pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3607 |
Genomic Coordinates | chr5: 86620497 - 86620575 |
Description | Homo sapiens miR-3607 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-3607-3p |
Sequence | 51| ACUGUAAACGCUUUCUGAUG |70 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | USP42 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | ubiquitin specific peptidase 42 | ||||||||||||||||||||
Transcript | NM_032172 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on USP42 | |||||||||||||||||||||
3'UTR of USP42 (miRNA target sites are highlighted) |
>USP42|NM_032172|3'UTR 1 AAACTCAGCCTCAAAACAAAAAATTCACTAGTTATGATTCAACGCGTTCAACAGAAGCCATCCCCAGCCCAGCTTAAATT 81 ATAAAGATAGACAATAACTCTGTTCCAATCTGCGTGGTGCTTCTTTAGTAAATACTGTACAGATTTTACCATGGAGAACT 161 TTTTTTTTAGTTTTTACCTTTTCTTAATTACCCTTATTCCGAATGGACGAACACTTTCTACCACTGCTGACCATTGTAAA 241 ATACCGTGTATATAAATCCCATTGAAATAATGCCCTGGAATAGAACATCTCAAATGCTGCTTAATTACAGACTCAGGTCG 321 ATTACTTGTATTTCATGTAATGTTCCTCCAAGTTAGACATCTGGTGCAAGACCAACCGGGAGACCATGGAATTGTCAAAA 401 GTACAAACTGACAGTGTGTATATTTAATTTAAAGACTTATTTAAAAACTCACAAGCTCTCACCTAGACTTTGGAGAGCAG 481 TCTGTTTTCTGTAATGTCTGATACTAGAAACTAATTTGCTTATTTTAGTTGTATTCAAGATTTGAAGATGTATTTTATAG 561 ACAAGTTCTGTTTTTGAACTTTGTGGAACTGTTCCAATCAATCAATTTCCCAGTTATGATGAGTATTTACATTATGAATG 641 TATAACCCAGACATGATTTGTAAAGCCGACAGTATGTTTCTATTACACAACACTTTTTGATACAGCGTCTCTTGTCTTCA 721 CTGATACTGGAGTCTCCGTTGTCTGCTTGGTCCCTTCGAGTTTCTAGTTACAGACACAATCATACTGTGATTTTATTTTT 801 AATATGGATATGCTATCAAACTGTGATACACTTATAATTCACTGGTCCTGCATCAGGAGATGGAGTGGGGAAAACTGTAT 881 TTAATACAGTTTGTATCTGAATAATCTGTATGGTTTATACAGTTTGTGTTGTTCAGAGATGTTTAAAGTTTGATCTTTGT 961 TTTTCTAAAGATTAAAAAAGCACTTGCCCCACTGTAAATATACAGCATGTAAAATTTCTATAGTATATAAATGGCAGCAA 1041 ATCACAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 84132.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 84132.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
93 hsa-miR-3607-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT057680 | LCOR | ligand dependent nuclear receptor corepressor | 2 | 2 | ||||||||
MIRT058092 | EIF4G2 | eukaryotic translation initiation factor 4 gamma 2 | 2 | 4 | ||||||||
MIRT063624 | FBXO28 | F-box protein 28 | 2 | 2 | ||||||||
MIRT071884 | BTF3L4 | basic transcription factor 3 like 4 | 2 | 2 | ||||||||
MIRT079440 | FOXK2 | forkhead box K2 | 2 | 4 | ||||||||
MIRT080491 | BCL10 | B-cell CLL/lymphoma 10 | 2 | 2 | ||||||||
MIRT081214 | MIDN | midnolin | 2 | 10 | ||||||||
MIRT082786 | ZNF264 | zinc finger protein 264 | 2 | 2 | ||||||||
MIRT082862 | ZNF543 | zinc finger protein 543 | 2 | 4 | ||||||||
MIRT099112 | FOXC1 | forkhead box C1 | 2 | 4 | ||||||||
MIRT099343 | QKI | QKI, KH domain containing RNA binding | 2 | 2 | ||||||||
MIRT100913 | CD2AP | CD2 associated protein | 2 | 2 | ||||||||
MIRT104030 | USP42 | ubiquitin specific peptidase 42 | 2 | 6 | ||||||||
MIRT130023 | QSER1 | glutamine and serine rich 1 | 2 | 2 | ||||||||
MIRT142614 | IL21R | interleukin 21 receptor | 2 | 2 | ||||||||
MIRT143477 | CHD9 | chromodomain helicase DNA binding protein 9 | 2 | 2 | ||||||||
MIRT187759 | ESYT1 | extended synaptotagmin 1 | 2 | 2 | ||||||||
MIRT200250 | EVI5 | ecotropic viral integration site 5 | 2 | 2 | ||||||||
MIRT212867 | N4BP2 | NEDD4 binding protein 2 | 2 | 2 | ||||||||
MIRT219622 | GIGYF1 | GRB10 interacting GYF protein 1 | 2 | 8 | ||||||||
MIRT220244 | FAM3C | family with sequence similarity 3 member C | 2 | 6 | ||||||||
MIRT222069 | PURB | purine rich element binding protein B | 2 | 2 | ||||||||
MIRT243478 | TRIM71 | tripartite motif containing 71 | 2 | 2 | ||||||||
MIRT261690 | PLEKHA1 | pleckstrin homology domain containing A1 | 2 | 2 | ||||||||
MIRT320184 | ITGB8 | integrin subunit beta 8 | 2 | 2 | ||||||||
MIRT441644 | CCNB1IP1 | cyclin B1 interacting protein 1 | 2 | 6 | ||||||||
MIRT441965 | BACE2 | beta-site APP-cleaving enzyme 2 | 2 | 2 | ||||||||
MIRT442175 | TRIM59 | tripartite motif containing 59 | 2 | 4 | ||||||||
MIRT442716 | TNKS | tankyrase | 2 | 2 | ||||||||
MIRT443932 | ZNF418 | zinc finger protein 418 | 2 | 2 | ||||||||
MIRT445790 | ALG13 | ALG13, UDP-N-acetylglucosaminyltransferase subunit | 2 | 2 | ||||||||
MIRT448148 | P2RY10 | purinergic receptor P2Y10 | 2 | 2 | ||||||||
MIRT463393 | ZDHHC20 | zinc finger DHHC-type containing 20 | 2 | 2 | ||||||||
MIRT463761 | YPEL2 | yippee like 2 | 2 | 2 | ||||||||
MIRT477233 | ETF1 | eukaryotic translation termination factor 1 | 2 | 2 | ||||||||
MIRT483464 | DR1 | down-regulator of transcription 1 | 2 | 6 | ||||||||
MIRT484110 | ABCD2 | ATP binding cassette subfamily D member 2 | 2 | 4 | ||||||||
MIRT487297 | SLC38A9 | solute carrier family 38 member 9 | 2 | 2 | ||||||||
MIRT501292 | RRN3 | RRN3 homolog, RNA polymerase I transcription factor | 2 | 4 | ||||||||
MIRT501343 | RNF44 | ring finger protein 44 | 2 | 4 | ||||||||
MIRT502696 | CSNK1G1 | casein kinase 1 gamma 1 | 2 | 4 | ||||||||
MIRT511075 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | 2 | 4 | ||||||||
MIRT511243 | KLHL36 | kelch like family member 36 | 2 | 6 | ||||||||
MIRT531418 | PLBD2 | phospholipase B domain containing 2 | 2 | 2 | ||||||||
MIRT536603 | IRF2 | interferon regulatory factor 2 | 2 | 2 | ||||||||
MIRT537727 | ELAVL2 | ELAV like RNA binding protein 2 | 2 | 2 | ||||||||
MIRT537985 | DPP8 | dipeptidyl peptidase 8 | 2 | 2 | ||||||||
MIRT539083 | ARNTL | aryl hydrocarbon receptor nuclear translocator like | 2 | 4 | ||||||||
MIRT547185 | PBRM1 | polybromo 1 | 2 | 2 | ||||||||
MIRT547596 | LIN28B | lin-28 homolog B | 2 | 2 | ||||||||
MIRT548188 | FOXA1 | forkhead box A1 | 2 | 2 | ||||||||
MIRT555055 | PYURF | PIGY upstream reading frame | 2 | 2 | ||||||||
MIRT557321 | HIC2 | HIC ZBTB transcriptional repressor 2 | 2 | 2 | ||||||||
MIRT557979 | FAM217B | family with sequence similarity 217 member B | 2 | 4 | ||||||||
MIRT558439 | DDIT4 | DNA damage inducible transcript 4 | 2 | 3 | ||||||||
MIRT558560 | CRLF3 | cytokine receptor like factor 3 | 2 | 4 | ||||||||
MIRT562332 | FGF2 | fibroblast growth factor 2 | 2 | 2 | ||||||||
MIRT565836 | SCML2 | Scm polycomb group protein like 2 | 2 | 2 | ||||||||
MIRT566796 | MIER3 | MIER family member 3 | 2 | 2 | ||||||||
MIRT568565 | AK4 | adenylate kinase 4 | 2 | 2 | ||||||||
MIRT572483 | PRR14L | proline rich 14 like | 2 | 2 | ||||||||
MIRT572586 | HGFAC | HGF activator | 2 | 2 | ||||||||
MIRT572876 | OPHN1 | oligophrenin 1 | 2 | 2 | ||||||||
MIRT573136 | ABT1 | activator of basal transcription 1 | 2 | 2 | ||||||||
MIRT573244 | ZBTB46 | zinc finger and BTB domain containing 46 | 2 | 2 | ||||||||
MIRT573388 | GGA2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | 2 | 2 | ||||||||
MIRT574588 | N4BP1 | NEDD4 binding protein 1 | 2 | 2 | ||||||||
MIRT575081 | Ddit4 | DNA-damage-inducible transcript 4 | 2 | 3 | ||||||||
MIRT609077 | SMIM15 | small integral membrane protein 15 | 2 | 8 | ||||||||
MIRT619337 | RNF2 | ring finger protein 2 | 2 | 2 | ||||||||
MIRT623058 | NRXN1 | neurexin 1 | 2 | 2 | ||||||||
MIRT623307 | MARCH4 | membrane associated ring-CH-type finger 4 | 2 | 2 | ||||||||
MIRT623899 | FOXN3 | forkhead box N3 | 2 | 2 | ||||||||
MIRT625177 | GRIK4 | glutamate ionotropic receptor kainate type subunit 4 | 2 | 2 | ||||||||
MIRT630448 | GTPBP8 | GTP binding protein 8 (putative) | 2 | 2 | ||||||||
MIRT630587 | SLC9A8 | solute carrier family 9 member A8 | 2 | 2 | ||||||||
MIRT634451 | PAK6 | p21 (RAC1) activated kinase 6 | 2 | 2 | ||||||||
MIRT634727 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | 2 | 2 | ||||||||
MIRT635769 | PDCL3 | phosducin like 3 | 2 | 2 | ||||||||
MIRT650924 | ST6GALNAC1 | ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 | 2 | 2 | ||||||||
MIRT668975 | CLSTN2 | calsyntenin 2 | 2 | 2 | ||||||||
MIRT669612 | AEBP2 | AE binding protein 2 | 2 | 2 | ||||||||
MIRT686746 | STX16 | syntaxin 16 | 2 | 2 | ||||||||
MIRT687932 | HMGN1 | high mobility group nucleosome binding domain 1 | 2 | 2 | ||||||||
MIRT691875 | GXYLT2 | glucoside xylosyltransferase 2 | 2 | 2 | ||||||||
MIRT698432 | TM4SF1 | transmembrane 4 L six family member 1 | 2 | 2 | ||||||||
MIRT698572 | TFDP2 | transcription factor Dp-2 | 2 | 2 | ||||||||
MIRT704500 | CPEB4 | cytoplasmic polyadenylation element binding protein 4 | 2 | 2 | ||||||||
MIRT704907 | CCDC71L | coiled-coil domain containing 71 like | 2 | 2 | ||||||||
MIRT713810 | XRCC2 | X-ray repair cross complementing 2 | 2 | 2 | ||||||||
MIRT718300 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | 2 | 2 | ||||||||
MIRT719022 | SHROOM3 | shroom family member 3 | 2 | 2 | ||||||||
MIRT723766 | MPLKIP | M-phase specific PLK1 interacting protein | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|