>ABT1|NM_013375|3'UTR
   1 GGGCCTGGGTGGCCCCTTCCATTTCCTGGCCCTGCTCTGCTTCCTGTCTACCTCATACTAGAATGATCGTGACTACCCGG
  81 GCAGACATTTTACTGTGTTTCTCAGACCAAGTGTCTACTGATGGCCCAAACATGGAGTTTTGTGGGCTTCCACTGTCCCC
 161 ACTCCGAACTCCTGTATGTGCCTGGCTGAGTCACCTAATTCATACTGTCATACTAGCATAATTATGACTATTGCATATGC
 241 TTGTTTTGTTTGACTCTTGGCTGCCTACGTCTGTAGGGTCCCCTGAAAATCCCACTTCCTGCCCCCAGAAAGGGCCTTTA
 321 TTTCCAACTAGGAGGATAATGCCTAGTCCAGGCAATCTTTCTCTGTTTAGCAGTCACAGGTGAGGGTGGTATTAGCATCT
 401 TTTTTATGTAGAAAAAATTGAGTTAATGGGGTGGACTGGGTTGGGAAGAAATACATTTCCTAATGTATTTATAGAAAATA
 481 AAAATATTTTTATGTGCCTTTTTATTTTTGTTGGTGGGGAGGTCATTGGACAAGTTCCAACTTTCATCTTGTGTTCCCTT
 561 CACCTTCATATCCTGATCTTAGAGCCCCCCTCCCCCTGCCACCCACCTTACTGTTTAACCTGGATTTTTTTTTCTATTTA
 641 ATTTTTGTCTAATATCTTAGCCCAGTTTATCAATCAGTTATCTTAAGTCAGCATTTTCTAAGCCATTGTTTGAGGAAACA
 721 GTGACAATAGGTAATAACACATCTTAGTATTAAGAGTTTTACAGGCCACTAGTATAAGATAGGCATCGTGGTAGATGCAT
 801 ATAAAGGGTGGAATGGGAGCCATGGCAGGTCATAGAGTCCTCTCAATGGGAACCTGATTGATGATCACAGTCTTCAGTGG
 881 TGAGTCAGTCCTCACCAAGTTTTCCAGATCATTCCTACAAAGTAAACTGGGAGAATAATAAGTCTGAAAGAGTGTGGAGT
 961 GCTCCCACAATTACAAAGAATGCTTCCTGGGTGGAGTGTTGAGTTGGAACCATTGTAAAGGTGGGCAAAGCCTAGTAGAG
1041 AACCAGTGCACCTCAGGTGCACTTACATATGGTGGGGCTGAGGCAAAGCAGCCCTGTAGGCTTCAAAGAATCAGTGTAAG
1121 CCACTAAAAGGAACTGAAAACCTAGGTGTCACAATAAACAGTCTACACAGTCTCACGTAGACCAAAATTCTGATCATTTT
1201 CCAGGCTGTTGCATGAAGTGATAGAGTATGATTATAATTTCTGTTTGCTTGTGCTGTTTGTTTTTGTTTTTCATCTGTCA
1281 ATGTGATGATCTGTGTTTTATAGGGTAGAGTGGATTTGTCTACTTTGGCTGTAAAATACCCTAATCACATTATGATCTTG
1361 ACAGGTGCACTTTACTGGGGAGAATAAAAAGGACCATACGGTAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ggAUGCAAGGUAUCAGAUGGu 5' |:| |||| | ||||||| Target 5' tcTGC-TTCC-T-GTCTACCt 3'	36 - 53	152.00	-18.60
2	miRNA 3' ggAUGCAA-------GGUAU-CAGAUGGu 5' |::||| ||| : ||||||: Target 5' acTGTGTTTCTCAGACCAAGTGTCTACTg 3'	92 - 120	131.00	-14.24
3	miRNA 3' ggaUGCAAGGUAUCAGAUGgu 5' || | | ||||||| Target 5' gtcACAATAAACAGTCTACac 3'	1148 - 1168	130.00	-8.60

Mutant ID	Mutant Position	Mutant Source
COSN30509338	12	COSMIC
COSN30181703	45	COSMIC
COSN31612421	70	COSMIC
COSN16052739	81	COSMIC
COSN31511344	106	COSMIC
COSN2157913	121	COSMIC
COSN17038394	257	COSMIC
COSN29760004	634	COSMIC
COSN24955289	894	COSMIC
COSN17213110	905	COSMIC
COSN19078282	1636	COSMIC
COSN28324463	2044	COSMIC
rs45527431	637	GWAS

Mutant ID	Mutant Position	Mutant Source
rs782597707	1	dbSNP
rs782219372	3	dbSNP
rs782367374	9	dbSNP
rs1374471119	11	dbSNP
rs781943753	13	dbSNP
rs782640242	14	dbSNP
rs1415022785	15	dbSNP
rs782273176	16	dbSNP
rs782818204	22	dbSNP
rs751550122	26	dbSNP
rs1170842854	28	dbSNP
rs782207883	37	dbSNP
rs563612129	38	dbSNP
rs370138971	47	dbSNP
rs1013441137	51	dbSNP
rs757553823	57	dbSNP
rs1438203874	68	dbSNP
rs1245406378	70	dbSNP
rs1188814626	74	dbSNP
rs1023437077	77	dbSNP
