miRTarBase - #MIRT104077


—
pre-miRNA Information
pre-miRNA hsa-mir-136   
Genomic Coordinates chr14: 100884702 - 100884783
Description Homo sapiens miR-136 stem-loop
Comment miR-136 was first identified by cloning studies in mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-136-5p
Sequence 15| ACUCCAUUUGUUUUGAUGAUGGA |37
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM3493815 4 COSMIC
COSM9594993 10 COSMIC
COSM5381857 13 COSMIC
COSM5381858 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265741270 12 dbSNP
rs1469776734 13 dbSNP
rs747068235 15 dbSNP
rs757383513 18 dbSNP
rs1465430581 19 dbSNP
rs1190567087 21 dbSNP
rs1386524981 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAC1   
Synonyms MIG5, Rac-1, TC-25, p21-Rac1
Description Rac family small GTPase 1
Transcript NM_006908   
Other Transcripts NM_018890   
Expression
Putative miRNA Targets on RAC1
3'UTR of RAC1
(miRNA target sites are highlighted)		 
>RAC1|NM_006908|3'UTR
   1 ATGTCTCAGCCCCTCGTTCTTGGTCCTGTCCCTTGGAACCTTTGTACGCTTTGCTCAAAAAAAAACAAAAAAAAAAAACA
  81 AAAAAAAAAAACAACGGTGGAGCCTTCGCACTCAATGCCAACTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTT
 161 TGAACCAATCAGTAATTTTAAGGTTTTGTTTGTTCTAAATGTAAGAGTTCAGACTCACATTCTATTAAAATTTAGCCCTA
 241 AAATGACAAGCCTTCTTAAAGCCTTATTTTTCAAAAGCGCCCCCCCCATTCTTGTTCAGATTAAGAGTTGCCAAAATACC
 321 TTCTGAACTACACTGCATTGTTGTGCCGAGAACACCGAGCACTGAACTTTGCAAAGACCTTCGTCTTTGAGAAGACGGTA
 401 GCTTCTGCAGTTAGGAGGTGCAGACACTTGCTCTCCTATGTAGTTCTCAGATGCGTAAAGCAGAACAGCCTCCCGAATGA
 481 AGCGTTGCCATTGAACTCACCAGTGAGTTAGCAGCACGTGTTCCCGACATAACATTGTACTGTAATGGAGTGAGCGTAGC
 561 AGCTCAGCTCTTTGGATCAGTCTTTGTGATTTCATAGCGAGTTTTCTGACCAGCTTTTGCGGAGATTTTGAACAGAACTG
 641 CTATTTCCTCTAATGAAGAATTCTGTTTAGCTGTGGGTGTGCCGGGTGGGGTGTGTGTGATCAAAGGACAAAGACAGTAT
 721 TTTGACAAAATACGAAGTGGAGATTTACACTACATTGTACAAGGAATGAAAGTGTCACGGGTAAAAACTCTAAAAGGTTA
 801 ATTTCTGTCAAATGCAGTAGATGATGAAAGAAAGGTTGGTATTATCAGGAAATGTTTTCTTAAGCTTTTCCTTTCTCTTA
 881 CACCTGCCATGCCTCCCCAAATTGGGCATTTAATTCATCTTTAAACTGGTTGTTCTGTTAGTCGCTAACTTAGTAAGTGC
 961 TTTTCTTATAGAACCCCTTCTGACTGAGCAATATGCCTCCTTGTATTATAAAATCTTTCTGATAATGCATTAGAAGGTTT
1041 TTTTGTCGATTAGTAAAAGTGCTTTCCATGTTACTTTATTCAGAGCTAATAAGTGCTTTCCTTAGTTTTCTAGTAACTAG
1121 GTGTAAAAATCATGTGTTGCAGCTTTATAGTTTTTAAAATATTTTAGATAATTCTTAAACTATGAACCTTCTTAACATCA
1201 CTGTCTTGCCAGATTACCGACACTGTCACTTGACCAATACTGACCCTCTTTACCTCGCCCACGCGGACACACGCCTCCTG
1281 TAGTCGCTTTGCCTATTGATGTTCCTTTGGGTCTGTGAGGTTCTGTAAACTGTGCTAGTGCTGACGATGTTCTGTACAAC
1361 TTAACTCACTGGCGAGAATACAGCGTGGGACCCTTCAGCCACTACAACAGAATTTTTTAAATTGACAGTTGCAGAATTGT
1441 GGAGTGTTTTTACATTGATCTTTTGCTAATGCAATTAGCATTATGTTTTGCATGTATGACTTAATAAATCCTTGAATCAT
1521 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGUA--GUAGUUUUGU-UUACCUCa 5'
            |||  |||:: | :: ||||||| 
Target 5' gaCATAACATTGTACTGTAATGGAGt 3'
 526 - 551 155.00 -11.70
2 
miRNA  3' agguAGUAGUUUUG---UUUACCUCa 5'
              |:: |||||:   ||:||||| 
Target 5' tattTTGACAAAATACGAAGTGGAGa 3'
 718 - 743 147.00 -12.40
3 
miRNA  3' agguaguagUUUUGU--UUACCUCa 5'
                   ||||||  ::||||| 
Target 5' caaaaaaaaAAAACAACGGTGGAGc 3'
 79 - 103 128.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31505813 13 COSMIC
COSN30476381 52 COSMIC
COSN17432309 67 COSMIC
COSN20069945 67 COSMIC
COSN31535636 68 COSMIC
COSN30161944 76 COSMIC
COSN28729012 79 COSMIC
COSN16259428 80 COSMIC
COSN18731867 80 COSMIC
COSN20091511 81 COSMIC
COSN31532813 82 COSMIC
COSN20091512 84 COSMIC
COSN15605499 89 COSMIC
COSN8517428 90 COSMIC
COSN2533822 92 COSMIC
COSN20091513 93 COSMIC
COSN31518309 109 COSMIC
COSN26644067 129 COSMIC
COSN26640374 135 COSMIC
COSN31571666 279 COSMIC
COSN31532650 288 COSMIC
COSN6888601 315 COSMIC
COSN31550544 348 COSMIC
COSN31526506 349 COSMIC
COSN31579961 421 COSMIC
COSN31515916 476 COSMIC
COSN31521904 512 COSMIC
COSN28724803 520 COSMIC
COSN29044412 540 COSMIC
COSN26566795 907 COSMIC
COSN28727152 917 COSMIC
COSN20684842 974 COSMIC
COSN31555354 998 COSMIC
COSN8305666 1068 COSMIC
COSN15663032 1278 COSMIC
COSN31539651 1287 COSMIC
COSN22365392 1305 COSMIC
COSN22488813 1322 COSMIC
COSN24002372 1344 COSMIC
COSN31582515 1411 COSMIC
COSN31539327 1453 COSMIC
COSN24302246 1455 COSMIC
COSN31487449 1458 COSMIC
COSN31588302 1482 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1182478201 3 dbSNP
rs551209067 4 dbSNP
rs747446057 5 dbSNP
rs1416607213 11 dbSNP
rs34140491 12 dbSNP
rs774393501 15 dbSNP
rs970144899 16 dbSNP
rs201247499 17 dbSNP
rs780518597 20 dbSNP
rs866033200 22 dbSNP
rs916666566 23 dbSNP
rs555136675 24 dbSNP
rs775934071 28 dbSNP
rs566950515 31 dbSNP
rs771454358 31 dbSNP
rs748108279 33 dbSNP
rs757739241 35 dbSNP
rs1465138168 37 dbSNP
rs1279085861 48 dbSNP
rs1312724911 49 dbSNP
rs767081694 52 dbSNP
rs1381987413 53 dbSNP
rs1244028985 55 dbSNP
rs1377555716 55 dbSNP
rs1166104605 56 dbSNP
rs1304278830 56 dbSNP
rs1409488013 56 dbSNP
rs1417391229 56 dbSNP
rs1424239966 56 dbSNP
rs796691511 56 dbSNP
rs1231871206 57 dbSNP
rs1293190817 57 dbSNP
rs1484553436 57 dbSNP
rs763876723 57 dbSNP
rs867936578 57 dbSNP
rs1303653047 58 dbSNP
rs946552096 58 dbSNP
rs1043576518 59 dbSNP
rs1331046577 59 dbSNP
rs1352971070 59 dbSNP
rs1164068150 60 dbSNP
rs1401001083 60 dbSNP
rs1474120284 60 dbSNP
rs1182099611 61 dbSNP
rs1415607359 61 dbSNP
rs1465552463 61 dbSNP
rs1200035787 62 dbSNP
rs1230785604 62 dbSNP
rs1457781539 62 dbSNP
rs1212290485 63 dbSNP
rs1273141109 63 dbSNP
rs1323888791 63 dbSNP
rs200708039 64 dbSNP
rs756522639 64 dbSNP
rs773357267 64 dbSNP
rs1311715857 65 dbSNP
rs571090671 65 dbSNP
rs1370289499 66 dbSNP
rs59685280 66 dbSNP
rs1456277019 67 dbSNP
rs2303366 67 dbSNP
rs902427752 67 dbSNP
rs1165269331 68 dbSNP
rs749525692 68 dbSNP
rs1266519060 69 dbSNP
rs1439775798 69 dbSNP
rs999372877 69 dbSNP
rs1215588269 70 dbSNP
rs908346557 70 dbSNP
rs1301414312 71 dbSNP
rs1369699677 71 dbSNP
rs1388588575 71 dbSNP
rs1059223 72 dbSNP
rs1293989720 72 dbSNP
rs1394094306 73 dbSNP
rs1434377732 73 dbSNP
rs764941203 73 dbSNP
rs1268696847 74 dbSNP
rs567222182 74 dbSNP
rs577869801 74 dbSNP
rs1485101417 75 dbSNP
rs538417726 75 dbSNP
rs932429182 75 dbSNP
rs1217790976 76 dbSNP
rs1278430350 76 dbSNP
rs35359875 76 dbSNP
rs1312805789 77 dbSNP
rs557217236 77 dbSNP
rs1188189625 78 dbSNP
rs1008439681 79 dbSNP
rs61124997 79 dbSNP
rs1170377612 80 dbSNP
rs1377633444 80 dbSNP
rs1400344304 80 dbSNP
rs1467164933 80 dbSNP
rs1477162136 80 dbSNP
rs2303367 80 dbSNP
rs1426407280 81 dbSNP
rs866074948 81 dbSNP
rs1053799259 82 dbSNP
rs1225323747 82 dbSNP
rs891935382 83 dbSNP
rs951809960 83 dbSNP
rs1354544439 84 dbSNP
rs372877887 84 dbSNP
rs1397360010 85 dbSNP
rs560677179 85 dbSNP
rs1297169960 86 dbSNP
rs561883842 86 dbSNP
rs1403112556 87 dbSNP
rs1001610002 88 dbSNP
rs1475086944 89 dbSNP
rs1017136867 90 dbSNP
rs1424681356 90 dbSNP
rs777572979 90 dbSNP
rs1491166978 91 dbSNP
rs960317646 91 dbSNP
rs1491572747 92 dbSNP
rs992059776 92 dbSNP
rs1015912154 93 dbSNP
rs1263518009 96 dbSNP
rs961340166 96 dbSNP
rs1173614344 97 dbSNP
rs1156644036 104 dbSNP
rs1340740963 105 dbSNP
rs973896905 108 dbSNP
rs1443974023 109 dbSNP
rs1425157281 111 dbSNP
rs919792249 112 dbSNP
rs1320741095 116 dbSNP
rs960952155 122 dbSNP
rs16871368 128 dbSNP
rs1435307273 131 dbSNP
rs932355591 133 dbSNP
rs1165399679 140 dbSNP
rs1409664621 155 dbSNP
rs1363467193 156 dbSNP
rs1176964405 166 dbSNP
rs1362319411 166 dbSNP
rs1442539875 167 dbSNP
rs370215539 183 dbSNP
rs1193073455 192 dbSNP
rs368834331 196 dbSNP
rs36030054 197 dbSNP
rs1287605486 198 dbSNP
rs1211469159 201 dbSNP
rs990877710 202 dbSNP
rs1356737276 208 dbSNP
rs985208678 209 dbSNP
rs912208125 211 dbSNP
rs1355386383 214 dbSNP
rs1344269759 220 dbSNP
rs761465378 221 dbSNP
rs764853005 223 dbSNP
rs1286026073 224 dbSNP
rs1329643086 236 dbSNP
