| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4491 |
| Genomic Coordinates | chr11: 111347757 - 111347824 |
| Description | Homo sapiens miR-4491 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4491 | ||||||||||||||||||||||||
| Sequence | 46| AAUGUGGACUGGUGUGACCAAA |67 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | DNAJB9 | ||||||||||||||||||||
| Synonyms | ERdj4, MDG-1, MDG1, MST049, MSTP049 | ||||||||||||||||||||
| Description | DnaJ heat shock protein family (Hsp40) member B9 | ||||||||||||||||||||
| Transcript | NM_012328 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on DNAJB9 | |||||||||||||||||||||
| 3'UTR of DNAJB9 (miRNA target sites are highlighted) |
>DNAJB9|NM_012328|3'UTR 1 TTCTTATTCTATTCTCACTAAATCCAACTGGTTGACTCTTCCTCATTATCTTTGATGCTAAACAATTTTCTGTGAACTAT 81 TTTGACAAGTGCATGATTTCACTTTAAACAATTTGATATAGCTATTAAATATATTTAAGGGTTTTTTTTTTTTGACAAAT 161 TCAACATTCAACGAGTAGACAAAATGCTAATTATTTCCCTGATTAGGAAAGTTTCTTTAAAAAACACGTAATTTTGCCTA 241 GTGCTTTTTCTCTACCTGCCCTTGGGCTCACTAATATCACCAGTATTATTACCAAGAAAATATTGAGTTTACCTGATTAA 321 ACTTTAAAAGTTAATTGTAGATTTAAATTGTGTGAACCTAATGATTTTTGCAGTGAAACCTTTACTAATTCAAAGTTGCA 401 TGTTCTATGACATCTGTGACTTGCGTTGCAGAGTGTACATGAAACTGTATAATTGAGTCATTCAGTAAAGGAGAACAGTA 481 TCTTGGTTAATTGCTACTGAAAGGTTGAGAAAGGAATGGTTTGATATTTACCACAGCGCTGTGCCTTTCTACAGTAGAAC 561 TGGGGTAAAGGAAATGGTTTTATTGCCCATAGTCATTTAGGCTGGAAAAAAGTTGAAAACTTAACGAAATATTGCCAAGA 641 GATTGTTATGTGTTTGGTTCCAGCCTAAAAATGATTTTGTAGTGTTGAAATCATAGCTACTTACATAGCTTTTTCATATT 721 TCTTTCTTAGTTGTTGGCACTCTTAGGTCTTAGTATGGATTTATGTGTTTGTGTGTGTGTAGTTTATCCTCTCTCTCATC 801 TTTATCTAGAGATTGACTGATACCTCATTCTGTTTGTAAAACCAGCCAGTAATTTCTGTGCAACCTTACTATGTGCAATA 881 TTTTTAAATCCTGAGAAATGTGTGCTTTTGTTTTCGGATAGACTTATTTCTTTAGTTCTGCACTTTTCCACATTATACTC 961 CATATGAGTATTAATCCTATGGATACATATTAAAACAAGTGTCTCATACAACATTGTATGTGAGAGAAATATAAATATTT 1041 ACAACCTGATATTCGTTGTTGTTTTATTGTTAAAAGTTTATTATGCAACTCTGGAGGTATAGAGGGCATATAAGCTATGG 1121 GACATATGCTGATCACAGGCTATATTCATGAAGTTACTTTTGACCAACCTGAAAACTGATAGGATTTTGTTTGTCATTTG 1201 GTAATTTCTACTGCATTCTTACCATCCTTCTCTCACAAATTTTGATAGCTTGAAGATCTTTTTAATTATAATTTTGTTGT 1281 ATTTGTTTCCTAGGAGCAAGTGTTCCTGCTGCCAGTTCTTTCCTCTTTAGGCGTGGTTGAGAAAAAGCAGAAACTTTACA 1361 TAAAGCTGTATTTCTTAATCATCTTTAATTTGAAACTTAAGAAAATGAATTTATTCTGTTATATTTATGTAACTTATTTC 1441 CTGGAAGTTATATCTACTAGTTTTGTTTGATAATAATAAAATTAGCTATACCTTGAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 4189.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 4189.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 4189.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000249356.3 | 3UTR | UGCACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000249356.3 | 3UTR | UCUGCACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000249356.3 | 3UTR | CACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000249356.3 | 3UTR | UUCUGCACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000249356.3 | 3UTR | ACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000249356.3 | 3UTR | UCUGCACUUUUCCACAUUAUACUCCAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000249356.3 | 3UTR | CACUUUUCCACAUUAUACUCCAUAUGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
67 hsa-miR-4491 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT056779 | ARID5B | AT-rich interaction domain 5B |  |
|
2 | 2 | ||||||
| MIRT061577 | BTG2 | BTG anti-proliferation factor 2 | |
|
2 | 2 | ||||||
| MIRT063828 | SRP9 | signal recognition particle 9 | |
|
2 | 4 | ||||||
| MIRT102306 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | |
|
2 | 10 | ||||||
| MIRT186634 | COX20 | COX20, cytochrome c oxidase assembly factor | |
|
2 | 8 | ||||||
| MIRT191243 | STYX | serine/threonine/tyrosine interacting protein | |
|
2 | 2 | ||||||
| MIRT195908 | SRSF11 | serine and arginine rich splicing factor 11 | |
|
2 | 4 | ||||||
| MIRT240343 | UBXN2B | UBX domain protein 2B | |
|
2 | 2 | ||||||
| MIRT271178 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | |
|
2 | 2 | ||||||
| MIRT286219 | TMEM97 | transmembrane protein 97 | |
|
2 | 4 | ||||||
| MIRT314182 | OCLN | occludin | |
|
2 | 4 | ||||||
| MIRT323938 | AKAP2 | A-kinase anchoring protein 2 | |
|
