>MYLIP|NM_013262|3'UTR
   1 TCTGTTGTGCTTTTGTTGGACTTGGCATGTTTCCATGAACTGCACTATTATAAACTATTAAAATGATAGATTGTGGAGAA
  81 AGTAATTATTCCAACACCCATCTGCCATGCGATGTTAAAAAAAAAAAAAAGGAAGAAAAATAACACAGCTACTCCTCACT
 161 GCAAAAACATATCCATGCGTAGAATCAACAACTCCAGTCATGGGACCAGGAGGAGCTCTGGGACGCAGACACATTCCTTG
 241 GATGTTGATTTTTTTTATGATCTAGTAAAGGAATAGGTAAAGTCTTTGATGTCAGTGAAGTGGCAACATAGCCAAAAAGT
 321 TGGGTACCTTTTAGGAAATGATGTTGTAAGTCTCCTTAATGTATCCTGAGGTAAGTTTCCTACTGGCAGCAGATTTTGTA
 401 AGAATTACTTTTAAGAATTTCATTCTTTTTGTATGGTCATGGAGCTCCAACCATTTTTAATAGGAAAGTCTTTTGTAAAT
 481 TGTTGTCGTTTTAATGTCATTTCTGTCTTTATAACTTGATCAAGAATGATTGGAAGGCAAACAGGTTTACAAATCAATTC
 561 TGTGACTTTTAAAAAGTTGACAATGTTGTCAGATTTAAACCAGTGTGGCTAGTAAAAAGCAGCTCACTCAATGTGGGTGG
 641 CTCCCTATTCCTTTACGCTCCCCCTATCCCTACCCCACAAGCCTTTCGATTATAAAATACTACCAATCTTGTTATAAGAT
 721 TACTGTGGAGTAGTCAAGTACTCCCCGGGCCTTCTGAGCTGGTGGAATATTTTATTTCAGACTGAAAACAGAGAGCACTC
 801 TCCTTGGGAAGGGAAAGCGGAGCTTGCTGAGTGAGAGATGGAGCCTCATGGTGTACAACTGAGGGTAGTTAACTCATCAC
 881 TTCTCCCAAGCACTCGATCCCAGCTTCACCCACTGGTGTTGCTTTGCTTGAACTGTTCAAGCCTTTTATAGCCTTACCAT
 961 AAGTATTTAGATATGGTGTCCTTTTCTGTTTTTGGGGGGGGAGTTTTGTTGTGTTTTTTTAAAGTAAGTGCTTAAGTATT
1041 AACTTTGGGTTGTCCCCTCTGTATGTTTCGAAGGGGTTTTGGTTCTTTTTGCTTCTGTTTTCTTAAACATGTTTTCCACT
1121 CCCACTTGGGCATTTTGGAAGCTGGTCAGCTAGCAGGTTTTCTGGGATGTCGGGAGACCTAGATGACCTTATCGGGTGCA
1201 ATACTAGCTAAGGTAAAGCTAGAAACCTACACTGTCACTTTACTGAGATTTCTGAGTATACTTTTCATATTGCCTTAATG
1281 TAGCAGTAATGTGTTTATGCATTTGTTTCTTTGCACAGACATTTTGTCAAATATTAAAACTCTACTTTTTTATGGCACAT
1361 ATTAGCATATAAGCCTTTATTCCAAGAGGTATTTATTTTTTCACTTGTAAAAAAATAATGTTTCCACGTAAAGAACTCTG
1441 TTATATCCTAGAGGACTCTGTCTTTTATATTCGGGATAATAAAGACTTTAAAGCAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgagaCGAGUCUU--GAUGUGAg 5' ||| |||| ||||||| Target 5' gtaaaGCT-AGAAACCTACACTg 3'	1213 - 1234	157.00	-11.90
2	miRNA 3' cgagACGA--GU-CUUGAUGUGAg 5' ||:| || |||||:|||| Target 5' ggcaTGTTTCCATGAACTGCACTa 3'	24 - 47	147.00	-15.40
3	miRNA 3' cgaGACGAGUCUUGAUGUGAg 5' || :|| :|||:|| Target 5' tccCTATTC--CTTTACGCTc 3'	642 - 660	110.00	-11.40

Mutant ID	Mutant Position	Mutant Source
COSN30113693	14	COSMIC
COSN31563092	22	COSMIC
COSN31523055	43	COSMIC
COSN30512138	49	COSMIC
COSN30166050	58	COSMIC
COSN30146209	70	COSMIC
COSN31539046	111	COSMIC
COSN31602903	112	COSMIC
COSN20102424	131	COSMIC
COSN20102426	131	COSMIC
COSN30129649	180	COSMIC
COSN20349307	368	COSMIC
COSN15191689	436	COSMIC
COSN31544709	466	COSMIC
COSN19662085	468	COSMIC
COSN31590404	488	COSMIC
COSN31565653	489	COSMIC
COSN31522643	511	COSMIC
COSN31548663	561	COSMIC
COSN9499970	897	COSMIC
COSN19253327	917	COSMIC
COSN31601261	995	COSMIC
COSN31596181	1180	COSMIC
COSN28675391	1195	COSMIC
COSN17038374	1328	COSMIC
COSN32192380	1408	COSMIC
COSN31483830	1415	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs776689547	1	dbSNP
rs1457944644	2	dbSNP
rs1054780271	5	dbSNP
rs1159681409	10	dbSNP
rs759813677	11	dbSNP
rs1454578773	14	dbSNP
rs1434284007	27	dbSNP
rs765421858	28	dbSNP
rs1367697363	43	dbSNP
rs1461758801	46	dbSNP
rs1390270492	52	dbSNP
rs1191730647	58	dbSNP
rs942278072	60	dbSNP
rs1453719701	66	dbSNP
rs1242565128	83	dbSNP
rs1216617152	86	dbSNP
rs1031417074	90	dbSNP
rs1282472822	93	dbSNP
rs560855721	98	dbSNP
rs1349128736	104	dbSNP
rs749813948	107	dbSNP
rs898002067	111	dbSNP
rs993659242	112	dbSNP
rs1193304819	117	dbSNP
rs1240419433	117	dbSNP
rs1317258148	117	dbSNP
rs35112615	117	dbSNP
rs1473483675	120	dbSNP
rs397971095	131	dbSNP
rs74708826	131	dbSNP
rs1159806562	132	dbSNP
rs62387664	133	dbSNP
rs574429000	135	dbSNP
rs199922789	136	dbSNP
rs1209199762	137	dbSNP
rs946485551	142	dbSNP
rs1274368688	146	dbSNP
rs1455881710	151	dbSNP
rs1164518688	152	dbSNP
rs1336947915	159	dbSNP
rs1277013839	163	dbSNP
rs1356990255	165	dbSNP
rs1310656837	170	dbSNP
rs185042496	173	dbSNP
rs1354877456	174	dbSNP
rs768976573	179	dbSNP
rs1418626286	180	dbSNP
rs1047509756	189	dbSNP
rs562970331	190	dbSNP
rs1259906998	192	dbSNP
rs941666461	194	dbSNP
rs1483154700	201	dbSNP
rs766943039	202	dbSNP
rs1037792015	203	dbSNP
rs1306272430	205	dbSNP
rs1257912756	206	dbSNP
rs1305853538	207	dbSNP
rs1336257418	212	dbSNP
rs777308311	214	dbSNP
rs113117363	221	dbSNP
rs377395123	225	dbSNP
rs989406611	226	dbSNP
rs765678974	234	dbSNP
rs1289455896	245	dbSNP
rs142596337	249	dbSNP
rs1020857954	253	dbSNP
rs1000009635	258	dbSNP
rs966958113	261	dbSNP
rs1267263631	269	dbSNP
rs981952442	277	dbSNP
rs1031047869	279	dbSNP
rs1163022786	283	dbSNP
rs1408905028	285	dbSNP
rs1423459539	285	dbSNP
rs1179334711	294	dbSNP
rs927724876	301	dbSNP
rs937772850	304	dbSNP
rs1483874694	309	dbSNP
rs990480203	313	dbSNP
rs1024067929	314	dbSNP
rs969931642	317	dbSNP
rs1270722127	325	dbSNP
rs565448190	334	dbSNP
rs1317153042	347	dbSNP
rs940992448	349	dbSNP
rs1308630012	352	dbSNP
rs1037936937	362	dbSNP
rs980029490	366	dbSNP
rs2072781	368	dbSNP
rs1256659930	370	dbSNP
rs959834599	379	dbSNP
rs1310018641	385	dbSNP
rs1422020798	399	dbSNP
rs1396871329	402	dbSNP
rs1291866091	404	dbSNP
rs1457422154	406	dbSNP
rs1346036413	412	dbSNP
rs929493905	423	dbSNP
rs983693209	426	dbSNP
rs907594302	430	dbSNP
rs1380062047	432	dbSNP
rs941789178	435	dbSNP
rs1051921207	440	dbSNP
rs1189586757	442	dbSNP
rs921619750	444	dbSNP
rs932218234	448	dbSNP
