miRTarBase - #MIRT100410


—
pre-miRNA Information
pre-miRNA hsa-mir-664a   
Genomic Coordinates chr1: 220200538 - 220200619
Description Homo sapiens miR-664 stem-loop
Comment This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference , and the sequence is homologous with rat mir-664.
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-664a-3p
Sequence 49| UAUUCAUUUAUCCCCAGCCUACA |71
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30457627 12 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1478242335 2 dbSNP
rs1042905485 5 dbSNP
rs908858734 6 dbSNP
rs1229753248 8 dbSNP
rs770101636 12 dbSNP
rs746047168 14 dbSNP
rs1170225715 15 dbSNP
rs1404740911 16 dbSNP
rs1393962832 17 dbSNP
rs1377901643 18 dbSNP
rs1313271494 19 dbSNP
rs1416447585 20 dbSNP
rs1368463251 21 dbSNP
rs1167925254 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HSPA1B   
Synonyms HSP70-1B, HSP70-2, HSP70.2
Description heat shock protein family A (Hsp70) member 1B
Transcript NM_005346   
Expression
Putative miRNA Targets on HSPA1B
3'UTR of HSPA1B
(miRNA target sites are highlighted)		 
>HSPA1B|NM_005346|3'UTR
   1 GGGCCTTTGTTCTTTAGTATGTTTGTCTTTGAGGTGGACTGTTGGGACTCAAGGACTTTGCTGCTGTTTTCCTATGTCAT
  81 TTCTGCTTCAGCTCTTTGCTGCTTCACTTCTTTGTAAAGTTGTAACCTGATGGTAATTAGCTGGCTTCATTATTTTTGTA
 161 GTACAACCGATATGTTCATTAGAATTCTTTGCATTTAATGTTGATACTGTAAGGGTGTTTCGTTCCCTTTAAATGAATCA
 241 ACACTGCCACCTTCTGTACGAGTTTGTTTGTTTTTTTTTTTTTTTTTTTTTTTTGCTTGGCGAAAACACTACAAAGGCTG
 321 GGAATGTATGTTTTTATAATTTGTTTATTTAAATATGAAAAATAAAATGTTAAACTTTAAAAAAAAAAAAAAAAAAAAAA
 401 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acaUCCGACCCCUAUUUACUUAu 5'
             ||||||||    |||| || 
Target 5' caaAGGCTGGG----AATGTATg 3'
 312 - 330 134.00 -18.50
2 
miRNA  3' acAUCCGAC--CCCU-AUUUACUUAu 5'
            |:| |||  |||| | || || | 
Target 5' ggTGGACTGTTGGGACTCAAGGACTt 3'
 33 - 58 103.00 -10.00
3 
miRNA  3' acAUCCGACCCCUAUUUACUUau 5'
            ||  |||  |:| ||| |:  
Target 5' tgTAACCTGATGGT-AATTAGct 3'
 121 - 142 88.00 -6.35
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7759787 4 COSMIC
COSN26979432 6 COSMIC
COSN30113567 8 COSMIC
COSN30193057 10 COSMIC
COSN26979433 11 COSMIC
COSN30510635 17 COSMIC
COSN30154461 32 COSMIC
COSN14219180 51 COSMIC
COSN32053496 79 COSMIC
COSN30169835 90 COSMIC
COSN20857905 93 COSMIC
COSN21627112 101 COSMIC
COSN30574755 113 COSMIC
COSN1331318 122 COSMIC
COSN30709645 124 COSMIC
COSN30502458 153 COSMIC
COSN31486824 178 COSMIC
COSN31547491 264 COSMIC
COSN18769819 271 COSMIC
COSN8514044 271 COSMIC
COSN25757655 296 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776661762 3 dbSNP
rs1381457173 4 dbSNP
rs374210554 4 dbSNP
rs1206725726 5 dbSNP
rs1254527597 8 dbSNP
rs1470825022 10 dbSNP
rs372841582 13 dbSNP
rs1472296430 16 dbSNP
rs1379454709 20 dbSNP
rs775184193 21 dbSNP
rs1425766708 22 dbSNP
rs185921924 25 dbSNP
rs763791273 26 dbSNP
rs376092958 28 dbSNP
rs895550052 29 dbSNP
rs141231210 30 dbSNP
rs1218493533 31 dbSNP
rs370072638 31 dbSNP
rs1355006764 35 dbSNP
rs749927695 44 dbSNP
rs1300853557 45 dbSNP
rs1488529722 46 dbSNP
rs1402329325 47 dbSNP
rs756621240 47 dbSNP
rs1228680570 50 dbSNP
rs1285219732 51 dbSNP
rs770756887 51 dbSNP
rs780607464 53 dbSNP
rs1346436683 55 dbSNP
rs1490546012 57 dbSNP
rs1274952613 60 dbSNP
rs1224798121 62 dbSNP
rs1271047574 64 dbSNP
rs1402236515 65 dbSNP
rs1020378280 68 dbSNP
rs1477001976 73 dbSNP
rs1190492622 83 dbSNP
rs967526102 87 dbSNP
rs896809973 88 dbSNP
rs1173200429 91 dbSNP
rs565503358 93 dbSNP
rs146946127 95 dbSNP
rs1427450031 98 dbSNP
rs1033675939 102 dbSNP
rs1359472597 111 dbSNP
rs964359227 114 dbSNP
rs55965437 117 dbSNP
rs77674559 117 dbSNP
rs9281590 117 dbSNP
rs3036297 118 dbSNP
rs1444096883 127 dbSNP
rs1056759343 130 dbSNP
rs896320682 134 dbSNP
rs1199374236 142 dbSNP
rs1342343577 146 dbSNP
rs1279625863 149 dbSNP
rs531028875 159 dbSNP
rs922652254 161 dbSNP
rs1277994912 163 dbSNP
rs955418752 170 dbSNP
rs549822168 171 dbSNP
rs982878795 173 dbSNP
rs866683666 178 dbSNP
rs907677097 188 dbSNP
rs1422604930 191 dbSNP
rs757378302 201 dbSNP
rs1473684834 204 dbSNP
rs1360431140 206 dbSNP
rs1224919215 207 dbSNP
rs564834394 208 dbSNP
rs1459545091 217 dbSNP
rs940510726 221 dbSNP
rs1289700388 222 dbSNP
rs1198838023 228 dbSNP
rs1451056542 245 dbSNP
rs1220777326 249 dbSNP
rs1061623 250 dbSNP
rs970168513 251 dbSNP
rs1255810742 253 dbSNP
rs1213168316 258 dbSNP
rs1381883908 260 dbSNP
rs1000261968 261 dbSNP
rs1362279347 262 dbSNP
rs1447966537 262 dbSNP
rs1168683033 263 dbSNP
rs1333482249 263 dbSNP
rs1380611889 263 dbSNP
rs1399810316 263 dbSNP
rs1447664169 263 dbSNP
rs932796547 263 dbSNP
rs1233353386 264 dbSNP
rs1162534393 265 dbSNP
rs1414273360 265 dbSNP
rs1442731145 265 dbSNP
rs1239982341 266 dbSNP
rs1178688227 267 dbSNP
rs1223323952 267 dbSNP
rs1230817281 267 dbSNP
rs1240951280 267 dbSNP
rs1245833421 267 dbSNP
rs1291069273 267 dbSNP
rs1296605074 267 dbSNP
rs1312162299 267 dbSNP
rs1323824582 267 dbSNP
rs1357887181 267 dbSNP
rs1438901175 267 dbSNP
rs530326021 267 dbSNP
rs746474434 267 dbSNP
rs9267570 267 dbSNP
rs1350207908 268 dbSNP
rs1481519659 269 dbSNP
rs55960422 270 dbSNP
rs570618722 270 dbSNP
rs1221054406 271 dbSNP
rs1222191939 271 dbSNP
rs1241520907 271 dbSNP
rs1245814918 271 dbSNP
rs1288693248 271 dbSNP
rs1304993217 271 dbSNP
rs1316361011 271 dbSNP
rs1488623591 271 dbSNP
rs1489979426 271 dbSNP
rs1491147194 271 dbSNP
rs668558 271 dbSNP
rs757877151 271 dbSNP
rs9279427 271 dbSNP
rs920493087 272 dbSNP
rs1444873789 273 dbSNP
rs937296635 273 dbSNP
rs200566756 274 dbSNP
rs28628780 274 dbSNP
rs7740730 275 dbSNP
rs903502904 276 dbSNP
rs955576176 277 dbSNP
rs986067505 278 dbSNP
rs911389750 279 dbSNP
rs41270537 280 dbSNP
rs1331101014 281 dbSNP
rs1013924695 282 dbSNP
rs941139222 283 dbSNP
rs1248470025 284 dbSNP
rs866051184 285 dbSNP
rs1038074304 286 dbSNP
rs1259534439 287 dbSNP
rs1282599051 292 dbSNP
rs1212318935 293 dbSNP
rs1312915632 293 dbSNP
rs1472502063 294 dbSNP
rs1177619895 295 dbSNP
rs1221926642 295 dbSNP
rs1342090229 295 dbSNP
rs1355776151 296 dbSNP
rs1359760780 297 dbSNP
rs34396430 298 dbSNP
rs1431818963 299 dbSNP
rs1273696887 300 dbSNP
rs1468733657 302 dbSNP
rs1173749659 308 dbSNP
rs1309184055 311 dbSNP
rs1466887631 316 dbSNP
rs778921535 318 dbSNP
rs1423941184 319 dbSNP
rs1196608679 320 dbSNP
rs745741102 323 dbSNP
rs1237360824 327 dbSNP
rs1461567631 329 dbSNP
rs1185085493 331 dbSNP
rs1235354486 336 dbSNP
rs547116736 337 dbSNP
rs1167985519 339 dbSNP
rs201449275 340 dbSNP
rs918268391 341 dbSNP
rs1170531230 344 dbSNP
rs1407334601 348 dbSNP
rs1320231693 350 dbSNP
rs1223680605 351 dbSNP
rs929590185 352 dbSNP
rs1332496391 356 dbSNP
rs1340080570 358 dbSNP
rs1226408819 359 dbSNP
rs1000762955 360 dbSNP
rs565973902 364 dbSNP
rs1314700622 370 dbSNP
rs1396556347 373 dbSNP
rs1033211672 375 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000375650.3 | 3UTR | CUUUAAAUGAAUCAACACUGCCACCUUCUGUACGAGUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000375650.3 | 3UTR | UUCCCUUUAAAUGAAUCAACACUGCCACCUUCUGUACGAGUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.553 3.1e-3 0.463 1.3e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.098 3.0e-1 0.139 2.2e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.082 3.5e-1 0.016 4.7e-1 24 Click to see details
GSE38226 Liver fibrosis -0.06 4.0e-1 0.092 3.5e-1 21 Click to see details
GSE28544 Breast cancer -0.045 4.2e-1 -0.018 4.7e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.022 4.7e-1 -0.181 2.8e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.35 0.02 0.375 0.01 38 Click to see details
PRAD 0.299 0.02 0.197 0.09 50 Click to see details
STAD -0.362 0.02 -0.341 0.03 32 Click to see details
BLCA -0.429 0.04 -0.261 0.15 18 Click to see details
LUAD 0.429 0.08 0.448 0.07 12 Click to see details
PAAD -0.773 0.11 -0.600 0.2 4 Click to see details
UCEC 0.265 0.14 0.207 0.2 19 Click to see details
CESC 0.88 0.16 0.500 0.33 3 Click to see details
KIRP 0.183 0.16 0.084 0.32 32 Click to see details
COAD 0.364 0.19 0.310 0.23 8 Click to see details
BRCA -0.094 0.2 0.083 0.23 84 Click to see details
ESCA -0.25 0.23 -0.300 0.19 11 Click to see details
KIRC 0.076 0.27 0.163 0.09 68 Click to see details
LIHC -0.075 0.3 -0.064 0.33 49 Click to see details
PCPG -0.414 0.36 -0.500 0.33 3 Click to see details
THCA -0.024 0.43 -0.027 0.42 59 Click to see details
KICH 0.032 0.44 0.022 0.46 25 Click to see details
CHOL -0.056 0.44 -0.233 0.27 9 Click to see details
HNSC -0.016 0.46 0.020 0.45 42 Click to see details
HNSC -0.016 0.46 0.020 0.45 42 Click to see details
HNSC -0.016 0.46 0.020 0.45 42 Click to see details
88 hsa-miR-664a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035824 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT035826 FUS FUS RNA binding protein 1 1
MIRT069432 SIVA1 SIVA1 apoptosis inducing factor 2 2
MIRT071494 CALM1 calmodulin 1 2 2
MIRT100410 HSPA1B heat shock protein family A (Hsp70) member 1B 2 2
MIRT143469 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT191113 ARF6 ADP ribosylation factor 6 2 2
MIRT235584 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT339131 ARID1A AT-rich interaction domain 1A 2 2
MIRT437450 MAT1A methionine adenosyltransferase 1A 1 1
MIRT442234 BTD biotinidase 2 2
MIRT443321 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443769 HLF HLF, PAR bZIP transcription factor 2 2
MIRT444352 KIAA1211 KIAA1211 2 2
MIRT456348 OLIG3 oligodendrocyte transcription factor 3 2 8
MIRT458866 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT466169 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470445 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT471524 PCGF3 polycomb group ring finger 3 2 6
MIRT477744 EDN1 endothelin 1 2 2
MIRT482885 CACNA2D3 calcium voltage-gated channel auxiliary subunit alpha2delta 3 2 2
MIRT496336 PTPRT protein tyrosine phosphatase, receptor type T 2 2
MIRT497703 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 2
MIRT499068 CTBP1 C-terminal binding protein 1 2 4
MIRT500296 ZNF667 zinc finger protein 667 2 8
MIRT500506 ZBTB34 zinc finger and BTB domain containing 34 2 8
MIRT501964 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT505457 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT505955 RAN RAN, member RAS oncogene family 2 6
MIRT507512 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT512953 MKI67 marker of proliferation Ki-67 2 2
MIRT520450 TSPAN2 tetraspanin 2 2 6
MIRT525997 MAGEL2 MAGE family member L2 2 2
MIRT526424 ZNF695 zinc finger protein 695 2 2
MIRT527364 KRTAP13-2 keratin associated protein 13-2 2 2
MIRT529612 H1F0 H1 histone family member 0 2 2
MIRT529811 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT530971 EXO5 exonuclease 5 2 4
MIRT531294 WNT7A Wnt family member 7A 2 2
MIRT531870 POF1B premature ovarian failure, 1B 2 2
MIRT532116 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT533534 TPR translocated promoter region, nuclear basket protein 2 2
MIRT545934 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546649 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT548063 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT548288 FAM3C family with sequence similarity 3 member C 2 4
MIRT551018 SPPL3 signal peptide peptidase like 3 2 2
MIRT551139 ZNF678 zinc finger protein 678 2 2
MIRT552398 ZNF487P zinc finger protein 487 1 1
MIRT555640 PHIP pleckstrin homology domain interacting protein 2 4
MIRT556267 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT558864 CD2AP CD2 associated protein 2 2
MIRT559239 BEND4 BEN domain containing 4 2 2
MIRT559438 ARSJ arylsulfatase family member J 2 2
MIRT559793 ZNF415 zinc finger protein 415 2 2
MIRT562572 CBX6 chromobox 6 2 2
MIRT562741 ZNF83 zinc finger protein 83 2 2
MIRT564737 ZNF23 zinc finger protein 23 2 2
MIRT565174 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT566301 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT571656 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT610720 NAV2 neuron navigator 2 2 2
MIRT611486 ADCYAP1R1 ADCYAP receptor type I 2 4
MIRT617118 KANK2 KN motif and ankyrin repeat domains 2 2 2
MIRT617836 SIGLEC10 sialic acid binding Ig like lectin 10 2 2
MIRT636145 VLDLR very low density lipoprotein receptor 2 2
MIRT638060 YAE1D1 Yae1 domain containing 1 2 4
MIRT640159 CDK13 cyclin dependent kinase 13 2 2
MIRT644257 WEE2 WEE1 homolog 2 2 2
MIRT646838 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT653074 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2 2
MIRT657671 GPR26 G protein-coupled receptor 26 2 2
MIRT660601 AP3M2 adaptor related protein complex 3 mu 2 subunit 2 2
MIRT668908 CREB1 cAMP responsive element binding protein 1 2 2
MIRT672685 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT680977 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682271 RS1 retinoschisin 1 2 2
MIRT702058 RNMT RNA guanine-7 methyltransferase 2 2
MIRT707786 UNK unkempt family zinc finger 2 2
MIRT709238 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710119 MED23 mediator complex subunit 23 2 2
MIRT710675 ADAP2 ArfGAP with dual PH domains 2 2 2
MIRT712884 NIPBL NIPBL, cohesin loading factor 2 2
MIRT719015 HPGD 15-hydroxyprostaglandin dehydrogenase 2 2
MIRT723323 COLEC10 collectin subfamily member 10 2 2
MIRT724947 TXNL1 thioredoxin like 1 2 2
MIRT725535 EN2 engrailed homeobox 2 2 2
MIRT734156 FHL1 four and a half LIM domains 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-664a Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-mir-664a Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-664a Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-miR-664a-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-664a-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-664a-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-664a-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-664a-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-664a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-miR-664a-3p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-664a-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-664a-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-664a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-664a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-664a-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-664a-3p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-664a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-664a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-664a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-664a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-664a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-664a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission