||||
MIRT324750 | ACER2 | alkaline ceramidase 2 | 2 | 2 | ||||||||
MIRT442732 | TEAD1 | TEA domain transcription factor 1 | 2 | 2 | ||||||||
MIRT444087 | C12orf73 | chromosome 12 open reading frame 73 | 2 | 2 | ||||||||
MIRT445527 | KLF9 | Kruppel like factor 9 | 2 | 2 | ||||||||
MIRT449604 | INIP | INTS3 and NABP interacting protein | 2 | 2 | ||||||||
MIRT451129 | ZNF99 | zinc finger protein 99 | 2 | 2 | ||||||||
MIRT452271 | RPL30 | ribosomal protein L30 | 2 | 2 | ||||||||
MIRT452486 | DDX4 | DEAD-box helicase 4 | 2 | 2 | ||||||||
MIRT454868 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | 2 | 6 | ||||||||
MIRT455773 | TSPAN6 | tetraspanin 6 | 2 | 4 | ||||||||
MIRT463844 | WRN | Werner syndrome RecQ like helicase | 2 | 2 | ||||||||
MIRT465036 | TTC39C | tetratricopeptide repeat domain 39C | 2 | 2 | ||||||||
MIRT465176 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | 2 | 4 | ||||||||
MIRT465294 | TRIB3 | tribbles pseudokinase 3 | 2 | 4 | ||||||||
MIRT467931 | SLC16A7 | solute carrier family 16 member 7 | 2 | 2 | ||||||||
MIRT471906 | NUAK2 | NUAK family kinase 2 | 2 | 2 | ||||||||
MIRT472724 | MTUS1 | microtubule associated scaffold protein 1 | 2 | 6 | ||||||||
MIRT479785 | CCND1 | cyclin D1 | 2 | 2 | ||||||||
MIRT482446 | ADM | adrenomedullin | 2 | 10 | ||||||||
MIRT485365 | MYLIP | myosin regulatory light chain interacting protein | 2 | 12 | ||||||||
MIRT498399 | KIF6 | kinesin family member 6 | 2 | 2 | ||||||||
MIRT503202 | ACTB | actin beta | 2 | 6 | ||||||||
MIRT503819 | TMEM242 | transmembrane protein 242 | 2 | 2 | ||||||||
MIRT504706 | ZNF117 | zinc finger protein 117 | 2 | 2 | ||||||||
MIRT507802 | CDKN1B | cyclin dependent kinase inhibitor 1B | 2 | 2 | ||||||||
MIRT509968 | KANSL1L | KAT8 regulatory NSL complex subunit 1 like | 2 | 4 | ||||||||
MIRT517306 | ELF4 | E74 like ETS transcription factor 4 | 2 | 6 | ||||||||
MIRT523900 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | 2 | 6 | ||||||||
MIRT532018 | NOX5 | NADPH oxidase 5 | 2 | 2 | ||||||||
MIRT535334 | PHACTR2 | phosphatase and actin regulator 2 | 2 | 2 | ||||||||
MIRT536944 | HCN4 | hyperpolarization activated cyclic nucleotide gated potassium channel 4 | 2 | 4 | ||||||||
MIRT539322 | AHSA2 | activator of HSP90 ATPase homolog 2 | 2 | 2 | ||||||||
MIRT540189 | GSTM4 | glutathione S-transferase mu 4 | 2 | 2 | ||||||||
MIRT545015 | ZNF439 | zinc finger protein 439 | 2 | 2 | ||||||||
MIRT545265 | TRIM36 | tripartite motif containing 36 | 2 | 4 | ||||||||
MIRT547230 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | 2 | 4 | ||||||||
MIRT548425 | ELOVL5 | ELOVL fatty acid elongase 5 | 2 | 2 | ||||||||
MIRT549910 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | 2 | 2 | ||||||||
MIRT550185 | TMEM106C | transmembrane protein 106C | 2 | 2 | ||||||||
MIRT550775 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | 2 | 4 | ||||||||
MIRT552401 | ZNF487P | zinc finger protein 487 | 1 | 1 | ||||||||
MIRT554782 | RHEBP1 | RHEB pseudogene 1 | 2 | 4 | ||||||||
MIRT557311 | HIF1A | hypoxia inducible factor 1 alpha subunit | 2 | 2 | ||||||||
MIRT558635 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | 2 | 2 | ||||||||
MIRT563168 | RPS14 | ribosomal protein S14 | 2 | 2 | ||||||||
MIRT564886 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | 2 | 2 | ||||||||
MIRT565778 | SEPHS1 | selenophosphate synthetase 1 | 2 | 2 | ||||||||
MIRT566480 | PDCD4 | programmed cell death 4 | 2 | 2 | ||||||||
MIRT567206 | IGFBP5 | insulin like growth factor binding protein 5 | 2 | 2 | ||||||||
MIRT568931 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | 2 | 2 | ||||||||
MIRT570698 | FBXO41 | F-box protein 41 | 2 | 2 | ||||||||
MIRT573474 | MTRNR2L9 | MT-RNR2-like 9 | 2 | 2 | ||||||||
MIRT576170 | Hmox1 | heme oxygenase 1 | 2 | 2 | ||||||||
MIRT607555 | GLI2 | GLI family zinc finger 2 | 2 | 2 | ||||||||
MIRT608203 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT609779 | VWC2L | von Willebrand factor C domain containing protein 2 like | 2 | 4 | ||||||||
MIRT616312 | CELF2 | CUGBP Elav-like family member 2 | 2 | 2 | ||||||||
MIRT617190 | CDH13 | cadherin 13 | 2 | 2 | ||||||||
MIRT626842 | RPLP1 | ribosomal protein lateral stalk subunit P1 | 2 | 2 | ||||||||
MIRT636438 | MARCH1 | membrane associated ring-CH-type finger 1 | 2 | 2 | ||||||||
MIRT639101 | GLIPR1L2 | GLI pathogenesis related 1 like 2 | 2 | 2 | ||||||||
MIRT691018 | CRTC3 | CREB regulated transcription coactivator 3 | 2 | 2 | ||||||||
MIRT700008 | RPS21 | ribosomal protein S21 | 2 | 2 | ||||||||
MIRT701144 | PANK1 | pantothenate kinase 1 | 2 | 2 | ||||||||
MIRT712691 | NUDT7 | nudix hydrolase 7 | 2 | 2 | ||||||||
MIRT715505 | MAZ | MYC associated zinc finger protein | 2 | 2 | ||||||||
MIRT722509 | PTPRC | protein tyrosine phosphatase, receptor type C | 2 | 2 | ||||||||
MIRT724982 | TNS1 | tensin 1 | 2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|