rs1213189085	449	dbSNP
rs890578122	451	dbSNP
rs1007636368	454	dbSNP
rs1280781138	455	dbSNP
rs1039104831	459	dbSNP
rs893828277	465	dbSNP
rs1372030689	466	dbSNP
rs559126255	470	dbSNP
rs1020910143	474	dbSNP
rs966632666	476	dbSNP
rs1290914624	480	dbSNP
rs1003824884	488	dbSNP
rs1460095863	489	dbSNP
rs1394773655	492	dbSNP
rs1034851609	495	dbSNP
rs893860706	496	dbSNP
rs1376460056	497	dbSNP
rs1198735047	499	dbSNP
rs1011435750	504	dbSNP
rs959432549	509	dbSNP
rs1023590083	523	dbSNP
rs548070767	532	dbSNP
rs1206192429	535	dbSNP
rs969396171	543	dbSNP
rs1003508032	544	dbSNP
rs1035532103	544	dbSNP
rs1257710998	546	dbSNP
rs373942444	548	dbSNP
rs909612729	551	dbSNP
rs1205561246	553	dbSNP
rs962366977	565	dbSNP
rs536993573	571	dbSNP
rs972360369	574	dbSNP
rs919526620	579	dbSNP
rs929573603	582	dbSNP
rs577343919	584	dbSNP
rs1482182029	585	dbSNP
rs1313668073	589	dbSNP
rs907731996	604	dbSNP
rs912074429	608	dbSNP
rs1172570136	609	dbSNP
rs1197282678	616	dbSNP
rs541236307	617	dbSNP
rs1039148601	622	dbSNP
rs548107375	626	dbSNP
rs144304196	628	dbSNP
rs181113039	630	dbSNP
rs558807326	631	dbSNP
rs987137722	635	dbSNP
rs1255211280	638	dbSNP
rs912124443	641	dbSNP
rs1481581935	645	dbSNP
rs1172675667	646	dbSNP
rs935594779	657	dbSNP
rs1464916196	658	dbSNP
rs1003469201	662	dbSNP
rs1035309443	663	dbSNP
rs574992262	665	dbSNP
rs1339150951	668	dbSNP
rs894005507	669	dbSNP
rs1392272273	674	dbSNP
rs1399289648	675	dbSNP
rs946814698	676	dbSNP
rs959253162	677	dbSNP
rs1367493328	682	dbSNP
rs1166731010	683	dbSNP
rs1471608139	684	dbSNP
rs79714658	688	dbSNP
rs1016669379	689	dbSNP
rs1420610937	691	dbSNP
rs1300920040	695	dbSNP
rs1310217564	712	dbSNP
rs1236323503	716	dbSNP
rs962418523	730	dbSNP
rs749881130	739	dbSNP
rs534506054	747	dbSNP
rs755646615	748	dbSNP
rs546539224	751	dbSNP
rs1249318245	752	dbSNP
rs1240249991	759	dbSNP
rs1005233601	770	dbSNP
rs1307780588	780	dbSNP
rs1014756341	790	dbSNP
rs1464999496	790	dbSNP
rs377668250	795	dbSNP
rs1395772146	809	dbSNP
rs1327345358	811	dbSNP
rs554388488	819	dbSNP
rs943543905	820	dbSNP
rs1192610425	840	dbSNP
rs1389602345	843	dbSNP
rs1039201147	844	dbSNP
rs1422626000	854	dbSNP
rs1455195576	858	dbSNP
rs114004922	859	dbSNP
rs1178019478	870	dbSNP
rs73724995	872	dbSNP
rs1028705704	874	dbSNP
rs534963815	876	dbSNP
rs866079863	886	dbSNP
rs1457148652	887	dbSNP
rs1449899254	892	dbSNP
rs556503375	896	dbSNP
rs987105237	897	dbSNP
rs1284327928	899	dbSNP
rs911588626	903	dbSNP
rs1372387236	914	dbSNP
rs1293097819	916	dbSNP
rs935577778	917	dbSNP
rs988834094	920	dbSNP
rs1329977027	942	dbSNP
rs902514617	944	dbSNP
rs1402078081	949	dbSNP
rs1423506817	952	dbSNP
rs1358166386	974	dbSNP
rs749288448	975	dbSNP
rs557964319	976	dbSNP
rs1396849453	978	dbSNP
rs1170711388	980	dbSNP
rs905260103	989	dbSNP
rs77893654	993	dbSNP
rs148485764	994	dbSNP
rs1489401674	994	dbSNP
rs371043452	994	dbSNP
rs1328276711	995	dbSNP
rs185701087	996	dbSNP
rs531245511	997	dbSNP
rs1270280227	1000	dbSNP
rs1329158261	1002	dbSNP
rs545836670	1003	dbSNP
rs1337995697	1007	dbSNP
rs1297161022	1009	dbSNP
rs1016721739	1010	dbSNP
rs1220202668	1011	dbSNP
rs1377028368	1012	dbSNP
rs1244570383	1014	dbSNP
rs1332181008	1014	dbSNP
rs898286624	1018	dbSNP
rs1413836740	1024	dbSNP
rs1420069989	1025	dbSNP
rs1168591687	1034	dbSNP
rs1478819557	1047	dbSNP
rs1421808394	1048	dbSNP
rs993887530	1070	dbSNP
rs1489275242	1071	dbSNP
rs2205795	1077	dbSNP
rs1270023921	1083	dbSNP
rs1274270476	1087	dbSNP
rs955087187	1089	dbSNP
rs986856254	1096	dbSNP
rs899082493	1121	dbSNP
rs994649206	1133	dbSNP
rs1381161667	1134	dbSNP
rs1019214334	1140	dbSNP
rs557046125	1145	dbSNP
rs974939887	1154	dbSNP
rs772360325	1156	dbSNP
rs1398183245	1157	dbSNP
rs541642474	1171	dbSNP
rs564667989	1172	dbSNP
rs116634947	1173	dbSNP
rs1180504914	1179	dbSNP
rs1294397025	1180	dbSNP
rs12202423	1183	dbSNP
rs141980944	1186	dbSNP
rs532257839	1187	dbSNP
rs1407767061	1192	dbSNP
rs1256864604	1194	dbSNP
rs2205794	1195	dbSNP
rs956540628	1200	dbSNP
rs1227571960	1201	dbSNP
rs1373759421	1209	dbSNP
rs1311440583	1211	dbSNP
rs747045166	1214	dbSNP
rs146292820	1222	dbSNP
rs771174727	1226	dbSNP
rs565878028	1233	dbSNP
rs190419186	1234	dbSNP
rs1038218992	1245	dbSNP
rs1162913633	1246	dbSNP
rs980894265	1253	dbSNP
rs898339114	1261	dbSNP
rs1181131435	1268	dbSNP
rs1438391033	1270	dbSNP
rs994385360	1272	dbSNP
rs1193750518	1279	dbSNP
rs1025419359	1280	dbSNP
rs890849790	1287	dbSNP
rs926818954	1296	dbSNP
rs939436791	1299	dbSNP
rs1220353714	1301	dbSNP
rs1317362455	1310	dbSNP
rs1287092594	1313	dbSNP
rs1056505658	1326	dbSNP
rs1007931252	1343	dbSNP
rs568930709	1346	dbSNP
rs776978370	1347	dbSNP
rs1387471044	1354	dbSNP
rs1369797136	1359	dbSNP
rs1292063451	1367	dbSNP
rs368658363	1370	dbSNP
rs1221830448	1374	dbSNP
rs534817839	1376	dbSNP
rs11552211	1381	dbSNP
rs974993710	1390	dbSNP
rs112375157	1405	dbSNP
rs899049417	1409	dbSNP
rs994784165	1409	dbSNP
rs1050232704	1416	dbSNP
rs1434456992	1416	dbSNP
rs113232913	1420	dbSNP
rs567929267	1428	dbSNP
rs924073702	1429	dbSNP
rs1485996937	1433	dbSNP
rs144460760	1441	dbSNP
rs992206767	1449	dbSNP
rs1214223019	1451	dbSNP
rs916591025	1457	dbSNP
rs1019072169	1470	dbSNP
rs956501626	1473	dbSNP
rs948018857	1474	dbSNP
rs1218664712	1488	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.