rs7773587	78	dbSNP
rs1277149684	79	dbSNP
rs1198176268	86	dbSNP
rs969717843	87	dbSNP
rs1352228461	88	dbSNP
rs186218450	97	dbSNP
rs1032461635	100	dbSNP
rs1351208512	109	dbSNP
rs562987068	122	dbSNP
rs1316840696	130	dbSNP
rs1339745093	133	dbSNP
rs1332120502	134	dbSNP
rs1383988127	166	dbSNP
rs1361311884	167	dbSNP
rs1158247329	168	dbSNP
rs13978	171	dbSNP
rs1387353091	174	dbSNP
rs1164151758	198	dbSNP
rs541955319	211	dbSNP
rs1236166394	224	dbSNP
rs1196039145	226	dbSNP
rs1488977467	227	dbSNP
rs1263335807	229	dbSNP
rs987875642	236	dbSNP
rs923043058	238	dbSNP
rs561718545	253	dbSNP
rs1293507454	261	dbSNP
rs954433446	267	dbSNP
rs1228607416	269	dbSNP
rs1355462610	270	dbSNP
rs1229580666	280	dbSNP
rs1341174657	282	dbSNP
rs1297610494	289	dbSNP
rs1398256544	291	dbSNP
rs13227	292	dbSNP
rs1367623539	296	dbSNP
rs1324464831	299	dbSNP
rs986272729	303	dbSNP
rs1405140959	307	dbSNP
rs1412152989	314	dbSNP
rs1170127082	317	dbSNP
rs1478458720	317	dbSNP
rs1423567103	318	dbSNP
rs1192228378	325	dbSNP
rs1487024591	329	dbSNP
rs1248089613	333	dbSNP
rs527681003	347	dbSNP
rs750673356	353	dbSNP
rs546449352	355	dbSNP
rs529249489	356	dbSNP
rs189939133	358	dbSNP
rs1450794878	359	dbSNP
rs73739030	360	dbSNP
rs552324058	364	dbSNP
rs919277896	369	dbSNP
rs1277508416	371	dbSNP
rs1216806751	378	dbSNP
rs1347543451	383	dbSNP
rs1275647998	387	dbSNP
rs1436090550	390	dbSNP
rs368622746	400	dbSNP
rs1331249295	403	dbSNP
rs1466482087	409	dbSNP
rs1400121259	410	dbSNP
rs1169246772	411	dbSNP
rs929271395	416	dbSNP
rs568989334	432	dbSNP
rs1191380679	434	dbSNP
rs1057130031	444	dbSNP
rs895914694	453	dbSNP
rs1477467614	456	dbSNP
rs369983822	461	dbSNP
rs1012971126	463	dbSNP
rs1458050412	475	dbSNP
rs1045302585	485	dbSNP
rs1196734475	486	dbSNP
rs1314006244	497	dbSNP
rs1218754556	499	dbSNP
rs905022628	499	dbSNP
rs1365681724	501	dbSNP
rs1281492090	512	dbSNP
rs781842144	515	dbSNP
rs1376696934	518	dbSNP
rs1329880315	527	dbSNP
rs1471265507	534	dbSNP
rs1001223960	541	dbSNP
rs1360278393	560	dbSNP
rs1176091833	566	dbSNP
rs1413425387	570	dbSNP
rs537913519	571	dbSNP
rs1032243080	579	dbSNP
rs1422540066	585	dbSNP
rs1180196448	587	dbSNP
rs1176671337	596	dbSNP
rs1440061987	596	dbSNP
rs1484173558	599	dbSNP
rs1238008592	604	dbSNP
rs554729175	605	dbSNP
rs1209422432	607	dbSNP
rs1310583518	608	dbSNP
rs1288405636	614	dbSNP
rs956599204	620	dbSNP
rs1241205464	625	dbSNP
rs1353399537	625	dbSNP
rs1009202227	635	dbSNP
rs45527431	637	dbSNP
rs782659382	650	dbSNP
rs1380453039	660	dbSNP
rs1302782362	664	dbSNP
rs551893680	677	dbSNP
rs1356989702	678	dbSNP
rs533782293	688	dbSNP
rs954465850	694	dbSNP
rs553844288	704	dbSNP
rs910747101	706	dbSNP
rs1156565057	707	dbSNP
rs1425338037	726	dbSNP
rs1414438013	727	dbSNP
rs1482302729	729	dbSNP
rs180692287	734	dbSNP
rs1488057404	746	dbSNP
rs186130957	763	dbSNP
rs974085340	764	dbSNP
rs1247357702	781	dbSNP
rs1322769768	782	dbSNP
rs556703191	811	dbSNP
rs1352992234	812	dbSNP
rs1299457215	813	dbSNP
rs189883839	827	dbSNP
rs1400107372	833	dbSNP
rs929513970	847	dbSNP
rs45568331	860	dbSNP
rs1286823524	868	dbSNP
rs917214516	869	dbSNP
rs948821045	893	dbSNP
rs1044477991	900	dbSNP
rs1163946291	906	dbSNP
rs905049803	918	dbSNP
rs1425716354	926	dbSNP
rs541873370	930	dbSNP
rs1194403295	934	dbSNP
rs1477538365	936	dbSNP
rs45600933	937	dbSNP
rs1054002270	939	dbSNP
rs892392129	944	dbSNP
rs1009401863	952	dbSNP
rs1265269533	952	dbSNP
rs141149859	958	dbSNP
rs1279407639	959	dbSNP
rs1218644154	963	dbSNP
rs954373211	968	dbSNP
rs555612859	971	dbSNP
rs11755959	983	dbSNP
rs1391043042	984	dbSNP
rs963432668	1002	dbSNP
rs1459689902	1004	dbSNP
rs1402284903	1005	dbSNP
rs146922054	1046	dbSNP
rs1465158430	1050	dbSNP
rs1026449608	1051	dbSNP
rs1421640062	1062	dbSNP
rs1433949182	1067	dbSNP
rs1266972716	1068	dbSNP
rs1189786879	1072	dbSNP
rs1459375353	1087	dbSNP
rs778490284	1095	dbSNP
rs747600067	1098	dbSNP
rs781977428	1147	dbSNP
rs532419021	1149	dbSNP
rs1249067251	1150	dbSNP
rs1234810560	1151	dbSNP
rs1331267372	1153	dbSNP
rs782250821	1177	dbSNP
rs1438434374	1178	dbSNP
rs948735661	1179	dbSNP
rs1378913225	1180	dbSNP
rs980487805	1194	dbSNP
rs1465076491	1197	dbSNP
rs1394288433	1206	dbSNP
rs926072261	1213	dbSNP
rs1466632302	1214	dbSNP
rs181873841	1216	dbSNP
rs1377218113	1220	dbSNP
rs936050619	1221	dbSNP
rs1441901247	1222	dbSNP
rs1239209128	1236	dbSNP
rs111922578	1237	dbSNP
rs1456787443	1240	dbSNP
rs1258888955	1242	dbSNP
rs1201606165	1249	dbSNP
rs1255039947	1255	dbSNP
rs1345193382	1255	dbSNP
rs1231690508	1256	dbSNP
rs1355546889	1258	dbSNP
rs1309664032	1267	dbSNP
rs892299384	1268	dbSNP
rs1445808433	1274	dbSNP
rs1333854935	1277	dbSNP
rs1336100138	1281	dbSNP
rs569007371	1282	dbSNP
rs1401644461	1283	dbSNP
rs531411683	1283	dbSNP
rs12204145	1284	dbSNP
rs1421705696	1284	dbSNP
rs1381172120	1300	dbSNP
rs890145325	1305	dbSNP
rs186396476	1317	dbSNP
rs1468927727	1326	dbSNP
rs1370696208	1327	dbSNP
rs1007243094	1330	dbSNP
rs1442476136	1332	dbSNP
rs41267937	1333	dbSNP
rs1208141823	1342	dbSNP
rs1489039352	1350	dbSNP
rs1286308410	1368	dbSNP
rs555890450	1369	dbSNP
rs1285871814	1371	dbSNP
rs1245479976	1393	dbSNP
rs532672226	1398	dbSNP
rs577606774	1400	dbSNP
rs1026523273	1401	dbSNP
rs1361336349	1408	dbSNP
rs1297888978	1410	dbSNP
rs1399307475	1413	dbSNP
rs950852447	1414	dbSNP
rs137891839	1422	dbSNP
rs149438731	1426	dbSNP
rs1416366129	1432	dbSNP
rs556582007	1434	dbSNP
rs544759930	1446	dbSNP
rs1263451338	1450	dbSNP
rs1214708561	1453	dbSNP
rs1445033016	1461	dbSNP
rs190353893	1462	dbSNP
rs183752542	1463	dbSNP
rs1355479345	1477	dbSNP
rs1220538152	1478	dbSNP
rs1291368560	1478	dbSNP
rs1341269276	1479	dbSNP
rs1277781425	1481	dbSNP
rs1428936435	1482	dbSNP
rs1333081550	1483	dbSNP
rs1324564071	1485	dbSNP
rs1405155452	1485	dbSNP
rs925907828	1485	dbSNP
rs936141189	1492	dbSNP
rs1173540869	1494	dbSNP
rs1466722343	1509	dbSNP
rs988849909	1521	dbSNP
rs1423782406	1522	dbSNP
rs1185458581	1524	dbSNP
rs1474193384	1526	dbSNP
rs143817668	1527	dbSNP
rs1199220222	1534	dbSNP
rs1467919781	1534	dbSNP
rs572183476	1536	dbSNP
rs746631475	1539	dbSNP
rs1271178237	1546	dbSNP
rs1200504313	1566	dbSNP
rs1318663366	1569	dbSNP
rs1272329015	1571	dbSNP
rs1212905186	1583	dbSNP
rs1369930863	1596	dbSNP
rs1275671994	1597	dbSNP
rs1436207303	1599	dbSNP
rs1369319666	1605	dbSNP
rs1333932363	1610	dbSNP
rs1448113711	1623	dbSNP
rs1400238465	1624	dbSNP
rs945196068	1626	dbSNP
rs1407716623	1630	dbSNP
rs1426823301	1637	dbSNP
rs1051521790	1640	dbSNP
rs1453550377	1645	dbSNP
rs782097347	1653	dbSNP
rs890388944	1656	dbSNP
rs1180311533	1661	dbSNP
rs1458120113	1662	dbSNP
rs1232250699	1667	dbSNP
rs1202447204	1695	dbSNP
rs1314089200	1704	dbSNP
rs782779250	1717	dbSNP
rs770241918	1736	dbSNP
rs943245597	1737	dbSNP
rs148151521	1748	dbSNP
rs1233911837	1755	dbSNP
rs1346134312	1759	dbSNP
rs1038697253	1764	dbSNP
rs781871210	1767	dbSNP
rs141924470	1768	dbSNP
rs187790695	1776	dbSNP
rs73739033	1778	dbSNP
rs1334367961	1783	dbSNP
rs1360437936	1783	dbSNP
rs1433672658	1788	dbSNP
rs1392903096	1791	dbSNP
rs886629572	1796	dbSNP
rs1440084646	1801	dbSNP
rs1407162317	1805	dbSNP
rs1175472072	1810	dbSNP
rs1484266873	1811	dbSNP
rs562652403	1825	dbSNP
rs1014445414	1834	dbSNP
rs1484778116	1835	dbSNP
rs1024444997	1839	dbSNP
rs1288429868	1839	dbSNP
rs1241317439	1840	dbSNP
rs370237666	1845	dbSNP
rs1316756442	1847	dbSNP
rs542857492	1853	dbSNP
rs1002192605	1856	dbSNP
rs764438985	1857	dbSNP
rs1413645285	1860	dbSNP
rs1373173944	1868	dbSNP
rs1299730185	1869	dbSNP
rs781955721	1872	dbSNP
rs1420070759	1878	dbSNP
rs1344441927	1880	dbSNP
rs1033050279	1888	dbSNP
rs957589669	1889	dbSNP
rs1425449087	1893	dbSNP
rs1414458414	1898	dbSNP
rs548401724	1907	dbSNP
rs1474304311	1915	dbSNP
rs1265590516	1916	dbSNP
rs782467515	1917	dbSNP
rs1485728485	1921	dbSNP
rs782615769	1930	dbSNP
rs955426225	1945	dbSNP
rs1224270535	1946	dbSNP
rs561123793	1952	dbSNP
rs1322787341	1953	dbSNP
rs1273116239	1957	dbSNP
rs1232148340	1960	dbSNP
rs1353088575	1963	dbSNP
rs1279677368	1988	dbSNP
rs146093493	1994	dbSNP
rs1360880971	2004	dbSNP
rs1286838744	2005	dbSNP
rs59837426	2007	dbSNP
rs1395116627	2013	dbSNP
rs1459248462	2013	dbSNP
rs1164193821	2014	dbSNP
rs527367231	2020	dbSNP
rs1459919663	2021	dbSNP
rs547192408	2022	dbSNP
rs1194516254	2048	dbSNP
rs943338345	2050	dbSNP
rs1259933300	2052	dbSNP
rs1193219746	2064	dbSNP
rs1489051153	2066	dbSNP
rs1252908473	2069	dbSNP
rs1212425133	2070	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.