rs1208272882 238 dbSNP
rs1052818282 247 dbSNP
rs1246440211 252 dbSNP
rs892024550 253 dbSNP
rs947704541 254 dbSNP
rs1043200445 255 dbSNP
rs1384623428 258 dbSNP
rs1157098780 262 dbSNP
rs539906640 267 dbSNP
rs1421818528 275 dbSNP
rs906050171 279 dbSNP
rs1001536228 280 dbSNP
rs201711136 280 dbSNP
rs923745507 280 dbSNP
rs935185168 280 dbSNP
rs1040653467 282 dbSNP
rs901796664 283 dbSNP
rs1286252667 285 dbSNP
rs1469868891 286 dbSNP
rs1035748704 287 dbSNP
rs114923537 288 dbSNP
rs1402205304 293 dbSNP
rs1361467748 294 dbSNP
rs9374 295 dbSNP
rs1014963656 296 dbSNP
rs1160827940 297 dbSNP
rs1427286948 298 dbSNP
rs1413068445 300 dbSNP
rs1478352671 303 dbSNP
rs961581808 303 dbSNP
rs1014695653 306 dbSNP
rs961505468 308 dbSNP
rs1489118656 309 dbSNP
rs1263491403 315 dbSNP
rs1457054129 317 dbSNP
rs973993462 324 dbSNP
rs1208911158 326 dbSNP
rs1440214794 331 dbSNP
rs1026780077 333 dbSNP
rs953876837 334 dbSNP
rs950958927 337 dbSNP
rs1280202185 338 dbSNP
rs1157937761 339 dbSNP
rs994350428 342 dbSNP
rs985181066 348 dbSNP
rs1220873646 349 dbSNP
rs1387975330 350 dbSNP
rs1292920269 355 dbSNP
rs12977 357 dbSNP
rs569519190 358 dbSNP
rs943826535 363 dbSNP
rs916605897 368 dbSNP
rs751417028 369 dbSNP
rs1434158488 375 dbSNP
rs1281217216 378 dbSNP
rs988881290 379 dbSNP
rs1227623151 380 dbSNP
rs979450314 383 dbSNP
rs1181057782 384 dbSNP
rs912933812 386 dbSNP
rs947608448 395 dbSNP
rs1238815338 397 dbSNP
rs1266470787 398 dbSNP
rs1337277872 403 dbSNP
rs34625328 405 dbSNP
rs1256751467 411 dbSNP
rs927443723 414 dbSNP
rs1319193151 422 dbSNP
rs937495638 424 dbSNP
rs539108343 426 dbSNP
rs1381677312 427 dbSNP
rs1449973769 427 dbSNP
rs1284949732 431 dbSNP
rs895883866 432 dbSNP
rs1374668150 433 dbSNP
rs1184521662 434 dbSNP
rs1005000440 436 dbSNP
rs1036738067 438 dbSNP
rs899167662 439 dbSNP
rs1400939509 440 dbSNP
rs781547027 446 dbSNP
rs1026917635 455 dbSNP
rs548626083 456 dbSNP
rs1163439153 462 dbSNP
rs836552 468 dbSNP
rs1235888347 469 dbSNP
rs1179965931 473 dbSNP
rs1163513848 476 dbSNP
rs1246614964 479 dbSNP
rs887414228 484 dbSNP
rs1019483691 485 dbSNP
rs941685798 490 dbSNP
rs534300530 491 dbSNP
rs1311646583 496 dbSNP
rs1351770504 496 dbSNP
rs965495464 500 dbSNP
rs988589302 503 dbSNP
rs1447573236 506 dbSNP
rs774626708 510 dbSNP
rs1374034015 511 dbSNP
rs559042866 515 dbSNP
rs1434072990 518 dbSNP
rs897613835 519 dbSNP
rs994738680 522 dbSNP
rs1378064243 524 dbSNP
rs769811766 526 dbSNP
rs1439718949 527 dbSNP
rs576097646 528 dbSNP
rs1035225811 529 dbSNP
rs968376081 530 dbSNP
rs1247718447 531 dbSNP
rs978425027 533 dbSNP
rs1216343303 542 dbSNP
rs896713851 545 dbSNP
rs1245748203 551 dbSNP
rs1012478753 552 dbSNP
rs1240994553 556 dbSNP
rs927529916 557 dbSNP
rs967980661 558 dbSNP
rs937631392 565 dbSNP
rs979440387 571 dbSNP
rs1303575855 578 dbSNP
rs777835910 582 dbSNP
rs1283829821 583 dbSNP
rs1057481186 595 dbSNP
rs749756940 599 dbSNP
rs917431685 600 dbSNP
rs1173331757 601 dbSNP
rs11540454 607 dbSNP
rs956839787 614 dbSNP
rs940731630 621 dbSNP
rs1036465748 622 dbSNP
rs1477018767 623 dbSNP
rs1275932473 625 dbSNP
rs1265654864 626 dbSNP
rs899135374 631 dbSNP
rs571397435 640 dbSNP
rs1050442005 655 dbSNP
rs1254406866 655 dbSNP
rs1259998381 662 dbSNP
rs1313930856 667 dbSNP
rs1217815281 669 dbSNP
rs1283790828 669 dbSNP
rs889704483 674 dbSNP
rs1338058947 680 dbSNP
rs774560309 684 dbSNP
rs538816597 685 dbSNP
rs1187743508 686 dbSNP
rs557006972 687 dbSNP
rs1384247787 690 dbSNP
rs1300612651 691 dbSNP
rs1467116114 691 dbSNP
rs1407506599 699 dbSNP
rs965246899 703 dbSNP
rs760010477 707 dbSNP
rs1426158556 712 dbSNP
rs141377991 714 dbSNP
rs36059496 714 dbSNP
rs897558664 715 dbSNP
rs1020047318 716 dbSNP
rs551435881 717 dbSNP
rs1057305364 726 dbSNP
rs1483596324 727 dbSNP
rs575473267 734 dbSNP
rs1428976751 735 dbSNP
rs1012370229 746 dbSNP
rs543502045 749 dbSNP
rs968461700 757 dbSNP
rs1023838589 760 dbSNP
rs904145449 761 dbSNP
rs542485609 768 dbSNP
rs1397302393 769 dbSNP
rs1333745731 772 dbSNP
rs926992932 779 dbSNP
rs1230668599 780 dbSNP
rs1168902265 781 dbSNP
rs112102014 783 dbSNP
rs956940129 791 dbSNP
rs976163614 793 dbSNP
rs1167095199 798 dbSNP
rs1341583175 802 dbSNP
rs554159470 806 dbSNP
rs1237706163 812 dbSNP
rs1176848828 814 dbSNP
rs1456421406 815 dbSNP
rs879032072 819 dbSNP
rs200099418 820 dbSNP
rs60010350 820 dbSNP
rs1224489002 824 dbSNP
rs776663992 826 dbSNP
rs1355334590 827 dbSNP
rs572460244 831 dbSNP
rs569685951 835 dbSNP
rs556508707 838 dbSNP
rs768175198 844 dbSNP
rs1307983285 845 dbSNP
rs917381640 846 dbSNP
rs1190139511 848 dbSNP
rs539986428 849 dbSNP
rs770607361 853 dbSNP
rs1330094777 854 dbSNP
rs1386568208 858 dbSNP
rs1388948258 862 dbSNP
rs1295635252 866 dbSNP
rs1448357345 869 dbSNP
rs1425604570 871 dbSNP
rs1379880929 872 dbSNP
rs1156986858 876 dbSNP
rs1441573006 880 dbSNP
rs972669602 882 dbSNP
rs1365500799 893 dbSNP
rs909122683 897 dbSNP
rs373871719 901 dbSNP
rs1490425151 917 dbSNP
rs1379363573 929 dbSNP
rs6951997 932 dbSNP
rs1171846233 935 dbSNP
rs1050409572 944 dbSNP
rs556311804 945 dbSNP
rs938361852 946 dbSNP
rs532631334 950 dbSNP
rs1437467008 952 dbSNP
rs761562585 954 dbSNP
rs1321505488 957 dbSNP
rs1360160056 965 dbSNP
rs544771570 970 dbSNP
rs199612194 971 dbSNP
rs1421600954 976 dbSNP
rs1385688207 978 dbSNP
rs915682651 979 dbSNP
rs1172055805 985 dbSNP
rs1433051231 985 dbSNP
rs1477696887 986 dbSNP
rs759631104 988 dbSNP
rs1201342249 998 dbSNP
rs1480616981 1014 dbSNP
rs1045235905 1016 dbSNP
rs1313364067 1018 dbSNP
rs1448353180 1024 dbSNP
rs1040986189 1027 dbSNP
rs900974469 1029 dbSNP
rs139209076 1032 dbSNP
rs35850876 1032 dbSNP
rs1276557612 1038 dbSNP
rs1285695887 1038 dbSNP
rs1340220591 1038 dbSNP
rs562915357 1038 dbSNP
rs530441112 1047 dbSNP
rs904271163 1048 dbSNP
rs999907435 1049 dbSNP
rs1210158005 1053 dbSNP
rs1400018956 1057 dbSNP
rs1248278864 1059 dbSNP
rs1178416183 1067 dbSNP
rs1464027614 1069 dbSNP
rs1422723721 1083 dbSNP
rs892432313 1087 dbSNP
rs1033936578 1090 dbSNP
rs958384191 1102 dbSNP
rs1242313405 1104 dbSNP
rs1186257587 1114 dbSNP
rs1186202343 1122 dbSNP
rs1440160130 1131 dbSNP
rs761242391 1132 dbSNP
rs1204806407 1134 dbSNP
rs1317829996 1140 dbSNP
rs997928641 1149 dbSNP
rs1340383961 1151 dbSNP
rs1433646584 1151 dbSNP
rs993458281 1155 dbSNP
rs1337454632 1160 dbSNP
rs1342281971 1160 dbSNP
rs1453366164 1162 dbSNP
rs183208469 1169 dbSNP
rs1168330132 1172 dbSNP
rs1411398393 1176 dbSNP
rs976621022 1176 dbSNP
rs1162213396 1177 dbSNP
rs1471533746 1182 dbSNP
rs1007387727 1183 dbSNP
rs1016130940 1188 dbSNP
rs1457742662 1188 dbSNP
rs1236862963 1204 dbSNP
rs1207100963 1209 dbSNP
rs1024546694 1213 dbSNP
rs749974320 1219 dbSNP
rs566872985 1220 dbSNP
rs762960704 1221 dbSNP
rs766381651 1226 dbSNP
rs1361851231 1229 dbSNP
rs919168444 1231 dbSNP
rs1239485347 1236 dbSNP
rs959728138 1238 dbSNP
rs1296340679 1244 dbSNP
rs930681808 1246 dbSNP
rs112118570 1247 dbSNP
rs1295420808 1249 dbSNP
rs1322636716 1255 dbSNP
rs1403317750 1257 dbSNP
rs35197465 1257 dbSNP
rs1386678327 1258 dbSNP
rs910534664 1262 dbSNP
rs944738632 1263 dbSNP
rs1438492756 1264 dbSNP
rs1040807424 1265 dbSNP
rs901085296 1266 dbSNP
rs34144836 1267 dbSNP
rs554210282 1267 dbSNP
rs1352659166 1269 dbSNP
rs1246554258 1273 dbSNP
rs936849545 1274 dbSNP
rs1052662573 1278 dbSNP
rs1292711862 1280 dbSNP
rs1328126722 1281 dbSNP
rs1213234159 1282 dbSNP
rs368738077 1283 dbSNP
rs1266627882 1286 dbSNP
rs373918915 1287 dbSNP
rs1190505177 1288 dbSNP
rs945987849 1293 dbSNP
rs997520612 1294 dbSNP
rs754860731 1296 dbSNP
rs1473432147 1309 dbSNP
rs1402851907 1310 dbSNP
rs889188425 1312 dbSNP
rs1303308175 1318 dbSNP
rs1182717754 1322 dbSNP
rs760743675 1325 dbSNP
rs1418571799 1331 dbSNP
rs904366046 1332 dbSNP
rs1007626742 1336 dbSNP
rs1420246919 1336 dbSNP
rs999877880 1338 dbSNP
rs780862406 1344 dbSNP
rs894244138 1347 dbSNP
rs1350497784 1350 dbSNP
rs527680624 1351 dbSNP
rs1457486431 1352 dbSNP
rs1292265567 1358 dbSNP
rs1269877403 1359 dbSNP
rs14627 1360 dbSNP
rs1410817951 1363 dbSNP
rs1487423839 1363 dbSNP
rs1262636807 1366 dbSNP
rs570907419 1374 dbSNP
rs1026221013 1375 dbSNP
rs188629172 1377 dbSNP
rs972734797 1379 dbSNP
rs550772240 1385 dbSNP
rs992486547 1386 dbSNP
rs1022562528 1389 dbSNP
rs952210641 1394 dbSNP
rs1290168510 1397 dbSNP
rs1453790059 1400 dbSNP
rs1359124840 1401 dbSNP
rs986187329 1405 dbSNP
rs1174818794 1408 dbSNP
rs1471169778 1409 dbSNP
rs1321772252 1411 dbSNP
rs910628001 1412 dbSNP
rs1220239687 1419 dbSNP
rs1476987728 1428 dbSNP
rs978447791 1430 dbSNP
rs34737129 1431 dbSNP
rs976099912 1436 dbSNP
rs1482946100 1439 dbSNP
rs913897124 1443 dbSNP
rs572403740 1445 dbSNP
rs1205798690 1447 dbSNP
rs988749025 1449 dbSNP
rs1250710399 1454 dbSNP
rs1041635030 1455 dbSNP
rs1305427550 1458 dbSNP
rs146672210 1467 dbSNP
rs1414855276 1468 dbSNP
rs191733007 1475 dbSNP
rs1377740353 1480 dbSNP
rs1162845179 1482 dbSNP
rs1055575581 1493 dbSNP
rs1455116963 1494 dbSNP
rs894224045 1497 dbSNP
rs1392120508 1501 dbSNP
rs762280506 1505 dbSNP
rs1170477466 1510 dbSNP
rs183171680 1511 dbSNP
rs1307997335 1518 dbSNP
rs187853103 1520 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5879.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5879.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000348035.4 | 3UTR | ACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000348035.4 | 3UTR | ACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000348035.4 | 3UTR | ACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000348035.4 | 3UTR | ACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000348035.4 | 3UTR | UUCCCGACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000348035.4 | 3UTR | ACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000348035.4 | 3UTR | UUCCCGACAUAACAUUGUACUGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.644 3.4e-4 0.709 5.3e-5 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.652 9.2e-4 -0.565 4.7e-3 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.555 3.0e-3 0.419 2.3e-2 23 Click to see details
GSE17306 Multiple myeloma 0.372 4.2e-3 0.212 7.2e-2 49 Click to see details
GSE19783 ER- ER- breast cancer -0.281 6.1e-3 -0.144 1.0e-1 79 Click to see details
GSE19350 CNS germ cell tumors -0.579 2.4e-2 -0.308 1.7e-1 12 Click to see details
GSE19536 Breast cancer -0.194 2.7e-2 -0.161 5.5e-2 100 Click to see details
GSE32688 Pancreatic cancer -0.193 1.4e-1 -0.112 2.7e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.281 1.5e-1 0.376 7.6e-2 16 Click to see details
GSE21687 Ependynoma primary tumors -0.118 1.8e-1 -0.154 1.1e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.218 1.8e-1 0.254 1.4e-1 20 Click to see details
GSE17498 Multiple myeloma 0.142 1.9e-1 0.126 2.2e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.087 2.1e-1 -0.167 5.8e-2 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.156 2.3e-1 -0.048 4.1e-1 25 Click to see details
GSE21849 B cell lymphoma 0.116 2.7e-1 0.451 7.0e-3 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.092 3.3e-1 0.310 6.6e-2 25 Click to see details
GSE38226 Liver fibrosis -0.081 3.6e-1 -0.114 3.1e-1 21 Click to see details
GSE21032 Prostate cancer 0.034 3.8e-1 0.089 2.1e-1 83 Click to see details
GSE26953 Aortic valvular endothelial cells 0.053 4.0e-1 -0.035 4.4e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.066 4.3e-1 -0.167 3.3e-1 9 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD -0.988 0.01 -1.000 0.5 4 Click to see details
LUAD 0.581 0.02 0.657 0.01 12 Click to see details
STAD 0.327 0.03 0.480 0 32 Click to see details
HNSC -0.282 0.04 -0.272 0.04 42 Click to see details
CHOL 0.475 0.1 0.433 0.12 9 Click to see details
PAAD -0.704 0.15 -0.800 0.1 4 Click to see details
KIRP 0.188 0.15 0.164 0.18 32 Click to see details
UCEC -0.224 0.18 -0.172 0.24 19 Click to see details
BRCA -0.095 0.2 -0.048 0.33 84 Click to see details
THCA -0.077 0.28 0.031 0.41 57 Click to see details
LUSC -0.093 0.29 0.102 0.27 38 Click to see details
KIRC 0.065 0.3 0.056 0.33 68 Click to see details
CESC -0.39 0.37 -0.500 0.33 3 Click to see details
BLCA 0.061 0.4 0.090 0.36 18 Click to see details
KICH -0.015 0.47 0.000 0.5 25 Click to see details
PRAD -0.009 0.48 -0.153 0.14 50 Click to see details
PCPG 0.051 0.48 -0.500 0.33 3 Click to see details
LIHC 0.005 0.49 0.053 0.36 49 Click to see details
ESCA -0.002 0.5 -0.091 0.4 11 Click to see details
ESCA -0.002 0.5 -0.091 0.4 11 Click to see details
ESCA -0.002 0.5 -0.091 0.4 11 Click to see details
154 hsa-miR-136-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006867 MTDH metadherin 3 1
MIRT006868 BCL2 BCL2, apoptosis regulator 1 1
MIRT104077 RAC1 Rac family small GTPase 1 2 10
MIRT213511 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT387257 SOX9 SRY-box 9 2 2
MIRT404278 PURB purine rich element binding protein B 2 2
MIRT438060 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 3 1
MIRT439203 ZNF429 zinc finger protein 429 1 1
MIRT439242 ZCRB1 zinc finger CCHC-type and RNA binding motif containing 1 1 1
MIRT439351 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT439353 UBQLN1 ubiquilin 1 1 1
MIRT439365 UBE2D3 ubiquitin conjugating enzyme E2 D3 1 1
MIRT439431 TMEM30A transmembrane protein 30A 1 1
MIRT439468 TFRC transferrin receptor 1 1
MIRT439530 STAG2 stromal antigen 2 1 1
MIRT439572 SNX13 sorting nexin 13 1 1
MIRT439576 SNAP25 synaptosome associated protein 25 1 1
MIRT439701 SCARB2 scavenger receptor class B member 2 1 1
MIRT439754 RNF6 ring finger protein 6 1 1
MIRT439841 RAB21 RAB21, member RAS oncogene family 1 1
MIRT439946 PLOD2 procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 1 1
MIRT439948 PLEKHA6 pleckstrin homology domain containing A6 1 1
MIRT439990 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT440001 PERP PERP, TP53 apoptosis effector 1 1
MIRT440028 PCLO piccolo presynaptic cytomatrix protein 1 1
MIRT440077 NUDT3 nudix hydrolase 3 1 1
MIRT440079 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT440107 NIPBL NIPBL, cohesin loading factor 1 1
MIRT440148 NARS asparaginyl-tRNA synthetase 1 1
MIRT440196 MTPN myotrophin 1 1
MIRT440203 MTMR4 myotubularin related protein 4 1 1
MIRT440295 MADD MAP kinase activating death domain 1 1
MIRT440302 LUZP6 leucine zipper protein 6 1 1
MIRT440330 LGALS8 galectin 8 1 1
MIRT440344 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT440398 KDM5A lysine demethylase 5A 1 1
MIRT440502 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT440527 H2AFV H2A histone family member V 1 1
MIRT440553 GNAS GNAS complex locus 1 1
MIRT440574 GGA1 golgi associated, gamma adaptin ear containing, ARF binding protein 1 1 1
MIRT440623 FNIP1 folliculin interacting protein 1 1 1
MIRT440690 FAM105A family with sequence similarity 105 member A 1 1
MIRT440731 EIF4G3 eukaryotic translation initiation factor 4 gamma 3 1 1
MIRT440772 DST dystonin 1 1
MIRT441008 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441027 CACNA1D calcium voltage-gated channel subunit alpha1 D 1 1
MIRT441172 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT441303 ABI2 abl interactor 2 1 1
MIRT441310 ABCC8 ATP binding cassette subfamily C member 8 1 1
MIRT454544 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT457253 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT463197 ZNF148 zinc finger protein 148 2 4
MIRT465732 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT476922 FBLIM1 filamin binding LIM protein 1 2 2
MIRT477708 EFHD2 EF-hand domain family member D2 2 2
MIRT506318 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT507922 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT513679 SLC38A1 solute carrier family 38 member 1 2 2
MIRT528015 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528780 FCGR3B Fc fragment of IgG receptor IIIb 2 2
MIRT529636 ZNF621 zinc finger protein 621 2 2
MIRT532161 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT532745 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT534214 SLC37A3 solute carrier family 37 member 3 2 4
MIRT544778 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT553854 SYDE2 synapse defective Rho GTPase homolog 2 2 2
MIRT554051 SOCS7 suppressor of cytokine signaling 7 2 2
MIRT557741 FUT4 fucosyltransferase 4 2 2
MIRT558903 CCDC58 coiled-coil domain containing 58 2 2
MIRT562347 EXOSC2 exosome component 2 2 2
MIRT562614 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT566322 POTEM POTE ankyrin domain family member M 2 2
MIRT566333 POTEG POTE ankyrin domain family member G 2 2
MIRT570178 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT570833 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT571888 MSL2 MSL complex subunit 2 2 2
MIRT615151 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 2
MIRT619071 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619559 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT621353 GUCA1B guanylate cyclase activator 1B 2 2
MIRT624082 DR1 down-regulator of transcription 1 2 2
MIRT624263 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT625027 ZNF730 zinc finger protein 730 2 2
MIRT625283 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT630596 C2CD2 C2 calcium dependent domain containing 2 2 2
MIRT634452 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT641251 CENPN centromere protein N 2 2
MIRT641398 NUBPL nucleotide binding protein like 2 2
MIRT643485 DISC1 disrupted in schizophrenia 1 2 2
MIRT644642 ICA1L islet cell autoantigen 1 like 2 2
MIRT644655 SNX9 sorting nexin 9 2 2
MIRT644833 SEC14L4 SEC14 like lipid binding 4 2 2
MIRT645323 GPR158 G protein-coupled receptor 158 2 2
MIRT646107 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT647885 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT648026 ZDHHC24 zinc finger DHHC-type containing 24 2 2
MIRT648537 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT648550 CCDC140 coiled-coil domain containing 140 2 2
MIRT649220 ZNF614 zinc finger protein 614 2 2
MIRT649561 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT650886 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT651191 ZNF281 zinc finger protein 281 2 2
MIRT652501 TMEM170A transmembrane protein 170A 2 2
MIRT653960 SEPN1 selenoprotein N 2 2
MIRT654316 RBM8A RNA binding motif protein 8A 2 2
MIRT654379 RBM12B RNA binding motif protein 12B 2 2
MIRT654396 RBFOX2 RNA binding protein, fox-1 homolog 2 2 2
MIRT655282 PER1 period circadian clock 1 2 2
MIRT655498 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT656307 METTL1 methyltransferase like 1 2 2
MIRT656396 MCU mitochondrial calcium uniporter 2 2
MIRT657954 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658453 FAM13B family with sequence similarity 13 member B 2 2
MIRT659145 DDHD1 DDHD domain containing 1 2 2
MIRT660427 ATXN1 ataxin 1 2 2
MIRT660880 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT661004 ABHD10 abhydrolase domain containing 10 2 2
MIRT663678 CCDC18 coiled-coil domain containing 18 2 2
MIRT682290 RLIM ring finger protein, LIM domain interacting 2 2
MIRT688370 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT707382 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708271 EGLN2 egl-9 family hypoxia inducible factor 2 2 2
MIRT708509 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT708611 CCDC71L coiled-coil domain containing 71 like 2 2
MIRT708654 LYRM7 LYR motif containing 7 2 2
MIRT708970 SLC12A3 solute carrier family 12 member 3 2 2
MIRT709252 CENPM centromere protein M 2 2
MIRT710540 SERINC1 serine incorporator 1 2 2
MIRT712085 UNC13A unc-13 homolog A 2 2
MIRT712466 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712940 GALP galanin like peptide 2 2
MIRT715227 NPVF neuropeptide VF precursor 2 2
MIRT715853 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT716111 GMPS guanine monophosphate synthase 2 2
MIRT716486 SAMD7 sterile alpha motif domain containing 7 2 2
MIRT717245 HLA-DRB5 major histocompatibility complex, class II, DR beta 5 2 2
MIRT718155 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT720260 FAM83F family with sequence similarity 83 member F 2 2
MIRT720584 FAM9C family with sequence similarity 9 member C 2 2
MIRT720912 PILRB paired immunoglobin-like type 2 receptor beta 2 2
MIRT721989 FAM214B family with sequence similarity 214 member B 2 2
MIRT722365 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT722912 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT724442 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT724490 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT724632 NR1H2 nuclear receptor subfamily 1 group H member 2 2 2
MIRT725504 GANAB glucosidase II alpha subunit 2 2
MIRT725525 FAM229B family with sequence similarity 229 member B 2 2
MIRT732668 ROCK1 Rho associated coiled-coil containing protein kinase 1 3 0
MIRT737244 CRNDE colorectal neoplasia differentially expressed 3 0
MIRT737313 TLK1 tousled like kinase 1 4 0
MIRT737314 CBX4 chromobox 4 4 0
MIRT755884 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 1
MIRT756000 TWSG1 twisted gastrulation BMP signaling modulator 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-136 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-136 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-136-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-136-5p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 resistant
hsa-miR-136-5p (1Z)-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-(2-methylanilino)-2-oxoethanimidoyl cyanide 5466280 NSC683608 resistant
hsa-miR-136-5p (2,4-dinitrophenyl)methyl carbamimidothioate;chloride 24183838 NSC30637 resistant
hsa-miR-136-5p (2e)-2-[(4-chloroanilino)methylidene]-3-methyl-1-oxopyrido[1,2-a]benzimidazole-4-carbonitrile 5456998 NSC712423 sensitive
hsa-miR-136-5p (2E)-2-[(4-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988775 NSC639512 resistant
hsa-miR-136-5p (2E)-2-benzylidene-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468410 NSC669732 resistant
hsa-miR-136-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-136-5p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 resistant
hsa-miR-136-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-136-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-136-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-136-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-136-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-136-5p (3s,8r,9s,10r,13s,14s,16e,17s)-10,13-dimethyl-16-(pyridin-3-ylmethylidene)-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthrene-3,17-diol 5472448 NSC718809 sensitive
hsa-miR-136-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-136-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-136-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-136-5p (4e)-2-(2-hydroxybenzoyl)-5-methyl-4-[(3-nitrophenyl)methylene]pyrazol-3-one NSC652176 sensitive
hsa-miR-136-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-136-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-136-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-136-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-136-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-136-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-136-5p (5s,8ar)-5-[2-(dimethylamino)ethylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374337 NSC651861 sensitive