2 | 4 | ||||||
| MIRT323940 | PALM2-AKAP2 | PALM2-AKAP2 readthrough | |
|
2 | 4 | ||||||
| MIRT340113 | TXLNA | taxilin alpha | |
|
2 | 2 | ||||||
| MIRT450333 | LRWD1 | leucine rich repeats and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT451283 | ZNF101 | zinc finger protein 101 | |
|
2 | 2 | ||||||
| MIRT451879 | SOD2 | superoxide dismutase 2 | |
|
2 | 8 | ||||||
| MIRT453577 | CRCP | CGRP receptor component | |
|
2 | 2 | ||||||
| MIRT454366 | ASAH2 | N-acylsphingosine amidohydrolase 2 | |
|
2 | 2 | ||||||
| MIRT454797 | STOML3 | stomatin like 3 | |
|
2 | 2 | ||||||
| MIRT459801 | POTED | POTE ankyrin domain family member D | |
|
2 | 10 | ||||||
| MIRT460911 | POLQ | DNA polymerase theta | |
|
2 | 2 | ||||||
| MIRT468082 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 6 | ||||||
| MIRT470281 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 2 | ||||||
| MIRT471876 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT476147 | GPR137C | G protein-coupled receptor 137C | |
|
2 | 8 | ||||||
| MIRT478056 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 10 | ||||||
| MIRT501054 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | |
|
2 | 4 | ||||||
| MIRT501732 | OVOL1 | ovo like transcriptional repressor 1 | |
|
2 | 2 | ||||||
| MIRT502214 | HSPB8 | heat shock protein family B (small) member 8 | |
|
2 | 2 | ||||||
| MIRT505243 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | |
|
2 | 2 | ||||||
| MIRT505957 | RAN | RAN, member RAS oncogene family | |
|
2 | 6 | ||||||
| MIRT507996 | BCL2L13 | BCL2 like 13 | |
|
2 | 4 | ||||||
| MIRT510433 | ZNF207 | zinc finger protein 207 | |
|
2 | 6 | ||||||
| MIRT510827 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 4 | ||||||
| MIRT511493 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | |
|
2 | 4 | ||||||
| MIRT512129 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
2 | 8 | ||||||
| MIRT514512 | SHISA9 | shisa family member 9 | |
|
2 | 4 | ||||||
| MIRT516482 | RAB32 | RAB32, member RAS oncogene family | |
|
2 | 4 | ||||||
| MIRT519514 | RBM22 | RNA binding motif protein 22 | |
|
2 | 4 | ||||||
| MIRT523367 | GTF2A1 | general transcription factor IIA subunit 1 | |
|
2 | 2 | ||||||
| MIRT524217 | DDI2 | DNA damage inducible 1 homolog 2 | |
|
2 | 6 | ||||||
| MIRT524649 | C4orf32 | family with sequence similarity 241 member A | |
|
2 | 2 | ||||||
| MIRT528297 | ZNF76 | zinc finger protein 76 | |
|
2 | 2 | ||||||
| MIRT528577 | ITGB3BP | integrin subunit beta 3 binding protein | |
|
2 | 2 | ||||||
| MIRT530458 | SULT1B1 | sulfotransferase family 1B member 1 | |
|
2 | 2 | ||||||
| MIRT535774 | MYCN | MYCN proto-oncogene, bHLH transcription factor | |
|
2 | 2 | ||||||
| MIRT544239 | CCBL2 | kynurenine aminotransferase 3 | |
|
2 | 2 | ||||||
| MIRT546733 | RNF217 | ring finger protein 217 | |
|
2 | 2 | ||||||
| MIRT550360 | INCENP | inner centromere protein | |
|
2 | 4 | ||||||
| MIRT553343 | TRPC3 | transient receptor potential cation channel subfamily C member 3 | |
|
2 | 4 | ||||||
| MIRT556629 | LAPTM4A | lysosomal protein transmembrane 4 alpha | |
|
2 | 2 | ||||||
| MIRT558006 | FAM122B | family with sequence similarity 122B | |
|
2 | 2 | ||||||
| MIRT558994 | CA8 | carbonic anhydrase 8 | |
|
2 | 2 | ||||||
| MIRT560418 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT565717 | SESN3 | sestrin 3 | |
|
2 | 2 | ||||||
| MIRT566271 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
|
2 | 2 | ||||||
| MIRT568161 | CCDC6 | coiled-coil domain containing 6 | |
|
2 | 2 | ||||||
| MIRT569753 | C2orf71 | chromosome 2 open reading frame 71 | |
|
2 | 2 | ||||||
| MIRT573959 | FIGNL1 | fidgetin like 1 | |
|
2 | 2 | ||||||
| MIRT574530 | PEG10 | paternally expressed 10 | |
|
2 | 2 | ||||||
| MIRT609453 | CCDC149 | coiled-coil domain containing 149 | |
|
2 | 2 | ||||||
| MIRT614047 | THBS2 | thrombospondin 2 | |
|
2 | 2 | ||||||
| MIRT628418 | ATMIN | ATM interactor | |
|
2 | 2 | ||||||
| MIRT689556 | XPO6 | exportin 6 | |
|
2 | 2 | ||||||
| MIRT725598 | CDH7 | cadherin 7 | |
|
2 | 2 | ||||||
| MIRT735561 | TRIM7 | tripartite motif containing 7 | |
|
|
3 | 0 | |||||