hsa-miR-136-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 374326 NSC651850 sensitive
hsa-miR-136-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374327 NSC651851 sensitive
hsa-miR-136-5p (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-136-5p (5s,8r,8ar)-5-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[5,6-f][1,3]benzodioxol-8-ol 378226 NSC660029 sensitive
hsa-miR-136-5p (6aS)-3-[5-[[(6aS)-8-fluoro-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]pentoxy]-8-fluoro-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 24203387 NSC727729 sensitive
hsa-miR-136-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-136-5p (9S)-9-acetyl-7-(3-fluoro-4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-8,10-dihydro-7H-tetracene-5,12-dione 6712215 NSC659948 sensitive
hsa-miR-136-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 resistant
hsa-miR-136-5p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 sensitive
hsa-miR-136-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-136-5p (E)-3-(3,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 53362837 NSC750054 resistant
hsa-miR-136-5p (E)-4-methyl-1-[(E)-4-methyl-3-oxopent-1-enyl]sulfanylpent-1-en-3-one 5473097 NSC723655 resistant
hsa-miR-136-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-136-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-136-5p (Z)-1-(4-bromophenyl)-2-(morpholin-4-ylmethyl)-3-phenylprop-2-en-1-one;hydrobromide 24193247 NSC150311 resistant
hsa-miR-136-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-136-5p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 resistant
hsa-miR-136-5p [(3S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-4,5-dioxo-3-(1-phenylprop-2-enyl)oxolan-3-yl] acetate 386050 NSC677617 resistant
hsa-miR-136-5p [(3S,8R,9S,10R,13S,14S,16Z,17E)-16-benzylidene-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 9572078 NSC701570 resistant
hsa-miR-136-5p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 resistant
hsa-miR-136-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-136-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-136-5p [(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl] 1H-indole-2-carboxylate 396302 NSC702015 resistant
hsa-miR-136-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-136-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-136-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-136-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-(4-cyanophenyl)carbamate 5466030 NSC672058 resistant
hsa-miR-136-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-136-5p [(E)-1-chloropropylideneamino] N-(4-methoxyphenyl)carbamate 5466263 NSC682833 resistant
hsa-miR-136-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(3,4-dichlorophenyl)carbamate 9556246 NSC682823 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(5-chloro-2-methoxyphenyl)carbamate 9556260 NSC682838 resistant
hsa-miR-136-5p [(z)-[4-(2,4-dichloroanilino)-2-oxo-1-naphthylidene]amino]thiourea 3000994 NSC657676 sensitive
hsa-miR-136-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-136-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-136-5p [2-(4-methoxyphenyl)quinolin-4-yl]-piperidin-2-ylmethanol;dihydrochloride 91885392 NSC23925 resistant
hsa-miR-136-5p [3-[5-[3,5-dihydroxy-4-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-3-hydroxy-6-methyl-4-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl] (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[4,5-dihydroxy-6-(hydroxymethyl)-3-[3,4,5-trihydroxy-6-(hydr 385523 NSC676775 resistant
hsa-miR-136-5p [3,4-dihydroxy-5-[4-(octadecylamino)-2-oxopyrimidin-1-yl]oxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 392613 NSC693169 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-6-(4-methoxyphenyl)-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383442 NSC671809 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-6-phenyl-2-sulfanyl-4H-pyridin-1-yl]oxan-2-yl]methyl acetate 381302 NSC667739 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-4-phenyl-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383439 NSC671806 sensitive
hsa-miR-136-5p [4-[[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]methyl]phenyl]-phenylmethanone;(Z)-but-2-enedioic acid 5351430 NSC676963 resistant
hsa-miR-136-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-136-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-136-5p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 resistant
hsa-miR-136-5p 1-((2-(4-chlorophenyl)-4-methylene-5-oxotetrahydro-2-furanyl)methyl)-2,4(1h,3h)-pyrimidinedione 381498 NSC668254 resistant
hsa-miR-136-5p 1-(2-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465914 NSC668323 resistant
hsa-miR-136-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-136-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-136-5p 1-(3-diethylarsino-3-thio-2-methyl-1-oxopropyl)-l-proline 24203225 NSC727224 resistant
hsa-miR-136-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-136-5p 1-[(2r,4s,10r,12s)-3,11-dioxahexacyclo[7.7.2.02,4.05,18.010,12.013,17]octadeca-1(16),5,7,9(18),13(17),14-hexaen-6-yl]ethanone 397369 NSC705022 resistant
hsa-miR-136-5p 1-[(E)-1-[4-[methyl(phenyl)sulfamoyl]phenyl]ethylideneamino]-3-propylthiourea 5466445 NSC691415 sensitive
hsa-miR-136-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-136-5p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 sensitive
hsa-miR-136-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methoxyphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155810023 NSC762555 sensitive
hsa-miR-136-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-136-5p 1-[4-(4-nitrophenyl)-1,3-dithiol-2-ylidene]piperidin-1-ium 431958 NSC301189 sensitive
hsa-miR-136-5p 1-adamantyl(3-(4-hydroxyphenyl)-2-oxiranyl)methanone 386287 NSC678044 resistant
hsa-miR-136-5p 1-azido-2-formyl-benzo[ij]quinolizin-3-one 381901 NSC669158 resistant
hsa-miR-136-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-136-5p 10,11-dibromo-5h-dibenzo(a,d)cyclohepten-5-one 339483 NSC366220 resistant
hsa-miR-136-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-136-5p 15-[(11-oxo-3,10-diazapentacyclo[10.7.1.02,10.04,9.016,20]icosa-1(19),2,4,6,8,12(20),13,15,17-nonaen-15-yl)sulfonyl]-3,10-diazapentacyclo[10.7.1.02,10.04,9.016,20]icosa-1(19),2,4,6,8,12(20),13,15,17-n 341016 NSC372364 sensitive
hsa-miR-136-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-136-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-136-5p 18,20-dioxa-3,11,24-triazahexacyclo[12.10.0.02,11.04,9.015,23.017,21]tetracosa-1(14),2,4,6,8,15,17(21),22-octaen-10-one 378229 NSC660032 sensitive
hsa-miR-136-5p 1h-pyrazole-1-ethanol, 4,4'-azoxybis(3,5-dimethyl- 301772 NSC179945 resistant
hsa-miR-136-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-136-5p 2-((1,4-dimethoxy-9-acridinyl)thio)-n,n-diethylethanamine 362326 NSC625985 resistant
hsa-miR-136-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-136-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-136-5p 2-(2-chloro-4,5-dimethoxyphenyl)-1-(1h-indol-3-yl)ethanone 266625 NSC105348 sensitive
hsa-miR-136-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-136-5p 2-(5-bromo-6-formyl-3-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2h)-yl)ethyl nitrate 383812 NSC672424 resistant
hsa-miR-136-5p 2-(7-amino-[1,2]thiazolo[4,5-d]pyrimidin-3-yl)-5-(hydroxymethyl)oxolane-3,4-diol 385012 NSC675865 resistant
hsa-miR-136-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-136-5p 2-(hydroxymethyl)-5-[6-[(2Z)-2-(pyridin-2-ylmethylidene)hydrazinyl]purin-9-yl]oxolane-3,4-diol 60147746 NSC752331 resistant
hsa-miR-136-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-136-5p 2-[(4-fluorophenyl)diazenyl]-1-oxo-3-phenyl-5h-pyrido[1,2-a]benzimidazole-4-carbonitrile 395420 NSC699956 resistant
hsa-miR-136-5p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 resistant
hsa-miR-136-5p 2-[(dimethylamino)methyl]-4-(phenylazo)phenol 384361 NSC674071 resistant
hsa-miR-136-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-136-5p 2-[2-[4-(3-chloro-1,4-dihydroxy-5,8-dioxonaphthalen-2-yl)piperazin-1-yl]ethoxy]ethyl acetate 378769 NSC661939 resistant
hsa-miR-136-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-136-5p 2-[4-(acridin-9-ylmethylamino)phenyl]sulfonylguanidine 335981 NSC348894 sensitive
hsa-miR-136-5p 2-acetamido-N-(4-chloro-3-oxo-1-phenylbutan-2-yl)-4-methylpentanamide 299926 NSC173905 resistant
hsa-miR-136-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-136-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-136-5p 2-bromo-6-(5-(4-methoxyphenyl)-3-isoxazolyl)-4-methylphenol 355054 NSC607993 sensitive
hsa-miR-136-5p 2-chloro-3-(1-(4-methyl)piperazino)naphthazarin 378627 NSC661420 resistant
hsa-miR-136-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-136-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-136-5p 2-imidazolidinethione, 1,3-bis(pentafluorobenzoyl)- 383506 NSC671891 resistant
hsa-miR-136-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-136-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-136-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-136-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-136-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-136-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-136-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-136-5p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 resistant
hsa-miR-136-5p 2,3,4a,8,12b-pentahydroxy-3-methyl-2,4-dihydrobenzo[a]anthracene-1,7,12-trione 43854 NSC368697 resistant
hsa-miR-136-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-136-5p 2,4,6-trichloro-n-(pyridin-3-ylmethyl)-n-[pyridin-3-ylmethyl-(2,4,6-trichlorobenzoyl)carbamothioyl]benzamide 401373 NSC714685 resistant
hsa-miR-136-5p 2,5-bis[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368963 NSC131233 resistant
hsa-miR-136-5p 2,5-dibenzyl-2-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368538 NSC639617 resistant
hsa-miR-136-5p 2,5-dichloro-3,6-bis-propionylamino-[1,4]benzoquinone 323616 NSC285233 resistant
hsa-miR-136-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-136-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-136-5p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 resistant
hsa-miR-136-5p 2,8-bis(3,4,5-trimethoxyphenyl)pyrano[3,2-g]chromene-4,6-dione 386069 NSC677640 sensitive
hsa-miR-136-5p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 resistant
hsa-miR-136-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-136-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-136-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-136-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-136-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-136-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-136-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-136-5p 3-[3,5-bis(trifluoromethyl)phenyl]-6-(4-fluorophenyl)-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazole 155809975 NSC756619 sensitive
hsa-miR-136-5p 3-bromo-2,4,6-trinitrotoluene 219376 NSC596 resistant
hsa-miR-136-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-136-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-136-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-136-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-136-5p 3-methyl-1-[5-(3-methyl-2,5-dioxopyrrol-1-yl)naphthalen-1-yl]pyrrole-2,5-dione 250323 NSC69577 resistant
hsa-miR-136-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-136-5p 3-N',5-N'-bis(2-hydroxybenzoyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarbohydrazide 377030 NSC658247 sensitive
hsa-miR-136-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-136-5p 3-piperidino-2-phenylpropiophenone 89341 NSC33568 resistant
hsa-miR-136-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-136-5p 3,4-dichlorocoumarin 282447 NSC135925 resistant
hsa-miR-136-5p 3,5,12,14-tetraethyl-7,8,9,10-tetrathia-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-dithione 365480 NSC633113 resistant
hsa-miR-136-5p 3h-xanthen-3-one, 2,6,7-trihydroxy-9-(o-hydroxy-phenyl)- 72722 NSC9037 sensitive
hsa-miR-136-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-136-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-136-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-136-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-136-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-136-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-136-5p 4-[(6-iodo-2-thiophen-2-ylquinazolin-4-yl)amino]-N-(1,3-thiazol-2-yl)benzenesulfonamide 404801 NSC721319 resistant
hsa-miR-136-5p 4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-3-phenyl-1h-1,2,4-triazol-5-one 9556349 NSC698058 resistant
hsa-miR-136-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-136-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-136-5p 4-[[4-[benzenesulfonyl(2-cyanoethyl)amino]-2-methylphenyl]methylideneamino]benzoic acid 369351 NSC641106 resistant
hsa-miR-136-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-136-5p 4-[4-(4-chlorophenyl)piperazin-1-yl]-6-(4-methoxyphenyl)-2-oxo-2h-pyran-3-carbonitrile 360621 NSC622926 sensitive
hsa-miR-136-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-136-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-136-5p 4-amino-6-(4-chlorophenyl)-14-nitro-3-oxatricyclo[9.4.0.02,7]pentadeca-1(11),2(7),4,12,14-pentaene-5-carbonitrile 401106 NSC714000 resistant
hsa-miR-136-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-136-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-136-5p 4-nitro-9h-thioxanthen-9-one 10,10-dioxide 378894 NSC662302 resistant
hsa-miR-136-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-136-5p 4-piperidinone, 1-methyl-2,6-bis[(2-nitrophenyl)methylene]- 5468197 NSC673650 resistant
hsa-miR-136-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-136-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-136-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-136-5p 5-(2-methylsulfonylpyrimidin-4-yl)-6-(3-phenylmethoxyphenyl)imidazo[2,1-b][1,3]thiazole 155804973 NSC763231 resistant
hsa-miR-136-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-136-5p 5-[(5s,8ar)-5-(4-fluoroanilino)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-3-methoxycyclohexa-3,5-diene-1,2-dione 369957 NSC642324 sensitive
hsa-miR-136-5p 5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(4-methoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374707 NSC759016 resistant
hsa-miR-136-5p 5-acetyl-1,3-diphenyl-6-(2-pyrrolidin-1-ylethylsulfanyl)-2-thioxo-pyrimidin-4-one NSC703439 resistant
hsa-miR-136-5p 5-acetyl-6-(2-diethylaminoethylsulfanyl)-1,3-diphenyl-2-thioxo-pyrimidin-4-one NSC707006 resistant
hsa-miR-136-5p 5-amino-6-(7-amino-6-methoxy-5,8-dioxo-1,2,3,4-tetrahydroquinolin-2-yl)-4-(2-hydroxy-3,4-dimethoxyphenyl)-3-methylpyridine-2-carboxylic acid 253712 NSC76919 sensitive
hsa-miR-136-5p 5-fluoro-4-methoxy-1-(5-oxo-2H-furan-2-yl)pyrimidin-2-one 330094 NSC315844 resistant
hsa-miR-136-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-136-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-136-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-136-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-136-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-136-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]pyrazine-2,3-dicarbonitrile 395616 NSC700361 resistant
hsa-miR-136-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanylmethyl]pyrazine-2,3-dicarbonitrile NSC708393 resistant
hsa-miR-136-5p 5,6-dimethoxy-n-(2-piperidin-2-ylethyl)quinolin-8-amine;hydroiodide 24182013 NSC13275 resistant
hsa-miR-136-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-136-5p 5,8-quinolinedione, 2-methyl- 388305 NSC682995 resistant
hsa-miR-136-5p 5h-naphtho[2,3-c][1]benzazepine-6,13-dione 386348 NSC678131 sensitive
hsa-miR-136-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-136-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-136-5p 6-(4-methoxyphenyl)-2-oxo-4-(4-phenylpiperazin-1-yl)-2h-pyran-3-carbonitrile 360619 NSC622924 sensitive
hsa-miR-136-5p 6-(5-nitropyridin-2-yl)sulfanyl-7h-purin-2-amine 3977545 NSC704077 resistant
hsa-miR-136-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-136-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-136-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-136-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-136-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-136-5p 6-bromochroman-2-one 266737 NSC105509 sensitive
hsa-miR-136-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-136-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-136-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-136-5p 6-N,6-N,8-N,8-N-tetraethylthieno[3,4-f]pentathiepine-6,8-diamine 406615 NSC724855 resistant
hsa-miR-136-5p 6,13-bis[3-[(2-chlorophenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone;4-methylbenzenesulfonic acid;hydrate 60147715 NSC752270 resistant
hsa-miR-136-5p 6,7-dimethyl-3-[4-(4-nitrophenyl)piperazin-1-yl]-1,4-dioxido-quinoxaline-1,4-diium-2-carbonitrile 394345 NSC697715 sensitive
hsa-miR-136-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-136-5p 7-[5-(diethylamino)pentoxy]-5-hydroxy-2-phenylchromen-4-one 24205488 NSC736041 resistant
hsa-miR-136-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-136-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-136-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-136-5p 8-azadenosine 251928 NSC72961 resistant
hsa-miR-136-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-136-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-136-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-136-5p 9-(2-chloroethylsulfinyl)-2,7-dimethoxy-acridine 395390 NSC699926 resistant
hsa-miR-136-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-136-5p 9-(oxan-2-yl)-1,3-diphenyl-2-sulfanylidenepurin-6-one 387937 NSC682242 sensitive
hsa-miR-136-5p 9-amino-5-methyl-N-[2-[4-[(4-nitrophenyl)methyl]morpholin-4-ium-4-yl]ethyl]acridine-4-carboxamide;chloride;hydrochloride 393528 NSC695586 sensitive
hsa-miR-136-5p 9-amino-7-(3,4,5-trimethoxyphenyl)-6h-benzo[c]chromene-8,10-dicarbonitrile 399086 NSC709502 sensitive
hsa-miR-136-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-136-5p 9-chloro-2-methylellipticinium acetate, hydrate 10383530 NSC632855 sensitive
hsa-miR-136-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-136-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium iodide 373612 NSC650262 sensitive
hsa-miR-136-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-136-5p 9-methoxy-2-methylellipticinium iodide 3086380 NSC155693 sensitive
hsa-miR-136-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-136-5p Active compound from cephalodiscus gilchristi 5458859 NSC363979 sensitive
hsa-miR-136-5p Ak136303 388306 NSC682996 resistant
hsa-miR-136-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-136-5p Ambrosin 257272 NSC85235 resistant
hsa-miR-136-5p Annamycin liposomal NSC700363 sensitive
hsa-miR-136-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-136-5p Antineoplastic-d648114 372647 NSC648114 sensitive
hsa-miR-136-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-136-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-136-5p Benzamido 2-methyl-5-phenyl-4-(p-tolyl)-1h-pyrrole-3-carboxylate 398159 NSC707691 sensitive
hsa-miR-136-5p Benzoyloxy-[[6-(benzoyloxymercuriomethyl)-1,4-dioxan-2-yl]methyl]mercury 16683646 NSC30915 resistant
hsa-miR-136-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-136-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-136-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-136-5p C11h7clo5 135409146 NSC659996 resistant
hsa-miR-136-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-136-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-136-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-136-5p Carquniostatin b 380452 NSC666034 resistant
hsa-miR-136-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-136-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-136-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-136-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive
hsa-miR-136-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-136-5p Deoxyartemisitene 6712468 NSC690035 resistant
hsa-miR-136-5p Destruxin b NSC236580 resistant
hsa-miR-136-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-136-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-136-5p Dienone b 100324 NSC289074 resistant
hsa-miR-136-5p Diethyl (E)-2-[5-chloro-3-(2-ethoxy-2-oxoethyl)-2,4-dioxopyrimidin-1-yl]but-2-enedioate 5470768 NSC704888 resistant
hsa-miR-136-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-136-5p Diethyl 2-[[2-[4-[(3-phenylquinoxalin-2-yl)amino]phenyl]acetyl]amino]pentanedioate 401477 NSC715135 sensitive
hsa-miR-136-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 sensitive
hsa-miR-136-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-136-5p Dimethyl 1-[(z)-2-[(z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1,2-bis(4-methoxyphenyl)ethenyl]pyrazole-3,4-dicarboxylate 5471659 NSC712735 resistant
hsa-miR-136-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-136-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-136-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-136-5p Eremantholide b 5478094 NSC380721 resistant
hsa-miR-136-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-136-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-136-5p Ethyl 3-(4-fluoroanilino)quinoxaline-2-carboxylate 387137 NSC680553 sensitive
hsa-miR-136-5p Ethyl 3-[4-[bis(2-chloroethyl)amino]phenyl]-2-[4-(7-chloro-2-oxo-5-phenyl-3h-1,4-benzodiazepin-1-yl)butanoylamino]propanoate 388729 NSC683782 resistant
hsa-miR-136-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-136-5p Ethyl 7-(1,3-benzodioxol-5-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399950 NSC711102 sensitive
hsa-miR-136-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-136-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-miR-136-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-136-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-136-5p Fixierer p 70397 NSC63839 resistant
hsa-miR-136-5p Geldanamycin analog 5358467 NSC255104 resistant
hsa-miR-136-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-136-5p Gtpl10345 378629 NSC661421 resistant
hsa-miR-136-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-136-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-136-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-136-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-136-5p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-136-5p Imidazole, 1-(4-chlorophenyl)-4-(4-nitrophenyl)- 355940 NSC610744 sensitive
hsa-miR-136-5p Inosine dialdehyde 135400916 NSC118994 resistant
hsa-miR-136-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-136-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-136-5p Isoquinoline, 1-(5-phenyl-4-p-tolyl-2-oxazolyl)- 272358 NSC116702 resistant
hsa-miR-136-5p Jatrophon 5281373 NSC135037 resistant
hsa-miR-136-5p Jolkinolide b 161954 NSC700087 resistant
hsa-miR-136-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-136-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-136-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-136-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-136-5p Ls-150387 365515 NSC633203 sensitive
hsa-miR-136-5p Ls-154710 380361 NSC665883 resistant
hsa-miR-136-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-136-5p Mcs-688 371061 NSC644960 sensitive
hsa-miR-136-5p Mcs-694 371067 NSC644966 sensitive
hsa-miR-136-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-136-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-136-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-(thiophen-2-ylmethylideneamino)but-2-enoate 5470184 NSC698280 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-[(3-methylthiophen-2-yl)methylideneamino]but-2-enoate 5470185 NSC698281 resistant
hsa-miR-136-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-136-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-136-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-136-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-136-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-136-5p Musennin 267361 NSC106554 sensitive
hsa-miR-136-5p Mycoin 4696 NSC32951 resistant
hsa-miR-136-5p Mycoin 4696 NSC32951 resistant
hsa-miR-136-5p N'-(cyano(3-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375018 NSC653844 sensitive
hsa-miR-136-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-136-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-136-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-136-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-136-5p N-(2-phenylethyl)-4-[[[3-(2-phenylthiazole-4-yl)acryloyl]amino]methyl]benzamide 5470485 NSC702131 sensitive
hsa-miR-136-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-136-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-136-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-136-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-136-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-136-5p N-[(Z)-(3-nitrophenyl)methylideneamino]-2-[2-[(2Z)-2-[(3-nitrophenyl)methylidene]hydrazinyl]-2-oxoethyl]sulfanylacetamide 9572668 NSC724063 sensitive
hsa-miR-136-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-136-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-136-5p N-[2-(1h-indole-3-yl)ethyl]-4-[[[3-[4-(benzyloxy)phenyl]acryloyl]amino]methyl]benzamide 5470479 NSC702125 sensitive
hsa-miR-136-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-136-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-136-5p N-1-adamantyl-2-(5-nitro-1h-indol-3-yl)-2-oxoacetamide 374150 NSC651607 sensitive
hsa-miR-136-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-136-5p N-methyl-2,4-dinitro-N-[(E)-quinolin-8-ylmethylideneamino]aniline 9555808 NSC630684 sensitive
hsa-miR-136-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-136-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-136-5p Ncichal_000043 393018 NSC694266 sensitive
hsa-miR-136-5p Ncimech_000601 264119 NSC99027 resistant
hsa-miR-136-5p Nobiletin 72344 NSC76751 resistant
hsa-miR-136-5p NSC337857 NSC337857 resistant
hsa-miR-136-5p NSC372474 NSC372474 resistant
hsa-miR-136-5p NSC618857 NSC618857 sensitive
hsa-miR-136-5p NSC671902 NSC671902 resistant
hsa-miR-136-5p NSC751830 NSC751830 resistant
hsa-miR-136-5p Ovatifolin acetate 5358419 NSC251668 resistant
hsa-miR-136-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-136-5p P-bromophenacyl benzoate 345792 NSC403572 resistant
hsa-miR-136-5p P-fuchsin 11292 NSC10460 sensitive
hsa-miR-136-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-136-5p Paucin 282787 NSC136722 resistant
hsa-miR-136-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-136-5p Pepleo 122804 NSC276382 sensitive
hsa-miR-136-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-136-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-136-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-136-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-136-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-136-5p Proflavine hcl 197873 NSC605756 resistant
hsa-miR-136-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-136-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-136-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-136-5p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 resistant
hsa-miR-136-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-136-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-136-5p Sangivamycin 5153 NSC65346 resistant
hsa-miR-136-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-136-5p Selendale 54601159 NSC347466 sensitive
hsa-miR-136-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-136-5p Stereoisomer of 672120 (mw=262) 5459262 NSC687011 resistant
hsa-miR-136-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-136-5p Stk134301 135400303 NSC715186 resistant
hsa-miR-136-5p Stl298328 387753 NSC681782 resistant
hsa-miR-136-5p Stl323102 375895 NSC656208 resistant
hsa-miR-136-5p Stl523755 334956 NSC342610 sensitive
hsa-miR-136-5p Suavedol 65631 NSC141545 resistant
hsa-miR-136-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-136-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-136-5p Thiosangivamycin 3006170 NSC105827 resistant
hsa-miR-136-5p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-136-5p Timtec1_008492 397075 NSC704388 sensitive
hsa-miR-136-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-136-5p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 resistant
hsa-miR-136-5p Tris(4-aminophenyl)methyl 3-hydroxy-4-[[2-hydroxy-3-[tris(4-aminophenyl)methoxycarbonyl]naphthalen-1-yl]methyl]naphthalene-2-carboxylate 16129848 NSC306107 sensitive
hsa-miR-136-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-136-5p Vorinostat 5311 NSC701852 approved resistant
hsa-miR-136-5p Withanolide e, 4-b-hydroxy- 73621 NSC212509 resistant
hsa-miR-136-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-136-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-136-5p Xyvptqbxfhrjjr-vhebqxmusa-n 139450 NSC70811 sensitive
hsa-miR-136-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive Low Glioma cell line (U87, U251)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (OV2008, C13)
hsa-miR-136-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-136-5p Docetaxel 148124 NSC628503 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-136-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-136-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-136-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-136-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-136-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-136-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-136-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-136-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-136-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-136-5p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission